ID: 1179218116

View in Genome Browser
Species Human (GRCh38)
Location 21:39384575-39384597
Sequence TTTTTTTAACTTTTAAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8449
Summary {0: 242, 1: 571, 2: 868, 3: 1572, 4: 5196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179218112_1179218116 7 Left 1179218112 21:39384545-39384567 CCACCACACCTGGCCGACAATTT 0: 3
1: 15
2: 244
3: 1758
4: 8676
Right 1179218116 21:39384575-39384597 TTTTTTTAACTTTTAAGTTCAGG 0: 242
1: 571
2: 868
3: 1572
4: 5196
1179218115_1179218116 -6 Left 1179218115 21:39384558-39384580 CCGACAATTTTTTTTTTTTTTTT 0: 100
1: 1069
2: 8953
3: 45243
4: 109410
Right 1179218116 21:39384575-39384597 TTTTTTTAACTTTTAAGTTCAGG 0: 242
1: 571
2: 868
3: 1572
4: 5196
1179218113_1179218116 4 Left 1179218113 21:39384548-39384570 CCACACCTGGCCGACAATTTTTT 0: 1
1: 8
2: 95
3: 832
4: 3889
Right 1179218116 21:39384575-39384597 TTTTTTTAACTTTTAAGTTCAGG 0: 242
1: 571
2: 868
3: 1572
4: 5196
1179218114_1179218116 -1 Left 1179218114 21:39384553-39384575 CCTGGCCGACAATTTTTTTTTTT 0: 1
1: 23
2: 268
3: 1489
4: 8204
Right 1179218116 21:39384575-39384597 TTTTTTTAACTTTTAAGTTCAGG 0: 242
1: 571
2: 868
3: 1572
4: 5196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179218116 Original CRISPR TTTTTTTAACTTTTAAGTTC AGG Intronic
Too many off-targets to display for this crispr