ID: 1179218114

View in Genome Browser
Species Human (GRCh38)
Location 21:39384553-39384575
Sequence AAAAAAAAAAATTGTCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9985
Summary {0: 1, 1: 23, 2: 268, 3: 1489, 4: 8204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179218114_1179218117 0 Left 1179218114 21:39384553-39384575 CCTGGCCGACAATTTTTTTTTTT 0: 1
1: 23
2: 268
3: 1489
4: 8204
Right 1179218117 21:39384576-39384598 TTTTTTAACTTTTAAGTTCAGGG 0: 278
1: 578
2: 736
3: 1125
4: 3471
1179218114_1179218120 26 Left 1179218114 21:39384553-39384575 CCTGGCCGACAATTTTTTTTTTT 0: 1
1: 23
2: 268
3: 1489
4: 8204
Right 1179218120 21:39384602-39384624 CATGTGCGGGTTTGTTATATAGG 0: 14
1: 761
2: 2997
3: 8505
4: 11769
1179218114_1179218118 12 Left 1179218114 21:39384553-39384575 CCTGGCCGACAATTTTTTTTTTT 0: 1
1: 23
2: 268
3: 1489
4: 8204
Right 1179218118 21:39384588-39384610 TAAGTTCAGGGATACATGTGCGG 0: 4
1: 88
2: 163
3: 190
4: 339
1179218114_1179218119 13 Left 1179218114 21:39384553-39384575 CCTGGCCGACAATTTTTTTTTTT 0: 1
1: 23
2: 268
3: 1489
4: 8204
Right 1179218119 21:39384589-39384611 AAGTTCAGGGATACATGTGCGGG 0: 88
1: 1371
2: 3301
3: 4038
4: 3547
1179218114_1179218116 -1 Left 1179218114 21:39384553-39384575 CCTGGCCGACAATTTTTTTTTTT 0: 1
1: 23
2: 268
3: 1489
4: 8204
Right 1179218116 21:39384575-39384597 TTTTTTTAACTTTTAAGTTCAGG 0: 242
1: 571
2: 868
3: 1572
4: 5196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179218114 Original CRISPR AAAAAAAAAAATTGTCGGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr