ID: 1179218483

View in Genome Browser
Species Human (GRCh38)
Location 21:39386787-39386809
Sequence TAACACTTATACGTGGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179218483 Original CRISPR TAACACTTATACGTGGGTCT TGG Intronic
900560124 1:3300669-3300691 TAACAATGATGCGTGGATCTTGG - Intronic
917009116 1:170450991-170451013 TCACACTTATACATGGTTATAGG + Intergenic
920075227 1:203331248-203331270 TGACACTGATAAGTGGGACTTGG - Intergenic
923608149 1:235464093-235464115 TAGCACTTATACGTAGGTCTTGG - Intronic
1064195624 10:13241920-13241942 TAACATTTATAAGTGGGCCATGG - Intergenic
1066696603 10:38084625-38084647 TACCACTTATAAGTGAGACTAGG - Intergenic
1070988103 10:80705801-80705823 GAACACTTATACGTGGTTGGTGG + Intergenic
1081098127 11:38966409-38966431 TAACACTTATTATTGGTTCTCGG + Intergenic
1082828619 11:57598798-57598820 TAGCAAACATACGTGGGTCTGGG + Intronic
1090618331 11:128537712-128537734 TACCACTTATACGTGTATATTGG + Intronic
1102069536 12:110006110-110006132 AAAAACTTATACATGGGGCTGGG - Intronic
1110000898 13:70198493-70198515 TAACACTTTTACATGAGTTTAGG + Intergenic
1118195199 14:63618963-63618985 TAACAATGAAATGTGGGTCTAGG + Intronic
1131363003 15:91811518-91811540 TAACATTTATAGTTGAGTCTTGG - Intergenic
1132598474 16:763680-763702 TAACATTTCCAGGTGGGTCTGGG + Exonic
1139541291 16:67619138-67619160 TAACACTTATGAGTGGGGCCAGG + Intronic
1142824488 17:2500024-2500046 TAACCCTTATACTTGGGTGTGGG + Intronic
1155072137 18:22325737-22325759 TAACATTTAAATGTGGGACTTGG + Intergenic
1160252947 18:77220003-77220025 AGACATTTGTACGTGGGTCTTGG - Intergenic
925217191 2:2107182-2107204 TAAGACTGAGACGTGGGTTTGGG + Intronic
927246966 2:20964683-20964705 TAACACTGATCCATGGCTCTGGG - Intergenic
928399383 2:30966825-30966847 TATCACTTATACCAGGGTTTGGG - Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
939576466 2:143901121-143901143 TGACACTTTTCCCTGGGTCTTGG - Intergenic
940089991 2:149904244-149904266 TAACACTTAAAAGTGTGACTTGG - Intergenic
945060994 2:205908750-205908772 TAACATCAATGCGTGGGTCTTGG + Intergenic
1170128472 20:12991771-12991793 AAGCACTTATACTTGGGTATTGG - Intergenic
1173211602 20:41037597-41037619 TAACAGTTATGCGTGAGTATAGG + Intronic
1179218483 21:39386787-39386809 TAACACTTATACGTGGGTCTTGG + Intronic
950547339 3:13646313-13646335 TAACACATATGAGTGTGTCTGGG - Intergenic
950940843 3:16889715-16889737 TAAAACTTTTATGTGTGTCTTGG + Intronic
957311142 3:78520381-78520403 TAACATTAAGAGGTGGGTCTTGG + Intergenic
970794615 4:19896307-19896329 TAACACTTATACGTTGTTGGTGG + Intergenic
981890956 4:149736426-149736448 TGACACTTATAAGTGTTTCTTGG + Intergenic
993886438 5:93420872-93420894 AAACATTTACAAGTGGGTCTTGG - Intergenic
994553360 5:101263976-101263998 TTACACTTATACATGGCTGTTGG + Intergenic
1003232260 6:4265149-4265171 AAACACTTATACCAGGGTTTCGG + Intergenic
1008904335 6:56659559-56659581 AAACACTTATTCTTGGGTCATGG - Intronic
1012361066 6:98381123-98381145 TAATTTTTCTACGTGGGTCTTGG - Intergenic
1015314401 6:131801929-131801951 TAGCCCTTATATTTGGGTCTAGG - Intergenic
1022469536 7:30673870-30673892 TAGCACTTCTACGTCAGTCTGGG - Intronic
1025727195 7:64077026-64077048 TTACACTTCTATGTGGTTCTTGG + Intronic
1025756402 7:64347850-64347872 TTACACTTCTATGTGGTTCTTGG + Intronic
1028701470 7:93785777-93785799 TATCACCTATACCTGGGTTTTGG - Intronic
1029561300 7:101304513-101304535 TAATTCTTATACTGGGGTCTTGG + Intergenic
1031561198 7:123240613-123240635 TAAAACTTATATGTGGGTAAAGG - Intergenic
1036491779 8:9233309-9233331 TAGCACTGATATGTGGCTCTTGG - Intergenic
1046452918 8:114416876-114416898 TAAAACTTATACTTGGATTTTGG - Intergenic
1048745738 8:137613356-137613378 TAAAACTGATACGTGGGGCTGGG + Intergenic
1052448252 9:28591551-28591573 TAACACTTTTACTTGGGGTTTGG - Intronic
1052972822 9:34387429-34387451 TCACACTTCTACGTGGGTGGCGG + Intronic
1053313351 9:37033304-37033326 AAACTCCTAGACGTGGGTCTGGG - Intronic
1060262292 9:122086832-122086854 AAACACTTAAAAGTGGGTTTTGG + Intronic
1061887949 9:133602189-133602211 CCACACTTCTACCTGGGTCTGGG + Intergenic
1194895940 X:99439879-99439901 TAATAATTATAGGTCGGTCTAGG - Intergenic
1199319446 X:146421275-146421297 TCACACTGATACTTGGCTCTAGG + Intergenic
1201237937 Y:11929729-11929751 GAACACTTATACATTGTTCTTGG - Intergenic