ID: 1179218118

View in Genome Browser
Species Human (GRCh38)
Location 21:39384588-39384610
Sequence TAAGTTCAGGGATACATGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 4, 1: 88, 2: 163, 3: 190, 4: 339}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179218112_1179218118 20 Left 1179218112 21:39384545-39384567 CCACCACACCTGGCCGACAATTT 0: 3
1: 15
2: 244
3: 1758
4: 8676
Right 1179218118 21:39384588-39384610 TAAGTTCAGGGATACATGTGCGG 0: 4
1: 88
2: 163
3: 190
4: 339
1179218115_1179218118 7 Left 1179218115 21:39384558-39384580 CCGACAATTTTTTTTTTTTTTTT 0: 100
1: 1069
2: 8953
3: 45243
4: 109410
Right 1179218118 21:39384588-39384610 TAAGTTCAGGGATACATGTGCGG 0: 4
1: 88
2: 163
3: 190
4: 339
1179218113_1179218118 17 Left 1179218113 21:39384548-39384570 CCACACCTGGCCGACAATTTTTT 0: 1
1: 8
2: 95
3: 832
4: 3889
Right 1179218118 21:39384588-39384610 TAAGTTCAGGGATACATGTGCGG 0: 4
1: 88
2: 163
3: 190
4: 339
1179218114_1179218118 12 Left 1179218114 21:39384553-39384575 CCTGGCCGACAATTTTTTTTTTT 0: 1
1: 23
2: 268
3: 1489
4: 8204
Right 1179218118 21:39384588-39384610 TAAGTTCAGGGATACATGTGCGG 0: 4
1: 88
2: 163
3: 190
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179218118 Original CRISPR TAAGTTCAGGGATACATGTG CGG Intronic
900277931 1:1844609-1844631 CAAGTACAGGTATACTTGTGGGG + Intronic
901214185 1:7545689-7545711 TAAGTTCCAGGATACATGTTAGG + Intronic
905380525 1:37558521-37558543 TAAGGTCAGGGATACATCGTAGG - Intronic
905848087 1:41250897-41250919 TAGGTTTGGGGATACATGTCAGG + Intergenic
906893739 1:49748025-49748047 TAAGTTTTGGGATACATGTGCGG + Intronic
906900378 1:49829639-49829661 TAAGTTCCGGAAAACATGTGCGG + Intronic
907060015 1:51412344-51412366 TAAGTTCTGGGATACATGTGTGG - Intronic
907684381 1:56595655-56595677 TAAGTTCTGGGATACATGTGCGG + Intronic
908174471 1:61540664-61540686 TAAGTTCAAGGATGCTTGGGAGG + Intergenic
908973139 1:69862718-69862740 TTAGTTCTGGGGTACATGTGCGG + Intronic
909681769 1:78299799-78299821 TGAGTTGAGGGATACATGTAGGG - Intergenic
909861350 1:80609769-80609791 TAAGTTCTGGGATACATGAGCGG + Intergenic
909991886 1:82233805-82233827 TAAGTTCCAGGGTATATGTGCGG + Intergenic
910119080 1:83764525-83764547 CAAGTTCAGGAAAAAATGTGTGG - Intergenic
910341967 1:86198867-86198889 TAAGTATAGGGATACAGGTGAGG - Intergenic
910889705 1:92005367-92005389 TATGTTCAAGGATGCATTTGGGG + Intronic
911311827 1:96302021-96302043 TAAGTTCTGGGGTACATGTGCGG - Intergenic
911362450 1:96896089-96896111 TAAGTTCTGACATACATGTGCGG + Intergenic
911514103 1:98846121-98846143 TAGGTTTAGGAGTACATGTGTGG + Intergenic
911690694 1:100830585-100830607 TAAGTTCCAGGATACATGTGCGG + Intergenic
911886519 1:103307627-103307649 TAAGTTCTGGGATACATTTGCGG - Intergenic
912592416 1:110837486-110837508 TAGATTTTGGGATACATGTGTGG + Intergenic
912725612 1:112056819-112056841 TGAGTTCAGGATTACCTGTGGGG - Intergenic
913669699 1:121084967-121084989 TAAGTTCCAGGGTACATGTGCGG + Intergenic
914021457 1:143872365-143872387 TAAGTTCCAGGGTACATGTGCGG + Intergenic
914659947 1:149780282-149780304 TAAGTTCCAGGGTACATGCGCGG + Intergenic
914999533 1:152576138-152576160 GAAGTTCAGGGGTACATGTGCGG - Intronic
916305087 1:163321632-163321654 TAAGTTCAGGGTGACAAGGGAGG - Intronic
916413414 1:164570231-164570253 TAAGTTCTGGAACACGTGTGTGG + Intronic
917009183 1:170451762-170451784 TAAGTTCTGGGATACATGCGCGG + Intergenic
917047970 1:170884579-170884601 TAAGTCCAGGGATACAGAAGGGG - Intergenic
917242535 1:172964311-172964333 TAAGTTCAGGGGTACATGTGTGG - Intergenic
917243492 1:172974753-172974775 TAAGTTCCAGGATGCATGTGTGG + Intergenic
917261751 1:173177097-173177119 TAGGTTCAGGGCTACATGTGTGG - Intergenic
917383895 1:174447467-174447489 TTAGTTCAGGGATTGATGTTGGG - Intronic
918536028 1:185575421-185575443 TAAGTAGAGGGATACATTTGTGG - Intergenic
919158671 1:193801063-193801085 TCAGTTCTGGGGTATATGTGTGG + Intergenic
919917574 1:202148340-202148362 TAAGTTCAGAGAGACATTGGAGG + Exonic
920327770 1:205180132-205180154 TAAGTTCTGGGATACATGTGGGG + Intronic
921424731 1:214988495-214988517 TAGGATCAAGGGTACATGTGTGG + Intergenic
921476163 1:215613111-215613133 TAAGTTCTGGGGTACATGTGCGG - Intronic
921761430 1:218919544-218919566 TAAGTTAAGTGATATGTGTGAGG - Intergenic
921777622 1:219120506-219120528 TAAGTTCAGGGATAAAGGAAGGG + Intergenic
923248643 1:232159057-232159079 TAGGTTCAGGGGTACACATGCGG - Intergenic
923481909 1:234393297-234393319 TAGGTTCACGGGTACATGTGCGG + Intronic
924667322 1:246086739-246086761 TAAGTTCTGGGATACATGTGCGG + Intronic
1063359696 10:5441451-5441473 GAAGTTCAGGGAAAAATGGGAGG + Intronic
1064871376 10:19941283-19941305 TTGGTTCAGGGATCCATGTGTGG - Intronic
1064883129 10:20079919-20079941 TAAGTTCTGGAATACATGTGCGG - Intronic
1065265201 10:23967969-23967991 TAAGTTTTGGGATACATGTGTGG + Intronic
1065899807 10:30195967-30195989 TAGGTTTGGGGGTACATGTGTGG + Intergenic
1066066429 10:31764589-31764611 TAAGTTCTGGGATACATGTGCGG - Intergenic
1066361928 10:34739697-34739719 TAAGTTTAGGGAAAGCTGTGAGG - Intronic
1066499798 10:35981561-35981583 TAAGTTCCAGGATACATGTGGGG + Intergenic
1066510978 10:36095577-36095599 TAAGTTCTGGGGTACATGTGTGG - Intergenic
1066667508 10:37800132-37800154 TAGGTTCAGGGGTACATGTACGG + Intronic
1067254505 10:44623438-44623460 TAAGATCTGGGATGCTTGTGTGG + Intergenic
1067328843 10:45295252-45295274 TAAGTTCTGGGATACATATGTGG + Intergenic
1067899221 10:50220746-50220768 TAAGTTCAGGAGTACATTTGCGG - Intronic
1068004160 10:51373450-51373472 TTAGTTCCAGGGTACATGTGCGG + Intronic
1068218800 10:54016856-54016878 TAGGTTCATAGATACATGTGTGG - Intronic
1068341361 10:55708346-55708368 TCAGGTCAAGGATAAATGTGGGG - Intergenic
1069028706 10:63572327-63572349 TAAGTTCTCGGATACATGTGCGG + Intronic
1069277453 10:66610310-66610332 TAAGTTCAGGGGTACATGTGCGG - Intronic
1069423496 10:68268918-68268940 TCAGTTCAGGGAGTCAAGTGAGG - Intergenic
1069487240 10:68831693-68831715 TAAGTTCAGGTCTACAACTGGGG - Intronic
1069503020 10:68971245-68971267 TAGGTTCAGGGGTACATGTGAGG + Intronic
1070498169 10:77044389-77044411 AAAGTGCTGGGATACAGGTGTGG - Intronic
1071187969 10:83065571-83065593 TAAGTTTTGGGGTACATGTGCGG + Intergenic
1071587263 10:86836451-86836473 TAAGTTCTGGGATACATGTGCGG + Intronic
1071951373 10:90706163-90706185 TATGTTCCTGGATACATGTACGG - Intergenic
1073651795 10:105368348-105368370 TAAGTTCGGCGATACTTATGGGG + Intergenic
1073885427 10:108034061-108034083 TAAGTTTTGGGATACACGTGCGG - Intergenic
1073904478 10:108261980-108262002 TAAGTTCAGGGGTACTCGTGTGG + Intergenic
1074025776 10:109632404-109632426 TAAGTTCTGGGATACATGTGCGG - Intergenic
1074026374 10:109640335-109640357 TAAGTTCAGGGATACAGGTATGG + Intergenic
1075189599 10:120294528-120294550 TGTTTTCAGGTATACATGTGAGG + Intergenic
1075654184 10:124150638-124150660 TAAGTTCAGGGACAGCTGAGAGG + Intergenic
1076206126 10:128604773-128604795 TAAGTTCCGGGATACATGTGAGG + Intergenic
1078380621 11:10836782-10836804 TAGATCCAGGGGTACATGTGAGG + Intronic
1079141046 11:17809891-17809913 TGAGTTCAGGAAAACATTTGGGG + Intronic
1079446351 11:20559824-20559846 TAAGTTCTGGGATACATGTGCGG - Intergenic
1079868439 11:25764410-25764432 TAAGTTTTGGTATACATATGCGG - Intergenic
1080286607 11:30621360-30621382 TAAGTTCATGGAACCATCTGAGG - Intergenic
1080996248 11:37605948-37605970 TAAGTTCTGGGATACATGTGCGG + Intergenic
1081022847 11:37968659-37968681 TAGAATCAGGGGTACATGTGAGG - Intergenic
1081272489 11:41102109-41102131 TAGGTTCAGGGGTACATGTACGG - Intronic
1081380001 11:42402837-42402859 TAGGTTCAGGGATACATGTACGG - Intergenic
1082676683 11:56113385-56113407 TAAGTTCAGGGATACATGTCAGG - Intergenic
1082872864 11:57959747-57959769 CCAGTTCAGTGATCCATGTGTGG + Intergenic
1085425181 11:76398248-76398270 TAAGGTGTGGGATACAAGTGAGG - Intronic
1086014004 11:82142375-82142397 TAAATTCTGGGGTACATGTGCGG - Intergenic
1086067437 11:82761504-82761526 TAAGTTCTGGGATACATGTGCGG + Intergenic
1086199943 11:84189956-84189978 TAAGTTCTGGGTTACATGTGCGG - Intronic
1086902416 11:92382847-92382869 TAAGTTCATGGGTACATGTGTGG + Intronic
1087328348 11:96750874-96750896 TAAGTTCAGGGGTACATGTGCGG + Intergenic
1087491754 11:98836945-98836967 TAAGTTCAGGGGTACATGTGCGG + Intergenic
1087679530 11:101203853-101203875 TAGGTTCTGGGTTACATGTGCGG + Intergenic
1087694802 11:101364501-101364523 TAAGTTCTGGGATACATGTGCGG + Intergenic
1087889126 11:103516905-103516927 TAAGTTCTGGGGTACATGTGAGG - Intergenic
1088424175 11:109683615-109683637 TAGGTTCAGGAGTACATGTGCGG - Intergenic
1089002397 11:115062936-115062958 TAAGTTCCAGGGTACATATGCGG + Intergenic
1089673319 11:120072239-120072261 TAGGTTCTGGGATACAGATGGGG + Intergenic
1090114645 11:123955624-123955646 TTAGTTCTGGGGTACATGTGTGG - Intergenic
1091349793 11:134883903-134883925 GAAGTTCAGGGGTACATGTGTGG + Intergenic
1091389134 12:115064-115086 TAACTGCAGGGAAACAAGTGGGG + Intronic
1093056162 12:14557805-14557827 TAAGTTCAGGGATACATGTGCGG - Intronic
1093446290 12:19262845-19262867 TAGGTTCAGGGGTACACATGTGG - Intronic
1094111590 12:26868446-26868468 TAAGTTCTGGGGTACATGTGTGG - Intergenic
1094139471 12:27165848-27165870 TAAGTTCTGGGATACATGTGCGG + Intergenic
1094279268 12:28717159-28717181 TAAGTTCTAGGATACACATGAGG - Intergenic
1094310676 12:29077345-29077367 TAAGTTCCAGGATGCATGTGAGG - Intergenic
1094785518 12:33844053-33844075 TAAATTCAGGGATACATGGCAGG - Intergenic
1095129167 12:38518421-38518443 TAAGTTCTGGGGGACAAGTGTGG + Intergenic
1095903614 12:47354498-47354520 TAGATTCAGGGATACATGTGTGG - Intergenic
1095903677 12:47355249-47355271 TAGATTCGGGGATACATGTCTGG + Intergenic
1096012425 12:48231438-48231460 TAAGATCAGGGGTACCTGTGCGG + Intergenic
1096317157 12:50577767-50577789 TAATTTCTGGGATACATGTGAGG - Intronic
1096370959 12:51068638-51068660 TAAATTAGGGGATACATGTCTGG - Intronic
1096581521 12:52588651-52588673 TAAGTTCTAGGGTACATGTACGG - Intronic
1097318048 12:58194359-58194381 TAGGTTCAGGGGTCCATGTAAGG + Intergenic
1097773716 12:63621178-63621200 TAAGTTCTGGGGTACATGTGCGG - Intronic
1098674607 12:73272975-73272997 TAAGTTCATGGGTACATGTCAGG - Intergenic
1098683376 12:73386336-73386358 TAAGTCTTGGTATACATGTGAGG - Intergenic
1098701908 12:73639146-73639168 TAAGTTCCAGGGTATATGTGCGG - Intergenic
1098999847 12:77166658-77166680 TAGGTTCAGGGGTATATGTGAGG - Intergenic
1099283687 12:80687514-80687536 TAAGTTCTGGGATACCTGTGAGG - Intergenic
1099636221 12:85216044-85216066 TAAGTTCTGAGGTACATGTGCGG + Intronic
1099927428 12:89034675-89034697 TAAGTTCTGGGATACATCTGGGG - Intergenic
1100065146 12:90634681-90634703 TAAGTTCTAGGACACATGTATGG - Intergenic
1100130584 12:91488190-91488212 TAAGTTCTGGGATACATGTGTGG - Intergenic
1101046085 12:100807581-100807603 TAAGCTCAGGGGTACAAGTGTGG + Intronic
1101069273 12:101056877-101056899 CAAGTTCTGGGATACATGTGTGG + Intronic
1101145560 12:101837433-101837455 TAAGATTAGGGATACATTTCTGG - Intergenic
1101172989 12:102119386-102119408 TAAGTTCCGGGATACGTGTGCGG - Intronic
1101206046 12:102488511-102488533 TAAGTTCTGGAATACATGTGTGG + Intergenic
1102659264 12:114511697-114511719 TAAGTTCCAGGGTACAGGTGCGG - Intergenic
1103199251 12:119073180-119073202 GAAGTTCAGGGATGTATATGAGG + Intronic
1103206327 12:119131929-119131951 AAAGTTCAGGGGTGCTTGTGGGG + Intronic
1103667627 12:122582580-122582602 TAGATTCAGGGGTACATGTCTGG - Intronic
1104305312 12:127605115-127605137 TAGTTTCAGGGGTACATGTGCGG + Intergenic
1104330118 12:127836818-127836840 TAAATTCTGGGATACATGTGAGG + Intergenic
1104392426 12:128402251-128402273 TAAGTTCATGGGTATATGTGAGG + Intronic
1104555545 12:129796847-129796869 TAAGTTCTGGGGTACATGTGCGG - Intronic
1104743933 12:131198670-131198692 TAAGTTCATGGATAGGGGTGTGG + Intergenic
1104902257 12:132195849-132195871 TAGATTCATGGGTACATGTGTGG + Intergenic
1105539974 13:21307768-21307790 TGACTTCTGGGATCCATGTGTGG + Intergenic
1105835473 13:24207353-24207375 TAAGTTCAGGGGTACATGTGCGG - Intronic
1106858935 13:33883911-33883933 TAAGTTCAGGGGTACAAGTGCGG - Intronic
1106866483 13:33969942-33969964 TATGTTCCGGGGTACATGTACGG + Intergenic
1107275482 13:38673732-38673754 GAAATTCAGGGGAACATGTGTGG + Intergenic
1109281176 13:60357523-60357545 TAAGTTCTGGGATACATGTGCGG + Intergenic
1109406875 13:61911779-61911801 TATGTTCAGAGATAAATATGAGG + Intergenic
1109536046 13:63721343-63721365 TAAGTTAAGGAATAAATGAGAGG + Intergenic
1109540054 13:63764943-63764965 TAAGTTAAGGAATAAATGAGAGG - Intergenic
1109636288 13:65122368-65122390 GAAGTTCAGGAGTACATGTGCGG + Intergenic
1109809326 13:67490555-67490577 TAAGTTCTGAGGTACATGTGCGG + Intergenic
1109890398 13:68604128-68604150 TAATTTCAGGGGAACAAGTGCGG + Intergenic
1109925649 13:69135063-69135085 TAAGTTCAGGAATACATGTCCGG + Intergenic
1110023288 13:70503406-70503428 TAAGTTCCAGGATACATGTGTGG + Intergenic
1110246495 13:73330841-73330863 TAGGTTCAGGGGAACATGTGCGG - Intergenic
1110639305 13:77803461-77803483 TAAGTTCAGCAGTACAAGTGCGG - Intergenic
1111167365 13:84477030-84477052 TAAGTTCTGGGATACATGTGTGG - Intergenic
1111289516 13:86145779-86145801 TAAGTTCTGAAATACACGTGTGG - Intergenic
1111318745 13:86595805-86595827 TAGGTTCAAACATACATGTGAGG - Intergenic
1111347133 13:86973608-86973630 TCATTTCAGGGTGACATGTGGGG - Intergenic
1111715980 13:91879161-91879183 TAAGTTCTGGGATACATGTGCGG + Intronic
1112671917 13:101650646-101650668 TAATTTCTAGGGTACATGTGCGG + Intronic
1113144761 13:107196275-107196297 TAAGTTCAGGGGTACATGCATGG - Intronic
1113187216 13:107702559-107702581 TAAGTTCAGGGGTACATGTCAGG + Intronic
1113663643 13:112125626-112125648 TAAGCTCCAGGGTACATGTGAGG - Intergenic
1114056441 14:18971705-18971727 TACATTCAGGGGTACATGTGCGG - Intronic
1114106109 14:19430022-19430044 TACATTCAGGGGTACATGTGCGG + Intronic
1114692579 14:24598393-24598415 TAAGTTCTGGGATACACGTGTGG + Intergenic
1114754383 14:25242861-25242883 TAAGTTTAAGGGTACATGTGTGG - Intergenic
1114906281 14:27131300-27131322 TGGGCTCAGGGGTACATGTGTGG + Intergenic
1115446701 14:33498803-33498825 TAAGTTCTGGGATACGTGTGCGG - Intronic
1115713616 14:36077292-36077314 TAAGTTCAGGGGTACATGTGCGG + Intergenic
1115798980 14:36971064-36971086 ACAGTTCAGGTAAACATGTGAGG + Intronic
1115908016 14:38222931-38222953 TAATTTCTGGGGTACATGTGCGG + Intergenic
1116180609 14:41527363-41527385 TAAGTTCCAGGATACATGCATGG - Intergenic
1116302172 14:43196756-43196778 TAAGTTCAGGGGCATATATGCGG - Intergenic
1116575360 14:46567671-46567693 TAAGTTCAAGGGTACATGTACGG + Intergenic
1116649550 14:47571875-47571897 TAAGTTCTGGGATACGTGTGTGG - Intronic
1116874766 14:50099993-50100015 TAAGTTCCGGGATACATGTACGG + Intergenic
1116918287 14:50546860-50546882 TAAGTTCTGGGGTACATGTGCGG + Intronic
1119009380 14:70968994-70969016 AAAGTTAAGAGAAACATGTGAGG - Intronic
1119876803 14:78066754-78066776 TAGGTTCAGGACTACATGTGCGG + Intergenic
1120260292 14:82175989-82176011 TTAGTTCTGAGGTACATGTGCGG + Intergenic
1120705163 14:87738283-87738305 TAACTTCATGAATATATGTGGGG + Intergenic
1120935872 14:89894271-89894293 TAAGTTCTGGGATACATGTGCGG + Intronic
1121953123 14:98189460-98189482 AAAATTCAGGGAGAAATGTGAGG + Intergenic
1123452318 15:20376540-20376562 TAAGTTCTTGGATATATATGAGG - Intergenic
1123736750 15:23192107-23192129 TCAGTTCTGGGATACATGCACGG + Intergenic
1124202119 15:27687336-27687358 AAAGTTCAGGGATGTATGTGAGG - Intergenic
1124287448 15:28415085-28415107 TCAGTTCTGGGATACATGCACGG + Intergenic
1124287970 15:28420787-28420809 TCAGTTCTGGGATACATGCAAGG + Intergenic
1124289717 15:28439166-28439188 TAAGCTCTGGGTTACATGTGCGG + Intergenic
1124293504 15:28478145-28478167 TAAGCTCTGGGTTACATGTGCGG - Intergenic
1124295254 15:28496540-28496562 TCAGTTCTGGGATACATGCACGG - Intergenic
1125038913 15:35160460-35160482 TAGGTTTAGGGGTACATTTGTGG + Intergenic
1125365274 15:38907516-38907538 TAAGTTCCGGGATACATGTGCGG + Intergenic
1125401180 15:39304940-39304962 AAAGTTCAGGGATGGATGTTAGG - Intergenic
1126513787 15:49511472-49511494 TAAGTTCCAGGGAACATGTGTGG + Intronic
1126531365 15:49714384-49714406 TAAGTTCTAGGATACATGTGCGG - Intergenic
1126877658 15:53061609-53061631 TAAGTTCCAGGGTACATGTGTGG + Intergenic
1126886594 15:53157814-53157836 AAAGATCAGGAATACCTGTGAGG - Intergenic
1126951139 15:53883030-53883052 TAAGTTCAGGGGTACATGTGCGG - Intergenic
1126959178 15:53970810-53970832 TAAGTTCCAGCATCCATGTGTGG - Intergenic
1128725535 15:69985734-69985756 TAAGTTCTGGGATACATGTGCGG - Intergenic
1128850441 15:70949828-70949850 TAAGTTCGGGGCTACATATGCGG + Intronic
1129572769 15:76706786-76706808 TAAATTCTGGGATACATGAGGGG - Intronic
1129808820 15:78489343-78489365 TAACTTCTGGGGTACATATGCGG - Intronic
1129931324 15:79413213-79413235 TAAGTTTAGGGGTACATGTGCGG - Intronic
1130129063 15:81121723-81121745 TAAGTTCAGGGGTACATGTGCGG + Intronic
1131293952 15:91130940-91130962 CAAGTTCAGGAACACATGGGAGG + Intronic
1131790504 15:95959286-95959308 TAAGTTTTAGGGTACATGTGTGG - Intergenic
1131800453 15:96063959-96063981 TGACTTCCGGGATACATGTGCGG - Intergenic
1131801626 15:96075162-96075184 TAAGTTCAAGGATATATATTTGG - Intergenic
1133531626 16:6660374-6660396 TTAGTTCTGGGGTACATGTGCGG - Intronic
1133637349 16:7680644-7680666 TCAGTTTAGAGATACCTGTGTGG - Intronic
1133881201 16:9784096-9784118 GAAGTTCATGGGTACATGTACGG - Intronic
1134299615 16:12977952-12977974 TAAGTTCCAAGGTACATGTGCGG - Intronic
1134773737 16:16833765-16833787 TAAGCTCAGGAATACAAGTGCGG + Intergenic
1135141326 16:19924565-19924587 TAAGTGCTGGGATACAAGTGGGG + Intergenic
1135351667 16:21734496-21734518 TAAGTTCAGGGGTACATGGCAGG - Intronic
1135450148 16:22550623-22550645 TAAGTTCAGGGGTACATGGCAGG - Intergenic
1135470389 16:22724162-22724184 TCAGTTCTGGGATACATGTGCGG - Intergenic
1136162689 16:28430892-28430914 TAGGTTCAGGGAGGCGTGTGTGG + Intergenic
1136200277 16:28684096-28684118 TAGGTTCAGGGAGGCGTGTGTGG - Intergenic
1136216625 16:28798289-28798311 TAGGTTCAGGGAGGCGTGTGTGG - Intergenic
1136408751 16:30064673-30064695 GAAGATCGGGGACACATGTGGGG + Intronic
1136775102 16:32867691-32867713 TAGATTGAGGAATACATGTGAGG + Intergenic
1136895516 16:33993821-33993843 TAGATTGAGGAATACATGTGAGG - Intergenic
1137067655 16:35865168-35865190 TAAGTTCCAGAATACATGTGCGG + Intergenic
1137969669 16:52972175-52972197 TAAGTTCTGGGATACATGTGTGG + Intergenic
1138027520 16:53534169-53534191 TAAGTTCCAGAATACATGTTAGG + Intergenic
1138790209 16:59895148-59895170 TATGTTAATGTATACATGTGTGG + Intergenic
1138884953 16:61065251-61065273 TAAGTTCTGGGATACACATGCGG - Intergenic
1138921762 16:61539023-61539045 TAAGTTCAGGGGTACATGTCAGG - Intergenic
1138929635 16:61636764-61636786 TAAGTTCAGTGGTACACGTGTGG + Intergenic
1138944888 16:61837106-61837128 TATTTTCAGAGATAAATGTGAGG - Intronic
1139135276 16:64196087-64196109 AAAGTTCAGGGGTACATATGTGG - Intergenic
1139162027 16:64521606-64521628 TAAGTTCCTGGGTACATGTGAGG + Intergenic
1140018312 16:71210630-71210652 TAGGTTCAGGGGTACATGTGTGG - Intronic
1140554036 16:75900242-75900264 CAAGTTCTGGGATACATGTGCGG + Intergenic
1140559885 16:75966752-75966774 TAAGTTCTAGGATACATGTGCGG - Intergenic
1140654746 16:77128029-77128051 TATGTTGAGGGGTACATGAGTGG - Intergenic
1141193075 16:81838744-81838766 TAAGTTCTGGGATACATGTGCGG - Intronic
1141276113 16:82589690-82589712 TAGGTTCAGGGGTGCACGTGCGG + Intergenic
1142317813 16:89359911-89359933 TAGGTTCGGGGGCACATGTGAGG + Intronic
1203077520 16_KI270728v1_random:1129800-1129822 TAGATTGAGGAATACATGTGAGG + Intergenic
1142906426 17:3045567-3045589 TAAGTTCTGGGGTACATGTGCGG + Intergenic
1143279643 17:5743271-5743293 TAAGGTCAGTGATATATTTGGGG + Intergenic
1143821444 17:9567274-9567296 CAAGTTCAGGGGTACATATGTGG - Intronic
1143849192 17:9796951-9796973 TAAGTTCTGGGATACATGTGCGG + Intronic
1146613764 17:34334428-34334450 TAAGTTCTGGGATACATGTGTGG + Intergenic
1147457385 17:40546367-40546389 TAAGGTCCAGGATACATGTGCGG + Intergenic
1150458182 17:65325253-65325275 TCAGTTCTGGGAAACATTTGAGG + Intergenic
1150919940 17:69472250-69472272 TAGATTCGGGGGTACATGTGCGG - Intronic
1151020035 17:70604349-70604371 TAAGTTCAAGGGTTCAAGTGCGG + Intergenic
1151104219 17:71593837-71593859 TAAGTTCTGGGGTACATGTGCGG + Intergenic
1152581325 17:81166594-81166616 AAGGTTCAGGGAGACAGGTGGGG + Intergenic
1153003969 18:481080-481102 TAAATTCACGCACACATGTGAGG - Intronic
1153104336 18:1510220-1510242 TAAGTTCTGGGATTCCTGTTTGG + Intergenic
1153227274 18:2908399-2908421 TATGTGCATGGATACATGGGTGG - Intronic
1153526876 18:6005032-6005054 TTAGTTCAGGAGTACGTGTGTGG + Intronic
1154461492 18:14593652-14593674 TAAGTTCAGAGGTACATGTGCGG + Intergenic
1154933856 18:21030592-21030614 TAAATTCTGAGATACAAGTGGGG + Intronic
1155017293 18:21856696-21856718 TAAGCTCTGGGATACATGTGCGG - Intronic
1155175161 18:23295336-23295358 TTAATTCTGGGGTACATGTGCGG - Intronic
1155635926 18:27955335-27955357 TAAATTCTGAGATACATGTGCGG - Intronic
1156769640 18:40703499-40703521 TAAGTTCTGAGATACATGTGTGG - Intergenic
1156913479 18:42438687-42438709 AAAGTTCCGGGATACACGTGTGG + Intergenic
1157052542 18:44184116-44184138 TATGTTCAGAGTTAAATGTGTGG - Intergenic
1157826119 18:50813964-50813986 TAGTTTCAGGGGTACATGTGTGG - Intronic
1157988482 18:52467070-52467092 TAAGTTCTGGGATACATGTGCGG + Intronic
1158031836 18:52975377-52975399 TAAGTTCAGGGGTACTCGTGCGG + Intronic
1158645493 18:59242021-59242043 TAGGTTCAGGGGTACATACGTGG - Intergenic
1158692073 18:59669709-59669731 GAAGTTCGGGGAGAGATGTGAGG - Intronic
1158692653 18:59674587-59674609 TAAGTTCTGGGATACATGTGCGG - Intronic
1158858383 18:61567342-61567364 TAAGTTCACGGGTACATGTGCGG + Intergenic
1159113234 18:64084454-64084476 CAAGTTCAGCGGTACATGTGCGG - Intergenic
1159224094 18:65508932-65508954 TAAGTTCAGGGGAATACGTGTGG - Intergenic
1159295264 18:66478411-66478433 TAAGTTCAGGAATATATGTGCGG + Intergenic
1159321758 18:66860131-66860153 TAAGTTCTGAGATACATGTGCGG - Intergenic
1159448797 18:68573927-68573949 TAAGTTCTGGGATACGTGTGCGG - Intergenic
1159610919 18:70524797-70524819 TAGGTACAGGGGTACATGTTGGG + Intergenic
1160253486 18:77225273-77225295 TAAGTTCAGGGGTACATGCATGG + Intergenic
1160275105 18:77425067-77425089 TAGATTCAGGGGTACACGTGCGG + Intergenic
1161227390 19:3153338-3153360 TAAGTTGAGGGATAGATGAGTGG + Intronic
1162011230 19:7816502-7816524 TAAGTTCAGGGGTATATGTGTGG - Intergenic
1162225216 19:9215400-9215422 TAAGTTCATAGATACAAATGGGG - Intergenic
1165003191 19:32781990-32782012 AAAGTTCTGGGTTACATGTGCGG + Intronic
1165654656 19:37522706-37522728 TAGGTTCAGGTATGCATTTGGGG + Intronic
1168028558 19:53661835-53661857 TAAGTTCTGGGATACACATGCGG + Intergenic
1168503508 19:56913490-56913512 TAAGTTCTGGGATACATGTGCGG - Intergenic
1202649066 1_KI270706v1_random:164613-164635 AAAGTTCAGAAATAAATGTGGGG + Intergenic
925415190 2:3665327-3665349 TAAGTTCTGGGATACATGTGCGG + Intronic
925858900 2:8156299-8156321 TAAATTCTGGGGTACATGTGAGG - Intergenic
926169477 2:10543276-10543298 TAAGTACAATAATACATGTGTGG + Intergenic
926188664 2:10711123-10711145 TAAGTTCAGGGGTACATGGCCGG - Intergenic
926260193 2:11252912-11252934 TAAGTTCTGGGATACATGCACGG - Intronic
926482873 2:13421791-13421813 TAAGTTCTTGGATATATATGAGG + Intergenic
926854121 2:17233639-17233661 TAGGTTCAGGCATACATGTGAGG - Intergenic
926960283 2:18350756-18350778 TAAGTTCAGGGGTAAAAGTGTGG + Intronic
926985172 2:18614654-18614676 TAAGTTCTAGAGTACATGTGCGG + Intergenic
927175455 2:20403217-20403239 TAGGTTTAGGGGTACATTTGAGG + Intergenic
928246690 2:29635800-29635822 TAAGTTCTAGGGTACATGTGAGG + Intronic
928388187 2:30887219-30887241 TTTTTTCAGGGATATATGTGGGG + Intergenic
928503390 2:31922495-31922517 TAAGTTCAAGGGTACCTGTACGG + Intronic
928693537 2:33825082-33825104 TAGGTTCAGGGTTGCCTGTGTGG + Intergenic
930286644 2:49437152-49437174 TAAGTTCTGGGTTACATGTGCGG - Intergenic
930482875 2:51971525-51971547 TAACTTCTGGGATACACGTGCGG + Intergenic
930548432 2:52799901-52799923 TAAGTTCAGGGTTACATGTGCGG - Intergenic
931071556 2:58657286-58657308 TGTGTTCAAGGATGCATGTGTGG + Intergenic
931385428 2:61793899-61793921 TAAGTTCTGGGATACATGTGCGG + Intergenic
931539080 2:63308859-63308881 TAGGTTCTTGGACACATGTGCGG - Intronic
931901065 2:66788709-66788731 TAAGTTCAGGGATACAAGTGCGG + Intergenic
932068843 2:68595642-68595664 TCAGTTCCAGGGTACATGTGCGG + Intronic
932185664 2:69693447-69693469 TAAGCTCAGTGAGACATTTGGGG + Intronic
933105667 2:78321928-78321950 TAAGTTCTGGGATACAAGTGCGG - Intergenic
933365348 2:81346735-81346757 AAACTTCAGAGATACATATGTGG + Intergenic
933500757 2:83108073-83108095 TAAGTTCAGCAGTACATGTGTGG - Intergenic
933568012 2:83974976-83974998 TAAGTTCTGGGATACATGTGTGG - Intergenic
934126750 2:88901229-88901251 TAAGTTCCAGGATATATGTATGG + Intergenic
934564638 2:95331468-95331490 GAAGTGGAGGGATACATTTGGGG + Intronic
934792515 2:97073785-97073807 TAAGTTCAGAGGTACACGTGCGG + Intergenic
934814103 2:97309896-97309918 TAAGTTCAGAGGTACACGTGCGG - Intergenic
934823592 2:97398585-97398607 TAAGTTCAGAGGTACACGTGCGG + Intergenic
935521669 2:104113638-104113660 TAAGTTCAGGGGTACATGTGCGG - Intergenic
935656109 2:105424989-105425011 TAAGTTCTGGGGTACATGTACGG - Intronic
936173447 2:110197264-110197286 TAAGTTCAGGGATACATGTATGG - Intronic
936340159 2:111623953-111623975 TAAGTTCCAGGGTTCATGTGCGG + Intergenic
936808519 2:116367428-116367450 TAAGTTCTGGGATACATGTGTGG + Intergenic
936829501 2:116625557-116625579 TAAGTTCTGGGATACATATTTGG - Intergenic
937571706 2:123371015-123371037 TAGGTTCAGGGGTACATGTGCGG - Intergenic
937587139 2:123566570-123566592 TGAATTCAGGTGTACATGTGTGG - Intergenic
937632657 2:124120899-124120921 TAAGTTGAGGAAGGCATGTGAGG + Intronic
938114388 2:128593466-128593488 TAGGTTCAGGGGTACATGCGTGG - Intergenic
938115778 2:128602192-128602214 TGAGTTCAGTGAGACATGTCAGG - Intergenic
938691111 2:133790220-133790242 AATGTTTAGGGATGCATGTGAGG - Intergenic
939402112 2:141708193-141708215 TAAGTCCTGGGATACATGTGCGG - Intronic
939869974 2:147516065-147516087 TAAGTTCTGGAATACATGTACGG + Intergenic
940547535 2:155107661-155107683 TAAATTCAGGGGTACAGGTATGG - Intergenic
941181166 2:162260996-162261018 TAAGTTCCAGGATACACTTGTGG - Intergenic
941360549 2:164546472-164546494 TGAGTTCTGGGATACTTCTGGGG - Intronic
941756027 2:169187091-169187113 TAAGTTCAGGGGTACATGTGCGG + Intronic
941810873 2:169755013-169755035 TAAGTTCCCGGGTAGATGTGCGG + Intronic
943621327 2:190151223-190151245 TAAGTTCTAGGATACATGTGCGG + Intronic
943628339 2:190223238-190223260 TAAGTTCTGGGTTACATGTGCGG - Intronic
943923990 2:193747181-193747203 TAAGTTCAAGGGTACGTATGCGG - Intergenic
943988303 2:194652752-194652774 TAAGTTCACTGAAAGATGTGGGG + Intergenic
944420345 2:199523481-199523503 CAAGTTCAGGGGTACACGTATGG + Intergenic
944839127 2:203608513-203608535 TAATTTCTGGGATACATGTACGG + Intergenic
945462190 2:210121622-210121644 TAAGTTCAGGGGTACAAGTGCGG - Intronic
945913720 2:215680452-215680474 TAAGTTCCGAGATACATGTGAGG - Intergenic
945917761 2:215722016-215722038 TAAGTTCTGGGATACATGTGCGG - Intergenic
946510430 2:220349903-220349925 TCAGTTCAGGGATCCATTTGTGG + Intergenic
946830666 2:223725266-223725288 TATCTGCAGGGGTACATGTGTGG - Intergenic
947393993 2:229669334-229669356 AAAGTTCTGGGATACATGTGCGG - Intronic
948722541 2:239910693-239910715 TGAGTTCGGGGGTACAGGTGCGG - Intronic
948791703 2:240382263-240382285 TAAGTTCCGGTATCCGTGTGTGG - Intergenic
1168773111 20:428624-428646 TAAGTTCTGGGATCCAGGTGGGG + Intronic
1169205415 20:3737356-3737378 TGAAATCAGGAATACATGTGAGG - Intronic
1169726859 20:8744137-8744159 TAGGTTCAGGGGTACACATGAGG - Intronic
1169997319 20:11572662-11572684 TAAGTTCTGGGATACATGTGCGG - Intergenic
1170517014 20:17140580-17140602 TAAGTTCTGGGATACATGTGCGG - Intergenic
1171156855 20:22882448-22882470 TAAGTTCAGCGGTATATGTGCGG + Intergenic
1173046427 20:39517169-39517191 TAAGTGCAGAGACAGATGTGGGG - Intergenic
1173134683 20:40428944-40428966 TAAGTTCAGGGGTACATGTCCGG - Intergenic
1173295906 20:41756711-41756733 TAAGTTCAGGGGTACCTGTGTGG + Intergenic
1174546855 20:51332138-51332160 TAAGTTCCAAGATACATGTGCGG + Intergenic
1174840146 20:53893750-53893772 TAGGTTCAGGGGTACACGTGCGG + Intergenic
1174888186 20:54359070-54359092 TAAGTTCAGGGGTACATGGCAGG + Intergenic
1175434404 20:58933081-58933103 TAAGTTCTGGGACATACGTGTGG - Intergenic
1176602748 21:8807929-8807951 AAAGTTCAGAAATAAATGTGGGG - Intergenic
1176720092 21:10385619-10385641 TAGGTCCAGGGGTACATGTGTGG + Intergenic
1176720267 21:10387024-10387046 TAGGTCTAGGGGTACATGTGTGG + Intergenic
1176813015 21:13564189-13564211 TAAGTTCAGAGGTACATGTGCGG - Intergenic
1176994681 21:15541709-15541731 TAAGTTCTAGGATACATGTGTGG - Intergenic
1177111145 21:17030965-17030987 TAAGAAAAGGGATACATTTGGGG - Intergenic
1177762077 21:25413457-25413479 AAAGTTCTGGGGTACATGTGCGG - Intergenic
1177777661 21:25586866-25586888 ACAGTTCAGGTGTACATGTGGGG - Intronic
1177852111 21:26360814-26360836 TAAGTTCAGGAGTACATGAGCGG - Intergenic
1177874421 21:26613349-26613371 TAAGTAAAAGGACACATGTGAGG - Intergenic
1178133948 21:29605075-29605097 TAAGATCAGGGGTACATGTGCGG + Intronic
1178748425 21:35276412-35276434 TAACTTAAGGGATACATTTCTGG + Intronic
1179218118 21:39384588-39384610 TAAGTTCAGGGATACATGTGCGG + Intronic
1179380297 21:40892358-40892380 TATGTTCAGGGGTACAAGTGTGG - Intergenic
1179497531 21:41782768-41782790 CAAGGTCTGGGAGACATGTGTGG + Intergenic
1180136409 21:45865202-45865224 CAAGTTCTGGGATACACGTCAGG - Intronic
1180254261 21:46612953-46612975 TAAGTTCAGGGGTATATGTGTGG + Intergenic
1180301296 22:11038396-11038418 TAGGTCCAGGGGTACCTGTGCGG + Intergenic
1180301465 22:11039774-11039796 TAGGTCTAGGGGTACATGTGTGG + Intergenic
1180345033 22:11699486-11699508 AAAGTTCAGAAATAAATGTGGGG - Intergenic
1180352705 22:11817375-11817397 TGAGTTCAGAAATAAATGTGGGG + Intergenic
1180385545 22:12174982-12175004 TAAGTTCAGAAATAAATGTGGGG - Intergenic
1180474927 22:15694316-15694338 TACATTCAGGGGTACATGTGCGG - Intronic
1181451048 22:23021532-23021554 TAAATTTAGGGGTACATGTGCGG + Intergenic
1182988663 22:34745175-34745197 TAAGTTCATGGGTACATGTGCGG + Intergenic
1182992239 22:34779059-34779081 AAAGTTCAGGGGTATATGTGCGG - Intergenic
1183008290 22:34922165-34922187 TAAGTTCTTGGATACATGTGCGG - Intergenic
1184203743 22:42987181-42987203 TTTGTTCAGGGACACATGGGTGG - Intronic
1184314382 22:43672850-43672872 TAAGTTCAGGGGTACAAATGCGG - Intronic
1184949127 22:47827524-47827546 TAAGTCCTAGGATACATATGCGG - Intergenic
1184971664 22:48026630-48026652 TAGGTGCAGGGGAACATGTGAGG + Intergenic
949246846 3:1934813-1934835 TAAGTTCTGGGGTACATGTACGG - Intergenic
949292044 3:2478438-2478460 TAAGTTCAGAGGTACATGTGTGG + Intronic
949387129 3:3515395-3515417 TAAGTTCCGGGACACATGTGCGG - Intergenic
951127747 3:19003918-19003940 TAAGTTCTGGGATACATGTGTGG + Intergenic
951277795 3:20710925-20710947 TAAGATCAGAGAGACATGAGGGG + Intergenic
953074631 3:39557318-39557340 TAAGTTCTGGGGTACATGTGAGG - Intergenic
953090740 3:39723560-39723582 TAAATTGATGGAGACATGTGTGG - Intergenic
953108685 3:39911094-39911116 TAACTTCAGGGAAACATGAAAGG - Intronic
954425106 3:50439118-50439140 CAAGTTTAGGGATAAAGGTGGGG - Intronic
954568494 3:51620438-51620460 TAGGTTCAGGGGTACATGTGTGG + Intronic
955062564 3:55505895-55505917 GATGTTCAGGGATGCCTGTGAGG + Intergenic
955128241 3:56136446-56136468 TAGGTTCACGGATACATGTGTGG + Intronic
955203367 3:56873243-56873265 TAAGTTCAGGCTTATATGTCAGG + Intronic
955218209 3:57002607-57002629 TGAGTTCAGGGGTACATGTGGGG + Intronic
956049088 3:65228317-65228339 TAAGTTCTGGGATATATATATGG - Intergenic
956052481 3:65263341-65263363 TAAATTCAGGGGTACATGTATGG - Intergenic
956566544 3:70645010-70645032 TAAGTTGTGAGATACATGTGTGG + Intergenic
958576518 3:95956172-95956194 TAAGTTCTGAGATACATGTGTGG + Intergenic
958589793 3:96141155-96141177 TAAGTTCATGGGTACATGGCAGG - Intergenic
958700955 3:97588900-97588922 TAGATTAAGGAATACATGTGCGG + Intronic
959206306 3:103311559-103311581 TAAGTTCTGGGATACATGTGCGG + Intergenic
959314627 3:104787133-104787155 GAACTTCAGAGGTACATGTGCGG - Intergenic
959349174 3:105239166-105239188 TAAGTTCTAGGATACATGTGCGG + Intergenic
959431099 3:106256291-106256313 TTAGTTCAGGTAAAAATGTGGGG - Intergenic
959808027 3:110581478-110581500 TAGAGTCAGGGGTACATGTGTGG + Intergenic
960010201 3:112825565-112825587 TGAGTTAAGGAATAGATGTGAGG + Intronic
960246608 3:115406743-115406765 TAAGGTAAAGAATACATGTGAGG + Intergenic
960398249 3:117163744-117163766 TAAATTCAGAGATGCATTTGAGG - Intergenic
960839638 3:121943663-121943685 TAATGACAGGGATACATTTGAGG + Exonic
961082241 3:124036083-124036105 TAGGTTCAGGGGTACATGTATGG + Intergenic
962232520 3:133677883-133677905 TAAGTTCTGGGATACAAGTGCGG + Intergenic
962506123 3:136048074-136048096 TAGGTACAGGGGTACATGTACGG - Intronic
962640615 3:137381912-137381934 TAATTTCCAGGATACATGTGCGG - Intergenic
962666616 3:137660400-137660422 TAAGTTCTGGAGTACATGTGCGG - Intergenic
962999257 3:140662071-140662093 TAAGTTCAGGGGTGCATTTGCGG - Intergenic
963632088 3:147746110-147746132 TAGGTTCAGGGGTACATGTGAGG + Intergenic
963768469 3:149363858-149363880 TAAGTTCTGGGGTACATGTGGGG - Intergenic
964288303 3:155145910-155145932 TGACTTCAGTGATACATATGAGG + Intronic
964581322 3:158242057-158242079 TTAGTTTAGGGGTACATATGCGG + Intronic
964990057 3:162799698-162799720 TAAGTTCAGGGGTACAAATAAGG - Intergenic
965084641 3:164079144-164079166 TAAGTTCAGGGATACAGCACAGG - Intergenic
965201290 3:165661142-165661164 TAGATTCAGGGGTACATGTGCGG - Intergenic
965830542 3:172782553-172782575 TAAGTTCAGGAGTACATGTACGG + Intronic
966004453 3:174992278-174992300 TAAGTTCTGGGAGAAAAGTGAGG + Intronic
966134327 3:176681290-176681312 TAAGTTCCAGGATACATGTGTGG - Intergenic
966152867 3:176884040-176884062 TAGGTTCAGGGGTATATATGCGG - Intergenic
966508951 3:180739212-180739234 TAGGTTTGGGGGTACATGTGAGG - Intronic
966682236 3:182655150-182655172 TAAGTTCTGGGATACATGTGTGG + Intergenic
969683111 4:8654035-8654057 TAAGTTCTGGGATACATGTGTGG + Intergenic
969777869 4:9372466-9372488 TAAGTTCTGGGATACATGTGAGG - Intergenic
969942890 4:10752838-10752860 GAATTTCAGGGATACAGCTGGGG - Intergenic
970004626 4:11399024-11399046 TAAGTTCTGGTGTACATCTGAGG - Exonic
970245410 4:14056709-14056731 TAAGTTCTGAGATACATGTGTGG + Intergenic
970266072 4:14287705-14287727 TAGATTCGGGGGTACATGTGCGG + Intergenic
970519928 4:16872348-16872370 GAAGTTCAGGTATTCATTTGTGG - Intronic
970636598 4:18017403-18017425 AACTTTCAGGGATACATATGAGG + Intronic
970973156 4:22008941-22008963 CAAGTTGAGGGATAAATGTTTGG + Intergenic
971521798 4:27561672-27561694 TAAGTTCTGGGATACATGTGCGG - Intergenic
971524146 4:27594913-27594935 CAAGTTCTGGGATACATGTGTGG + Intergenic
971548291 4:27915035-27915057 TAAGTTCTGGGATACATGTGCGG - Intergenic
972409461 4:38778400-38778422 TAAGTTCTGGGGTACATGTGCGG - Intronic
973375399 4:49282814-49282836 AAAGTTCAGAAATAAATGTGGGG - Intergenic
973376301 4:49288827-49288849 AAAGTTCAGAAATAAATGTGGGG - Intergenic
973377219 4:49294982-49295004 AAAGTTCAGAAATAAATGTGGGG - Intergenic
973378139 4:49301118-49301140 AAAGTTCAGAAATAAATGTGGGG - Intergenic
973379089 4:49307416-49307438 AAAGTTCAGAAATAAATGTGGGG - Intergenic
973380010 4:49314234-49314256 GAAGTTCAGAAATAAATGTGGGG + Intergenic
973380923 4:49320389-49320411 AAAGTTCAGAAATAAATGTGGGG + Intergenic
973382012 4:49327427-49327449 AAAGTTCAGAAATAAATGTGGGG + Intergenic
974010183 4:56599405-56599427 TAAGTTCCAGGATACATGTGCGG + Intronic
974197113 4:58589766-58589788 TAAGTTCTGGGATACGTGTGTGG + Intergenic
974343482 4:60645926-60645948 TAAGTTTTAGGGTACATGTGCGG - Intergenic
974503743 4:62739476-62739498 TAAGTTCTGGAATACATGTGCGG - Intergenic
975052152 4:69879300-69879322 TAAGTTCAGGGGTACATGTGAGG + Intergenic
975231028 4:71933154-71933176 TAAGTTCAGGAATGCATGTGAGG - Intergenic
975385601 4:73756124-73756146 TAAGTTCATGGTTCCATTTGTGG + Intergenic
975792935 4:77974137-77974159 TAAGTTCTGGGATACATGTGCGG - Intergenic
975909642 4:79251600-79251622 TAGGTTCAGGGGTACATGGCGGG - Intronic
975950604 4:79765681-79765703 TATGTTCTGGGATACATGTACGG - Intergenic
976316901 4:83668059-83668081 AAAGTTCCAGGGTACATGTGTGG + Intergenic
976494470 4:85711350-85711372 TAAGTTCAGGGGTACGTGTCCGG - Intronic
976511530 4:85915443-85915465 TAAGTTATGGGATACATGTGCGG + Intronic
976604060 4:86966080-86966102 TAAGTTCTGGGATACGTGCAAGG + Intronic
977371712 4:96145357-96145379 AGAAGTCAGGGATACATGTGAGG + Intergenic
977469408 4:97423648-97423670 TAGGCTCAGGGGTACATGTGCGG - Intronic
977512453 4:97978634-97978656 TAAGTTCAGGGGCACATGTGTGG - Intronic
977552996 4:98461963-98461985 TAAGTTCTGGAGTACATGTGCGG - Intergenic
977729849 4:100338178-100338200 TAGGTTTGGGGGTACATGTGAGG - Intergenic
978101782 4:104850453-104850475 TAAGTTCTAGAATACATGTACGG + Intergenic
978502248 4:109421972-109421994 TAAGTTCCAGGGTACATGTATGG + Intergenic
978607794 4:110501301-110501323 TAGGTTCAGGGGTATATGTACGG + Intronic
978694549 4:111561131-111561153 TAAGTTTTGGGATACATGTGTGG - Intergenic
978771743 4:112464058-112464080 TAAATTCTAGGATACATGTTAGG + Intergenic
979972008 4:127147167-127147189 CAAGTTCAGGGATACAAACGGGG + Intergenic
980524805 4:133975975-133975997 TAAGTTCCGGGGTACATGTCAGG + Intergenic
980734827 4:136871003-136871025 TAAGTTCTGGGGTACATGTGTGG + Intergenic
980863941 4:138531087-138531109 TACGTTCTGGGGTACATGTATGG - Intergenic
981158150 4:141464397-141464419 TAAGCTCAGCAGTACATGTGTGG - Intergenic
981589275 4:146339832-146339854 TAAGTTCCAGGATACATGTGCGG + Intronic
981949859 4:150392985-150393007 TAAGTTCTGGGATACATGTACGG - Intronic
982729495 4:158940759-158940781 AATGTTCATGGATACATATGTGG + Intronic
982778913 4:159469915-159469937 GAAGTTCTGGGGCACATGTGTGG + Intergenic
982948594 4:161660488-161660510 TAAGTTCAGGGATACATGTATGG + Intronic
983710061 4:170703913-170703935 TAGGCTCAGTGGTACATGTGCGG + Intergenic
983995389 4:174175816-174175838 AAAGTTCTGGGTTACATGTGCGG + Intergenic
984455682 4:179965365-179965387 TAAGTTCTGGGGTACATGTGCGG + Intergenic
984469035 4:180142499-180142521 TAAATCAAGGGATACATGTGAGG + Intergenic
985162556 4:187059876-187059898 TAAGTTCTGGGATACATGTGCGG - Intergenic
985726596 5:1519556-1519578 TAAGGTCAGGGCTCCTTGTGAGG + Intronic
986078174 5:4359702-4359724 TAAGTTCCAGAGTACATGTGCGG - Intergenic
986171862 5:5320826-5320848 TAAGTTTGAGGGTACATGTGCGG + Intergenic
986557237 5:9024084-9024106 TAAGTTCAGGGGTATATGTGTGG + Intergenic
986582241 5:9277927-9277949 TAAGTTCTGGGGTACATGTGCGG - Intronic
986599944 5:9462952-9462974 TAAGTTCAGGGATACATGTGCGG - Intronic
986624312 5:9709160-9709182 TAAGTTCTAGGATACATGTGCGG - Intronic
986906684 5:12503096-12503118 TAAGTTCAGTAGTACATGTGCGG + Intergenic
987017134 5:13832117-13832139 TAAGTTCAGGGGTACATGTGCGG - Intronic
987444834 5:18004961-18004983 TAAGTTCTGGGTTATATGTGCGG + Intergenic
987521591 5:18992909-18992931 TAAGTTCTGGGATACACGTGCGG + Intergenic
987639507 5:20594682-20594704 TAAGTTCCAGGATACCTGTGCGG + Intergenic
987694369 5:21308954-21308976 TAGGTTCAGGGGTACACATGTGG - Intergenic
988195566 5:28001278-28001300 TAAGTTCTGGGATACATGTGAGG + Intergenic
988209086 5:28179198-28179220 TAAGTTCAGGGGTGCATGTGCGG - Intergenic
988395714 5:30695569-30695591 TAAGTTCTGGGGTACTTGTGTGG - Intergenic
988618784 5:32801206-32801228 TATGTTCTGGGATACATGTGCGG - Intergenic
988715650 5:33824667-33824689 TCAGTTCAGGAGTACAAGTGAGG + Intronic
989242406 5:39216420-39216442 TTCTTTCTGGGATACATGTGCGG + Intronic
989652017 5:43701124-43701146 TAGATTCAGGGGTACATGTGCGG + Intronic
989812028 5:45689266-45689288 TAACTTCAGGGGTAAATGTGTGG - Intronic
989826291 5:45860192-45860214 TAAGTTCAGGGGTATAAGTGTGG - Intergenic
989975608 5:50582824-50582846 TAAGTTCTGGGGTACATGTGCGG - Intergenic
990845755 5:60136819-60136841 TAAGTTCATGGGTACATGTGCGG + Intronic
991745873 5:69740517-69740539 TAGGTTCAGGGGTACACATGTGG + Intergenic
991751831 5:69814716-69814738 TAGGTTCAGGGGTACACATGTGG - Intergenic
991797473 5:70320475-70320497 TAGGTTCAGGGGTACACATGTGG + Intergenic
991825251 5:70615831-70615853 TAGGTTCAGGGGTACACATGTGG + Intergenic
991831121 5:70689617-70689639 TAGGTTCAGGGGTACACATGTGG - Intergenic
991889816 5:71319796-71319818 TAGGTTCAGGGGTACACATGTGG + Intergenic
992379016 5:76218734-76218756 TGAGTTCTGGGATATGTGTGTGG - Intronic
992403875 5:76437387-76437409 TAAGTTCTGGGATATATGTGTGG + Intronic
992931584 5:81652966-81652988 TAAGTTCTGGGATACATGTGCGG + Intronic
993079000 5:83272429-83272451 TAAGTTCTGGGGTACATGTGCGG + Intronic
993194242 5:84720511-84720533 TAGGTTCAGGAAAACATGTGAGG - Intergenic
993226930 5:85179172-85179194 TAAGTTCTGGGGTACAGGTGCGG - Intergenic
993459183 5:88162049-88162071 TAGGTTCAGGGGTATATGTGCGG + Intergenic
993467301 5:88265070-88265092 TAAGTTCTGGGATACATGTACGG - Intronic
993550161 5:89263610-89263632 TAAGTTGAGGGATACATCTTTGG + Intergenic
993590115 5:89783918-89783940 TAAGTTCTGGAATACAGGTGCGG - Intergenic
993786354 5:92143126-92143148 TAAGTTCAGGGAATCATGGTGGG - Intergenic
993795151 5:92257758-92257780 TAGGTTCGGGCATACATCTGTGG - Intergenic
993930537 5:93933770-93933792 TAAGCTCTGGGATACATGTGCGG - Intronic
994415516 5:99464812-99464834 TAAATTCTGGGGTACATGTGCGG - Intergenic
994610263 5:102027875-102027897 TAAGTTCAGGGGTACAAGTGCGG - Intergenic
994618973 5:102140291-102140313 TAGGTTCATGGGTACATGTGTGG + Intergenic
994960430 5:106594967-106594989 TAAGTTCCAGGGTACACGTGCGG - Intergenic
995535017 5:113126892-113126914 TAGGTTCATGAGTACATGTGAGG + Intronic
995567033 5:113441525-113441547 CAAGTTCTGGGGTACATGTGCGG + Intronic
995695327 5:114872823-114872845 TTAGTTCAGGGGTACATGTGGGG - Intergenic
995775044 5:115716068-115716090 TAGATTCAGGGTTACATGTACGG + Intergenic
996190637 5:120537167-120537189 TAGGTTCAGGGGTACATGTGCGG - Intronic
996539600 5:124615851-124615873 TAAGTTCAGGGTTACAACTGTGG + Intergenic
996649123 5:125851885-125851907 TAAGTACTGGGATACATGTGCGG - Intergenic
996977427 5:129451716-129451738 TAAGTTCTGGGATTCATGTGTGG - Intergenic
997043484 5:130285605-130285627 TAGGTTCAGGGATACAAGGCAGG - Intergenic
997741912 5:136262769-136262791 TAAGTAAAGGGAAACAAGTGAGG + Intronic
997810607 5:136964089-136964111 TAAGTTCTTGGATACATGTGCGG + Intergenic
998578204 5:143340841-143340863 TAGGCTTGGGGATACATGTGAGG + Intronic
998645817 5:144060670-144060692 TAAGTTCCAGGATACATGTGTGG - Intergenic
998668369 5:144325054-144325076 TAAGCTCCGGGATACATGTGTGG - Intronic
998679280 5:144447525-144447547 CCAGGTCTGGGATACATGTGTGG - Intronic
998954914 5:147428937-147428959 TAAGTTCTGGGATACATGTACGG - Intronic
1000510150 5:162170854-162170876 TAAGTTTAGGAGTACATGTGTGG - Intergenic
1000668086 5:164024042-164024064 TAGACTCAGGGGTACATGTGCGG + Intergenic
1001012615 5:168112239-168112261 TAAGTTCAGGGGTGCAAGTGTGG + Intronic
1001151615 5:169233617-169233639 TAAGTTCCGGGGTACGTGTGCGG - Intronic
1001208595 5:169788856-169788878 GAAGTTCAGGGGTCCATGTGCGG + Intronic
1001312888 5:170623896-170623918 TCAGTTCTGGGACACAGGTGTGG - Intronic
1001660377 5:173387161-173387183 TAAGTTCAGGGGTACATGTGCGG + Intergenic
1002037188 5:176480926-176480948 TAAGTTCTGGGATACATGTACGG - Intronic
1003525855 6:6896441-6896463 TAGGTTCTGGGGTACATGTGAGG - Intergenic
1003930629 6:10920727-10920749 TAAGTTAATGGGTACATGTGCGG + Intronic
1004578619 6:16925068-16925090 TACGTTCTGGGATAAACGTGCGG - Intergenic
1004748825 6:18539934-18539956 TAAGTTCCGGGATACAAGGGTGG - Intergenic
1005461596 6:26074647-26074669 AAAGTTTAGGTATACATATGTGG + Intergenic
1005525607 6:26644822-26644844 TAAGTTCCAGGGTACCTGTGCGG + Intronic
1005771488 6:29077322-29077344 TAAGTTCTGGGATACATGTGTGG + Intergenic
1005780675 6:29188536-29188558 TAAGTCCTGGAAGACATGTGCGG + Intergenic
1007018433 6:38493703-38493725 AAACATCAGGGATACGTGTGGGG + Intronic
1007151440 6:39696267-39696289 TAGATTCAGGGGTACATGTGCGG - Intronic
1007936134 6:45733653-45733675 TAGGTTCAAGAGTACATGTGAGG + Intergenic
1009613777 6:65979390-65979412 TAACTTCAGGCAAACATGTCCGG - Intergenic
1009709070 6:67294578-67294600 TAAGTTCTGGAGTACATGTGCGG + Intergenic
1009725583 6:67532527-67532549 TAAATTCTGGGATACATGTGTGG - Intergenic
1009734464 6:67659089-67659111 TAAGTTCAGGGATACCAGTGTGG + Intergenic
1009750690 6:67875390-67875412 TAAGTTCCAAGATACATGGGAGG - Intergenic
1009764172 6:68047875-68047897 TATGTTCAGGGGTATATGTTAGG - Intergenic
1011063441 6:83297602-83297624 TAAGTTCCAGGATACATGTGAGG + Intronic
1011253580 6:85398902-85398924 TCTGTTTAGGGGTACATGTGCGG - Intergenic
1011575680 6:88795652-88795674 TAAGTTCTGGGATTCATGTGCGG - Intronic
1012113948 6:95269977-95269999 TAAGTTCAGGGGTACATGTGCGG + Intergenic
1012760210 6:103292108-103292130 TAAGATCAGGGGTACATATGCGG - Intergenic
1012784076 6:103601017-103601039 TAAGTTCCAGGATACATATGTGG + Intergenic
1012787362 6:103647817-103647839 TAAGTTCTGGGATACATGTGAGG - Intergenic
1012813991 6:103998965-103998987 TAAGTTCAGGGTTAAGTGTGAGG + Intergenic
1012875007 6:104715952-104715974 TAGGTTCAGGGTTACATTTGTGG - Intergenic
1012970620 6:105726179-105726201 TAAGTTCTGGGATTCTTGTGTGG - Intergenic
1012984583 6:105861406-105861428 TAAGTTCTGGGATACATGTGCGG - Intergenic
1013399915 6:109783246-109783268 TAAGTTCAGGGGTACATGTGCGG - Intronic
1014848540 6:126311253-126311275 TAAGTTCAGGGGTACATGTGCGG + Intergenic
1014902834 6:126988623-126988645 TAAGTTCTGGGATACATGTGCGG - Intergenic
1014960324 6:127675654-127675676 TAGGTTCAAGAATACATGTGTGG + Intergenic
1015311987 6:131776362-131776384 TAAGTTCAGGGGTACAAGTACGG + Intergenic
1016164841 6:140928123-140928145 TAGATTCAGGGGTACATATGCGG + Intergenic
1016482932 6:144502282-144502304 TAAGTTATGGGATACATGTGCGG + Intronic
1017090852 6:150757712-150757734 TAAGTTCCGGGGTACATGTGCGG + Intronic
1017193099 6:151674036-151674058 TAAGTTCTGGGATACATGTGGGG + Intronic
1017463823 6:154676125-154676147 TAAGATCAGGGATACAAGGAGGG + Intergenic
1017601973 6:156093086-156093108 TAGGTTCAGGAATACATATGCGG - Intergenic
1018339181 6:162831512-162831534 TAAGTTCCAGGATACATGGCAGG + Intronic
1019099308 6:169615242-169615264 TAGGTTCAGGGGTACACGTGTGG + Intronic
1020526012 7:9259948-9259970 TAAGTTCTGGGATACATGTGCGG + Intergenic
1020613383 7:10428500-10428522 TAAGTTCTGCGATTCATCTGGGG + Intergenic
1020684746 7:11280473-11280495 TAAGTTCTGGGATACATGTGCGG + Intergenic
1022069358 7:26896943-26896965 TGAATTCAGGGATACATCTTAGG + Intronic
1022232197 7:28425004-28425026 TAGGCTCATGGGTACATGTGTGG + Intronic
1022269269 7:28790086-28790108 TACGTTTAGGGAAACATTTGGGG + Intronic
1022640079 7:32173851-32173873 TAGGCTCAGGAATCCATGTGAGG - Intronic
1022933286 7:35144930-35144952 TAAGTTCTGGGGTACATGTGCGG - Intergenic
1023897373 7:44445176-44445198 GCAGTTCAGGGGTGCATGTGCGG - Intronic
1023917206 7:44598305-44598327 TAAGTTCCAGGATACATGTGCGG - Intergenic
1024528098 7:50366229-50366251 TAAGTTCAGGAGTACATGTGCGG - Intronic
1024845227 7:53634682-53634704 TAAGTTAAAGGGTACATGTCTGG - Intergenic
1025067542 7:55870364-55870386 CAAGTTCAGTGTTAAATGTGTGG - Intergenic
1025122217 7:56314714-56314736 TAAGTTCTGGGATACATGTGTGG + Intergenic
1025869125 7:65414504-65414526 TAAGTGCTGGGATACAGGTGTGG + Intergenic
1026198360 7:68192613-68192635 TATGTTCTGGGATACATGTGCGG - Intergenic
1026235647 7:68524774-68524796 TAAGTTCTGGGGTACATGTGTGG + Intergenic
1026338418 7:69414432-69414454 TAAGTTCAGGGGTACAAGTATGG + Intergenic
1026446981 7:70493137-70493159 AAAATTCAGGGAGGCATGTGTGG + Intronic
1027563094 7:79757300-79757322 TAAGTTCTGGGATACAAGTGCGG + Intergenic
1027684099 7:81259871-81259893 TGGGTTCAGAGTTACATGTGCGG + Intergenic
1027863982 7:83622961-83622983 TAAGTTCCAAGGTACATGTGCGG - Intronic
1028059634 7:86295440-86295462 TAGGTTCAGTGAAACATATGTGG + Intergenic
1028315917 7:89403124-89403146 TAAGTTCAGGGTTACAAGTGTGG + Intergenic
1028450346 7:90975130-90975152 CAAGTTCAGGGCTACTTCTGTGG - Intronic
1028668895 7:93378008-93378030 TCATTTTAGGGATACATGTGAGG - Intergenic
1028757955 7:94459656-94459678 TAGGTTCAGGGGTACATGTGCGG + Intergenic
1029829212 7:103237696-103237718 TAAGTTCTGGGGTACATGTGCGG - Intergenic
1030715862 7:112806052-112806074 TAGGTTCGGGGGTACATGTGAGG + Intergenic
1030959218 7:115893434-115893456 TAAGTTCTGGGATACATGTGCGG - Intergenic
1031823190 7:126530208-126530230 TAATTTCAGAGAGACCTGTGTGG + Intronic
1031906076 7:127460989-127461011 TAATTTCAGGAATACATGGATGG + Intergenic
1032295333 7:130632767-130632789 TAAGTTCTGGGATACATGTGCGG + Intronic
1032893735 7:136226483-136226505 TAAGTTCTGGGATATATGAGCGG - Intergenic
1032907421 7:136386351-136386373 TAAGTTCTAGGACACAGGTGCGG - Intergenic
1033782679 7:144691591-144691613 TAGGTTCAGGGGTATATATGTGG - Intronic
1033837857 7:145336977-145336999 TAAGTTCTGGGATACACGTGCGG - Intergenic
1033951551 7:146790943-146790965 TAAGTTCTGGGGTACACGTGTGG + Intronic
1034084140 7:148308598-148308620 TAAGTTCTGGGGTACATGTACGG + Intronic
1034704939 7:153132993-153133015 TAAGTTCTGTGGTGCATGTGCGG + Intergenic
1035712317 8:1727994-1728016 TCAGTTCTGGGATATGTGTGCGG - Intergenic
1035748370 8:1978012-1978034 TAAGTTGCAGGGTACATGTGCGG + Intronic
1035843770 8:2841346-2841368 TAAGTTCTGGGGTACATGTGCGG - Intergenic
1035894372 8:3380859-3380881 TAAGTTCTGGGACACATGTGCGG - Intronic
1036981162 8:13471659-13471681 TAAGTTCAGGGGTACAAGCGTGG - Intronic
1037515113 8:19623031-19623053 TAAGTTCTGGGATACATGTGTGG - Intronic
1037720230 8:21437458-21437480 TAAGTTCTGGGATACATGTGTGG - Intergenic
1038324633 8:26563440-26563462 TAAGTTCAGGACTTCATGTCTGG - Intronic
1038352367 8:26788956-26788978 TAAGTTCTGGGATACATGTGCGG + Intronic
1038590283 8:28831438-28831460 TAAGTTCTGGGATAGGTGTGTGG - Intronic
1039119119 8:34126093-34126115 TAGGTTCGGGGGTACATGTGTGG + Intergenic
1039193361 8:35002195-35002217 TAAATTCTGGGATACATGAGTGG + Intergenic
1040360933 8:46663901-46663923 CAAGTTCAGCGTTAAATGTGTGG + Intergenic
1040734765 8:50491742-50491764 TAAGTTCTGGGGTACATGTGTGG + Intronic
1040926866 8:52693914-52693936 TAAGTTAAAGGGTACATGTGCGG - Intronic
1041198570 8:55426468-55426490 TAAGTTCCGTGATAAATGTATGG - Intronic
1041273902 8:56137930-56137952 TAAGTTCCGGGGTACATATGCGG + Intergenic
1041301054 8:56411836-56411858 TAAGTTCAAGGGTACATGAGCGG + Intergenic
1041302377 8:56426238-56426260 TAGGTTCAGAAATACATGTGAGG + Intergenic
1041981589 8:63867722-63867744 TAAGTTCAGAGCTACGTATGCGG + Intergenic
1042492205 8:69412361-69412383 TAAGTTCATGGGTACCTGTGTGG - Intergenic
1042702288 8:71628504-71628526 TAAGTTCAGGGGTACATTGCAGG - Intergenic
1042818500 8:72904495-72904517 TAAGTTCAGGGGTACACGTGTGG - Intronic
1043015389 8:74933936-74933958 AAAGTTCTGGGATACATGTGTGG + Intergenic
1043052372 8:75399852-75399874 TAAGTTCAGGGACAAATTTTTGG + Intergenic
1043075246 8:75690617-75690639 TAGGTTCAGGGAGTGATGTGTGG + Intergenic
1043307700 8:78817837-78817859 TAATTTCAGGGGTACAAGTCTGG + Intergenic
1044250108 8:89996357-89996379 TCAGTTCAGAAATACTTGTGTGG + Intronic
1044452420 8:92353224-92353246 TAAGTTCTGGGATACATGTGTGG + Intergenic
1044974858 8:97654578-97654600 TAAGTTCTGGGATACATGTGCGG + Intronic
1045193182 8:99903566-99903588 TAAGCTCTGGGGTAAATGTGTGG - Intergenic
1045484463 8:102620253-102620275 TAAGTTCTGGGATACATGTGTGG - Intergenic
1045857504 8:106781201-106781223 TCAGATTGGGGATACATGTGTGG - Intergenic
1045886987 8:107110257-107110279 TAAGTTCTGGGATACATAATCGG + Intergenic
1046130731 8:109964965-109964987 TAAGTTCAGGGATACATGTGCGG - Exonic
1046221476 8:111222223-111222245 TAAGTTCTGGGATACATGTGTGG - Intergenic
1046412840 8:113871159-113871181 TTAGTTCCAGGATACATGAGTGG + Intergenic
1046681466 8:117175137-117175159 TAAGTTCTGGGGTACATGTGCGG + Intronic
1046759596 8:118007591-118007613 TAAGTTCCTGGATGCATGTGTGG - Intronic
1046959963 8:120100991-120101013 TAAGTTCTAGGGTACATTTGTGG - Intronic
1047150924 8:122261973-122261995 TAAGTTCTGGAATACATTTGTGG + Intergenic
1048320814 8:133399009-133399031 TAATTTCAGGAGTACAAGTGTGG + Intergenic
1050127503 9:2374178-2374200 TAGGTTCAGGAGTACAAGTGCGG - Intergenic
1050167167 9:2777248-2777270 TACGTTCTGGGATACATATGCGG - Intronic
1050451279 9:5783919-5783941 TAAGTTCTGGGGTACATGTGTGG - Intronic
1050758833 9:9041229-9041251 TAAGCTCAGGGGTACAGGTGCGG + Intronic
1050773820 9:9235905-9235927 TAAGTTCATGGAGACATGCAAGG - Intronic
1050855170 9:10345299-10345321 TAAGTTCTGGGATATATGGCAGG + Intronic
1051861793 9:21633552-21633574 TAGGTTCAGGGAAACATGTGCGG - Intergenic
1052083624 9:24237357-24237379 TAAGTTCCAGGATACATGTGCGG - Intergenic
1052124538 9:24759108-24759130 TAAGTTCTGGTGTACATATGTGG + Intergenic
1052446536 9:28568453-28568475 TAGGTTCAGCAATACATGTGTGG - Intronic
1052595563 9:30553077-30553099 TAAGTTCCAAAATACATGTGCGG - Intergenic
1053115077 9:35493007-35493029 TAGGTTCAGGGGTACATATGAGG + Intronic
1053193763 9:36098447-36098469 TAATTTCAGGCATTCTTGTGAGG - Intronic
1055034411 9:71802915-71802937 TAGGTTCAGGGGTACATGTGAGG - Intronic
1055125144 9:72710807-72710829 TACATTCTGGGGTACATGTGTGG + Intronic
1055240983 9:74185643-74185665 TAACTTCAGTGATGCATCTGAGG - Intergenic
1056146484 9:83736053-83736075 TAAGTTCAGGGGTACATTGCAGG + Intergenic
1056837029 9:89963582-89963604 TATGTTTGTGGATACATGTGGGG - Intergenic
1056888042 9:90462856-90462878 TACGTTCTGGGATACATGTGCGG - Intergenic
1058350160 9:104011701-104011723 TAAGTTCCGGGGTACATGTGGGG - Intergenic
1059111543 9:111562607-111562629 TCAGTTCCGGGATAATTGTGTGG + Intronic
1059835277 9:118145194-118145216 CATGTTCAGGGGTACATGTATGG + Intergenic
1061575632 9:131504026-131504048 TTGGTTCAGGTAGACATGTGGGG - Intronic
1203699115 Un_GL000214v1:121050-121072 AAAGTTCAGAAATAAATGTGGGG - Intergenic
1203700980 Un_GL000214v1:133344-133366 AAAGTTCAGAAATAAATGTGGGG - Intergenic
1203480777 Un_GL000224v1:8220-8242 AAAGTTCAGAAATAAATGTGGGG - Intergenic
1203481739 Un_GL000224v1:14550-14572 AAAGTTCAGAAATAAATGTGGGG - Intergenic
1203550111 Un_KI270743v1:160120-160142 AAAGTTCAGAAATAAATGTGGGG + Intergenic
1203569413 Un_KI270744v1:117298-117320 AAAGTTCAGAAATAAATGTGGGG - Intergenic
1203570363 Un_KI270744v1:123579-123601 AAAGTTCAGAAATAAATGTGGGG - Intergenic
1185540807 X:901883-901905 TAGGTCCAGGGGTACCTGTGTGG - Intergenic
1185724565 X:2409297-2409319 TAAGTTCTGGGGCACATGTGCGG + Intronic
1185997561 X:4968890-4968912 TAAGTTCTGGGGTACATGTGTGG - Intergenic
1186059738 X:5691043-5691065 TAAGTTCAGAGGTACAATTGTGG - Intergenic
1186647012 X:11517952-11517974 TAAATTCCGGGGTACATGTGCGG - Intronic
1187226922 X:17382134-17382156 TAGGTTCAGGGGTACATGTGCGG + Intronic
1187558895 X:20380711-20380733 TAAGTTCGAGGGTACATGTGCGG - Intergenic
1187661707 X:21554349-21554371 TAAGTTTAGGGGTACAAGTGTGG + Intronic
1187770827 X:22693831-22693853 TAAGTTCAGGGGTACATGTGTGG + Intergenic
1187886734 X:23895625-23895647 TAAGTCCTGGGATACATGTGCGG - Intronic
1188398735 X:29718574-29718596 TAGCTTCTGGGTTACATGTGCGG - Intronic
1188451321 X:30310205-30310227 TAGGTTCAGGAGTACATGTGCGG + Intergenic
1191012858 X:55778764-55778786 TAGGTTCAGGGGTACATGGATGG + Intergenic
1191238178 X:58153457-58153479 TATGTTCTGGGGTACATGTGCGG + Intergenic
1192003203 X:67179081-67179103 TAAGTTCATGGATACATGTGCGG - Intergenic
1192019072 X:67364950-67364972 TAAGTTCTGAAATACATGTGAGG - Intergenic
1192147190 X:68689588-68689610 TAAGCTCAGACATACAGGTGTGG - Intronic
1193100508 X:77606164-77606186 TAGGTTCATGGGTACATGTATGG + Intronic
1193191961 X:78581520-78581542 TAAGTTCTGGGATACATGTGCGG - Intergenic
1193444364 X:81581675-81581697 TTATTTCAGGGACACATGTTTGG + Intergenic
1193628619 X:83851765-83851787 TTAGTTCAGTAATACATGTATGG - Intergenic
1194271946 X:91826480-91826502 TAGGTTCAGGTATGCATGTGCGG + Intronic
1194536637 X:95113351-95113373 TAAGTTCAGGTGTACATGTGTGG + Intergenic
1195657240 X:107343796-107343818 TAAGTTCAGGGGTACATGTGAGG - Intergenic
1195808862 X:108806718-108806740 TAAGTTTTAGGGTACATGTGTGG + Intergenic
1196159581 X:112467929-112467951 TAAGTTCTGGGTTACGTGTGAGG - Intergenic
1196668037 X:118336690-118336712 TAAGCTCAGGGGTACAAGTGTGG - Intergenic
1196830225 X:119770173-119770195 TAAGTTCAGGTGTACATGTGTGG + Intergenic
1197284640 X:124581900-124581922 TAAGTTCCGGGATGCATGTGTGG + Intronic
1197342585 X:125290626-125290648 TAAGTACTGGGATACATGTGCGG + Intergenic
1197677449 X:129345903-129345925 TAAGTTTCAGGATACATGTGCGG - Intergenic
1198001693 X:132445818-132445840 TAAGTTCTGGGATACATGTGCGG + Intronic
1198649871 X:138850744-138850766 TAAGTTCCGGTGTACATGTGTGG + Intronic
1198983001 X:142420673-142420695 TAAGTTCTGGGGTACATGTATGG + Intergenic
1199138631 X:144284111-144284133 TTATTTCTGGGATGCATGTGCGG - Intergenic
1199365574 X:146978187-146978209 TAAGTTTGGGTGTACATGTGAGG + Intergenic
1199567864 X:149234759-149234781 TAAATTCTGGGATACACGTGCGG - Intergenic
1199706591 X:150431431-150431453 TAGGTCAAGGGGTACATGTGCGG + Intronic
1199886764 X:152028163-152028185 TAAGTTCAGGGGTATATGTGCGG - Intergenic
1199930549 X:152514768-152514790 TAAGTTCAGGGGTACATGTACGG - Intergenic
1200589195 Y:5047918-5047940 TAGGTTCAGGTATGCATGTGCGG + Intronic
1200732110 Y:6753420-6753442 TAAGTTCTGGGGTACATGTGTGG + Intergenic
1200739726 Y:6840870-6840892 TATGTTCTGGGGTACATGTGAGG + Intergenic
1201259179 Y:12141167-12141189 TAGATTCAGGGTTACATGTGTGG - Intergenic
1201712634 Y:17009419-17009441 TAAGTTCAGGGGTACAAATGGGG + Intergenic