ID: 1179218113

View in Genome Browser
Species Human (GRCh38)
Location 21:39384548-39384570
Sequence AAAAAATTGTCGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4825
Summary {0: 1, 1: 8, 2: 95, 3: 832, 4: 3889}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179218113_1179218117 5 Left 1179218113 21:39384548-39384570 CCACACCTGGCCGACAATTTTTT 0: 1
1: 8
2: 95
3: 832
4: 3889
Right 1179218117 21:39384576-39384598 TTTTTTAACTTTTAAGTTCAGGG 0: 278
1: 578
2: 736
3: 1125
4: 3471
1179218113_1179218116 4 Left 1179218113 21:39384548-39384570 CCACACCTGGCCGACAATTTTTT 0: 1
1: 8
2: 95
3: 832
4: 3889
Right 1179218116 21:39384575-39384597 TTTTTTTAACTTTTAAGTTCAGG 0: 242
1: 571
2: 868
3: 1572
4: 5196
1179218113_1179218119 18 Left 1179218113 21:39384548-39384570 CCACACCTGGCCGACAATTTTTT 0: 1
1: 8
2: 95
3: 832
4: 3889
Right 1179218119 21:39384589-39384611 AAGTTCAGGGATACATGTGCGGG 0: 88
1: 1371
2: 3301
3: 4038
4: 3547
1179218113_1179218118 17 Left 1179218113 21:39384548-39384570 CCACACCTGGCCGACAATTTTTT 0: 1
1: 8
2: 95
3: 832
4: 3889
Right 1179218118 21:39384588-39384610 TAAGTTCAGGGATACATGTGCGG 0: 4
1: 88
2: 163
3: 190
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179218113 Original CRISPR AAAAAATTGTCGGCCAGGTG TGG (reversed) Intronic
Too many off-targets to display for this crispr