ID: 1179218120

View in Genome Browser
Species Human (GRCh38)
Location 21:39384602-39384624
Sequence CATGTGCGGGTTTGTTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24046
Summary {0: 14, 1: 761, 2: 2997, 3: 8505, 4: 11769}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179218115_1179218120 21 Left 1179218115 21:39384558-39384580 CCGACAATTTTTTTTTTTTTTTT 0: 100
1: 1069
2: 8953
3: 45243
4: 109410
Right 1179218120 21:39384602-39384624 CATGTGCGGGTTTGTTATATAGG 0: 14
1: 761
2: 2997
3: 8505
4: 11769
1179218114_1179218120 26 Left 1179218114 21:39384553-39384575 CCTGGCCGACAATTTTTTTTTTT 0: 1
1: 23
2: 268
3: 1489
4: 8204
Right 1179218120 21:39384602-39384624 CATGTGCGGGTTTGTTATATAGG 0: 14
1: 761
2: 2997
3: 8505
4: 11769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179218120 Original CRISPR CATGTGCGGGTTTGTTATAT AGG Intronic
Too many off-targets to display for this crispr