ID: 1179223664

View in Genome Browser
Species Human (GRCh38)
Location 21:39432670-39432692
Sequence CTGGGTTGGGAGTGAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 425}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179223664 Original CRISPR CTGGGTTGGGAGTGAGGCGC AGG (reversed) Intronic
900008527 1:83310-83332 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900036758 1:417393-417415 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900058387 1:653140-653162 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900115474 1:1026133-1026155 CTGGGTGGGGAGTGAGGGAGTGG - Intronic
900151927 1:1182604-1182626 CTGGGTGGGGACTGAGGAGTTGG + Intronic
900152002 1:1182831-1182853 CTGGGTTGGGGGCGAGGCCAGGG + Intronic
900204307 1:1425608-1425630 CTGGGATGCGCGTGAGCCGCAGG - Intergenic
900249471 1:1659930-1659952 ATGGGTTTGGAGTGGGGCCCTGG - Intronic
900260407 1:1725241-1725263 ATGGGTTTGGAGTGGGGCCCTGG - Intronic
900787293 1:4656551-4656573 CTGCGGGGGGAGTGAGGCGAAGG + Intronic
901428866 1:9200142-9200164 CAGGGTTGGGAGTCAGAGGCTGG + Intergenic
901692053 1:10980169-10980191 CTGGGCTGGGCCTGAGGCCCTGG - Intronic
901807594 1:11748179-11748201 ATGGGTGGGGAGGGAGGCTCTGG + Intronic
902246571 1:15124706-15124728 CGGGGTTGGGGGTGAGGTGGGGG - Intergenic
902292301 1:15443321-15443343 GTGAGTTGGGAGTCAGGCCCAGG - Intronic
903039843 1:20521157-20521179 CAGGCTTGGGAGTCAGGCACCGG - Intergenic
903040068 1:20522839-20522861 CAGGCTTGGGAGTCAGGCACCGG + Intergenic
903193742 1:21670142-21670164 CTTGGTGGGGAGTGGGGCACAGG - Intergenic
903212883 1:21828558-21828580 CGGTGTGGGGAGGGAGGCGCAGG + Intronic
903240848 1:21981555-21981577 CTGGGCTGAGAGTCAGGCTCTGG + Intronic
903244585 1:22006195-22006217 CTGGGCTGAGAGTCAGGCTCTGG + Intronic
903280204 1:22245830-22245852 CTCGGTGGGCAGTGAGGGGCGGG + Intergenic
903460018 1:23514302-23514324 CTGGGATGGGAGATAGGCACTGG + Intronic
903836195 1:26204644-26204666 CTGAGTTAGGAGTGGGGCCCCGG + Intergenic
904316805 1:29671000-29671022 CTGGGGTGGGAGTGAGGGAGAGG + Intergenic
904328851 1:29745122-29745144 CTGGGCTGGGAGTCAGGGCCTGG - Intergenic
904355143 1:29933867-29933889 CTGGGGTGGGAGTGAGGGAGAGG + Intergenic
904480391 1:30789631-30789653 CTGGAGTGGGGGTGAGGCGGCGG + Intergenic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
906651810 1:47518123-47518145 CTGGGTAGAGAGTGAGGGGAGGG - Intergenic
907573573 1:55506014-55506036 CAGGGTAGGGAGTGAGGCAGAGG - Intergenic
909563748 1:77032687-77032709 CTGGCTTGGGAGTCAGGCTGGGG - Intronic
910514917 1:88049557-88049579 CTGAATTGGGAGTGCGGGGCTGG - Intergenic
910726344 1:90343701-90343723 ATGGGATGGGAGAGAGGCTCAGG + Intergenic
910827778 1:91428043-91428065 TGGGGTGGGGAGTGAGGGGCGGG - Intergenic
910876759 1:91885718-91885740 CGGCCTTGGGAGGGAGGCGCTGG - Intronic
911050652 1:93668128-93668150 CTGGGGTGGGAGTGAGGAGGGGG + Intronic
912644422 1:111378643-111378665 CTGGGTTGAGAGAGAGGGGAAGG - Intergenic
912950819 1:114118999-114119021 CTGGGCTGGGACTGAGTTGCTGG - Intronic
914165063 1:145168948-145168970 TTGGGAGGGGAGTGAGCCGCGGG + Intergenic
914620224 1:149398713-149398735 CTGGCTAGGCAGTGAGGGGCTGG + Intergenic
914804255 1:150981314-150981336 CTGAGTTGGGAGAGAGGCAGAGG + Intergenic
915474884 1:156147470-156147492 CTGGGGTGGGAGGGAGGGGCGGG + Intronic
915564067 1:156704345-156704367 CTGGGTTGGGCGAGAGGGGAGGG - Intronic
915913417 1:159928109-159928131 CTGGGGTGGGACTGAGGCGGAGG + Intronic
919732268 1:200920881-200920903 CTGGGCTGGGTGTGAGGAGCAGG + Intergenic
920116851 1:203627585-203627607 TTGGCTTGGGAATGAGACGCAGG + Intronic
920131731 1:203737182-203737204 CTGGGGTTGGAGTGAGGGTCTGG - Intronic
921476959 1:215622645-215622667 CTGGAGTGGGAGTGAGGCCTGGG - Intergenic
922674510 1:227542401-227542423 CTGGGCCGGGAGGGCGGCGCAGG - Intergenic
924821189 1:247492041-247492063 CTGGGGTGGGAGAAAGGGGCTGG + Intergenic
1062878557 10:960408-960430 CTGGGTATGGTGGGAGGCGCTGG + Intergenic
1062884616 10:1006811-1006833 CTGTGGTGGGAGAGAGGCCCAGG + Intronic
1063334749 10:5200746-5200768 TTAGGTTGGGAGTGAGGTGAGGG - Intronic
1063405879 10:5794401-5794423 CTGGGTTGGAAGTGAAATGCTGG - Intronic
1064585376 10:16834388-16834410 CTGGGGTGGGAGTGGGGGGTGGG + Intronic
1064684105 10:17841713-17841735 CTGGGGTGGGATTGAGGGGTGGG - Intronic
1066216817 10:33296397-33296419 CTGGCTTGGGTGTAAGGAGCAGG - Intronic
1067722935 10:48743344-48743366 CCGGGGTGGGAGTGAGCCGCTGG - Exonic
1069439872 10:68418584-68418606 GCGGGTTGGGGGTGAGGGGCGGG - Intronic
1070485330 10:76924987-76925009 CTGGGTTGGGAGGGAAGAGGGGG - Intronic
1070766451 10:79059314-79059336 CAGGGTTGGGATTGAGGGCCAGG + Intergenic
1071366629 10:84907119-84907141 CTGGGTTGGGAGTTGGGAGGAGG + Intergenic
1072252307 10:93591286-93591308 CTGGGTAGGGGGTGAGTTGCAGG - Intronic
1072419048 10:95274102-95274124 GTGGGTGGGGAGGGAGGCACTGG - Intronic
1073112464 10:101070681-101070703 CTGGTTAGGGAGTGGGGTGCGGG + Intergenic
1073266116 10:102229480-102229502 CTGGGATGGGAGTGGGGCGGAGG + Exonic
1075657961 10:124174311-124174333 CAGGGTTGGGAGGGCGGAGCAGG + Intergenic
1076706393 10:132304310-132304332 GTGGGTTGGGGGTGGGGCTCAGG - Intronic
1077231141 11:1458681-1458703 CTGGGGTGGGAGCAAGGCCCTGG - Intronic
1077342304 11:2031521-2031543 CTGGGTTGGGAGTTTGGAGGGGG + Intergenic
1077475531 11:2788552-2788574 TTGGGTTGGGTGTGGGGGGCGGG - Intronic
1078368882 11:10728853-10728875 CTGGGGTGGGAGTGAGGTGGGGG + Intergenic
1078987856 11:16612585-16612607 CGGGGTTGGGAGTGGGGGGATGG + Intronic
1081687598 11:45053672-45053694 CTGGAGTGGGTGTGAGGGGCTGG - Intergenic
1083209823 11:61176310-61176332 CTGGGATGGGAGAGAAGCCCAGG - Intergenic
1083296031 11:61716116-61716138 ATGGGGTGGGACTGAGGTGCTGG + Intronic
1083595620 11:63917249-63917271 CTGGGGTGGGAGGGAGGGCCCGG + Intergenic
1083678906 11:64342432-64342454 CCGGGTTGGGAGGGAGGCAATGG - Intronic
1083742027 11:64716284-64716306 CTGGGATGGGGGTGGGGCGGGGG - Intronic
1083871377 11:65490436-65490458 CTGGATTGGGAGTGGGGGGGTGG - Intergenic
1084473886 11:69378048-69378070 CTGGGTTAGGTGTGAGGCATGGG - Intergenic
1084935404 11:72584171-72584193 CGGGGTTGGGAGTGGGGTGTGGG - Intronic
1085217918 11:74848561-74848583 CTGGGTACGGACTGAGGCGGGGG + Intronic
1085430714 11:76445402-76445424 CTGGGGAGGGAGTGAGGCGCGGG + Intronic
1088764245 11:112961328-112961350 CTGGGATGGGAGCGAGGAGCGGG - Exonic
1088882535 11:113983021-113983043 CTGGGTAGGGAGTGAAGTTCGGG - Intronic
1089334340 11:117712847-117712869 CAGGGTGGGGAGAGAGGCGGGGG - Intronic
1089511206 11:118998338-118998360 ATGGGATGGGAGTGCGGGGCAGG + Intronic
1089959110 11:122600045-122600067 CTGGGGTGGGAGTCAGGACCAGG - Intergenic
1090748133 11:129723496-129723518 CTGGGTGGGGAGGGAGGTGTTGG - Intergenic
1090835115 11:130448558-130448580 CTGGGAGGGGAGTGAGGGGAGGG + Intergenic
1091207718 11:133832928-133832950 CTGGGCTGGGAGGGGGACGCGGG + Intergenic
1202825290 11_KI270721v1_random:86710-86732 CTGGGTTGGGAGTTTGGAGGGGG + Intergenic
1091452186 12:579704-579726 TTGGGTAGGCAGTGAGGCTCGGG - Intronic
1091719205 12:2800369-2800391 CTGGAATGGGAGAGAGGCTCAGG - Intronic
1091798641 12:3311025-3311047 CTGGGAGGGGAGCGAGGGGCTGG + Intergenic
1091823529 12:3492910-3492932 CGGGGATGGGGGTGTGGCGCGGG + Intronic
1092616797 12:10222947-10222969 GTGGGGTGGGAGTGGGGAGCAGG + Exonic
1093780000 12:23123826-23123848 GTAGGTTTGGAGTGAGGCCCAGG - Intergenic
1094595365 12:31860876-31860898 CTGAGGTGGGAGTGAGGCATCGG + Intergenic
1094807726 12:34108164-34108186 CTGGGCTGGGAGGGCGGCGCAGG + Intergenic
1096803879 12:54128443-54128465 CTGGGTTGGGGGTGGGGGGGTGG - Intergenic
1096986922 12:55765777-55765799 CTGGGTGGGGAGGGAAGAGCAGG - Intronic
1097182544 12:57179603-57179625 CAGGGTTGGGAGCAAGGGGCGGG - Intronic
1097705809 12:62867037-62867059 CTGGGTTGTGAATGAGCCACAGG - Intronic
1099425209 12:82515350-82515372 ATGGGTTTGGAGTGGGGCCCAGG - Intergenic
1099792744 12:87357871-87357893 CTGGGTTGGGGGTGAGGGAAGGG - Intergenic
1100089801 12:90955122-90955144 CTGGGTTGAGAGGGAGCAGCAGG - Exonic
1100431385 12:94534453-94534475 CAGGGCTGGGAGTGAGGTGTTGG - Intergenic
1102584578 12:113914271-113914293 CTGGGTGGGGACTGAGCAGCAGG - Intronic
1102823362 12:115926597-115926619 CTGGGCTGGGGGTGAGGGGTAGG + Intergenic
1103133021 12:118484991-118485013 CTGGGGTGGGAGTGAGTCATTGG + Intergenic
1104222803 12:126801764-126801786 CTGGGTGGGGTGTGAGGTGGGGG + Intergenic
1104857289 12:131908147-131908169 CTGGGGCGGGAGTGCGGGGCTGG + Intronic
1105414264 13:20194647-20194669 TGGGGTGGGGAGTGGGGCGCCGG + Intergenic
1106236460 13:27865286-27865308 CTGAGTTGGGATTGAGACCCAGG - Intergenic
1107116791 13:36755756-36755778 ATGGGTTGAAGGTGAGGCGCTGG - Intergenic
1107660576 13:42635197-42635219 CTGGGTTTAGAGTGGGGCTCAGG - Intergenic
1107763389 13:43706961-43706983 CTGGGTCGGGAGTGAGGGTGGGG - Intronic
1109375553 13:61486888-61486910 CTGGTTTGGGGGTGAGGTGGTGG + Intergenic
1109954969 13:69553680-69553702 GTGGGGTGGGAGTGAGGCGAGGG + Intergenic
1110299959 13:73914758-73914780 CTGGGTGGGGGGTGATGGGCAGG + Intronic
1112636336 13:101221951-101221973 CTGGGGTGGGAGTGAGTGGTTGG - Intronic
1113292678 13:108923577-108923599 CGAGGTGGGTAGTGAGGCGCTGG - Intronic
1113741240 13:112713952-112713974 CTGGGTGGGAAGGGAGGCGTGGG - Intronic
1113910629 13:113839647-113839669 CCGGAGTGGGAGTGAGGAGCGGG + Intronic
1114554786 14:23555795-23555817 CTGCGTTGGGGGTGCGGCGGGGG + Intronic
1116982564 14:51187001-51187023 CTGGGCTGGGATTGGGGCGTGGG - Intergenic
1117105519 14:52394054-52394076 AGGGGTTGGGAGTGAGAGGCAGG + Intergenic
1118379777 14:65208172-65208194 GTGGGTTGGGGGTGGGGAGCCGG + Intergenic
1119761603 14:77155606-77155628 CTGGGGTGGGAGTGGCGCGGAGG + Intronic
1121444499 14:93970059-93970081 CTGGGTTGGTAGAGAGGGGAAGG - Intronic
1122321094 14:100856295-100856317 CTGGGTCGGGGGTGAGGCATAGG + Intergenic
1122601806 14:102925325-102925347 CTGGGGTGGAAATGAGGCCCAGG - Intronic
1126131751 15:45348508-45348530 CTGGGGTGGCAGTGGGGCCCAGG + Intergenic
1126158576 15:45587554-45587576 CCGGGCTGGGTGTGAGGGGCGGG + Intronic
1126216719 15:46163913-46163935 CTGGGAAGGTAGTGAGGGGCAGG + Intergenic
1127117570 15:55743140-55743162 CTGGGGGCGGAGTGAGGCGGCGG + Intergenic
1128565405 15:68697780-68697802 CTGGGCTGGGAAAGAGGCACAGG + Intronic
1130098952 15:80877439-80877461 CCGGGTTGGGGGTGAGGAGGTGG - Intronic
1130213368 15:81946376-81946398 CTGGGGTGAGAGTGAGCCACAGG + Intergenic
1131133173 15:89912876-89912898 CTGGGCTGGGGGCGCGGCGCGGG + Exonic
1131194871 15:90347718-90347740 GTGGGGTGGGAGTGGGGAGCAGG - Intergenic
1131970743 15:97890365-97890387 ATTGGTTAGGAGTGAGGAGCTGG + Intergenic
1132445027 15:101908808-101908830 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1132699272 16:1215432-1215454 CATGGGTGGGAGTGAGGGGCGGG + Intronic
1132855478 16:2042863-2042885 GAGGGTGGGGAGGGAGGCGCTGG - Intronic
1132861355 16:2073299-2073321 CTGGGCTGGTTCTGAGGCGCAGG + Intronic
1132870998 16:2115737-2115759 CTGGGCTGGGAGTGCTGCCCAGG - Intronic
1133033202 16:3021313-3021335 CTGGGCTGTGAGTGGGGGGCAGG + Exonic
1134079108 16:11312863-11312885 CTGGGTGGGGAGTGAGGGGAGGG - Intronic
1134240514 16:12502538-12502560 CAGGGCTGGGAATGAGGCCCCGG - Intronic
1134521530 16:14921146-14921168 CTGGGCTGGGAGTGCTGCCCGGG + Intronic
1134709201 16:16319797-16319819 CTGGGCTGGGAGTGCTGCCCGGG + Intergenic
1134716410 16:16359826-16359848 CTGGGCTGGGAGTGCTGCCCGGG + Intergenic
1134880901 16:17744975-17744997 CGGGGCTGGGAGGGAGGGGCTGG + Intergenic
1134950404 16:18348848-18348870 CTGGGCTGGGAGTGCTGCCCGGG - Intergenic
1134958340 16:18392333-18392355 CTGGGCTGGGAGTGCTGCCCGGG - Intergenic
1135403346 16:22181283-22181305 CTGGGAAGGGAGGGAGGAGCGGG + Intronic
1136414109 16:30093176-30093198 CAGGGTTGGGAGTTGGGGGCAGG - Intronic
1137559422 16:49493238-49493260 CTTGGTTGGGAGGGAGGAGAAGG - Intronic
1137830543 16:51539380-51539402 ATGGGTTGGGGGTGGGGTGCTGG - Intergenic
1138566338 16:57835998-57836020 CTGGGTTGGAAGTGAGGGCCTGG - Intronic
1139446378 16:67001043-67001065 CTGGGTGGGAAGGGAGGGGCGGG + Intronic
1139966727 16:70749874-70749896 CTGGGGTGGAAGAGAGGCCCTGG + Intronic
1141509132 16:84501384-84501406 GTGGGATGGAAGTGAGGGGCTGG - Intronic
1142028735 16:87828116-87828138 CTGTGTGGGGAGTTGGGCGCGGG + Intergenic
1142187585 16:88701769-88701791 CTGGGTGGGCTGTGGGGCGCAGG + Intronic
1142373159 16:89694120-89694142 CTGGGCTGGGGGAGAGGAGCCGG + Intronic
1142434186 16:90046820-90046842 CCGGGTTGGGAGTGAGGTTAGGG - Intergenic
1142982934 17:3681783-3681805 CTGGGGTGGGAGGCAGGGGCTGG - Intronic
1143183496 17:4997929-4997951 CTGGGGCGGGAGCGAGGGGCGGG - Exonic
1143374225 17:6457896-6457918 CTGGGTTGGGCCTGGGGTGCAGG - Intronic
1143697427 17:8630706-8630728 TGGGTTTGGGACTGAGGCGCTGG - Exonic
1144635009 17:16900532-16900554 CTGGCATGGGAGGCAGGCGCAGG - Intergenic
1144834127 17:18148127-18148149 CTGGGTCGGGGGTAAGGTGCGGG - Exonic
1145915325 17:28570778-28570800 CTGAGTTGGGTGGGAGGAGCGGG - Intronic
1145992884 17:29089830-29089852 CTGGCCTGGCAGTGAGGCACAGG + Intronic
1146058788 17:29593792-29593814 CTGGGGAGGGGGTGCGGCGCGGG + Intronic
1147286954 17:39409936-39409958 CTGGGTTGGGGGTGAGGTACTGG + Exonic
1147736611 17:42642768-42642790 GTGGGGTGGGAGTGGGGGGCAGG - Intergenic
1148080236 17:44963980-44964002 CTGGGTTGGCAGTGGGGCCCTGG - Intronic
1148132486 17:45270501-45270523 CTGGGCTGTGAGAGGGGCGCAGG + Exonic
1149028409 17:52056443-52056465 CTGGGCTGGGAAAGAGGAGCTGG + Intronic
1149182218 17:53952817-53952839 CTGGGTTGAGAAAGAGGTGCTGG - Intergenic
1150008331 17:61483338-61483360 CTCTCTTGGGAATGAGGCGCTGG - Exonic
1150131312 17:62670705-62670727 CAGGGTTAGGAGTTAGGAGCGGG + Intronic
1151557263 17:74852746-74852768 TTGGGGCGGGAGGGAGGCGCAGG - Intronic
1151676842 17:75603050-75603072 CAGGGTTAGGGGTGAGGCACTGG - Intergenic
1151795957 17:76345931-76345953 CTGGCTTTGGAGGGAGGAGCAGG - Intronic
1151823021 17:76507232-76507254 CTGGGAGGAGAGTGAGGCCCGGG + Intergenic
1151903785 17:77034899-77034921 CTGGATGGGGAGTGTGGGGCAGG + Intergenic
1152306606 17:79524626-79524648 CTGTGCTGGGAGTGTGGAGCAGG + Intergenic
1152535872 17:80950063-80950085 CTGGGTGCGGGGCGAGGCGCAGG + Intronic
1152571962 17:81124888-81124910 CTGGGCTGGGCATGAGGGGCAGG - Intronic
1152627985 17:81396963-81396985 CTGGGCTGGGAGTGGGCCCCGGG + Intronic
1152805744 17:82355122-82355144 GTGGGCTGGGAGTGAGGGGAGGG + Intergenic
1152861094 17:82697626-82697648 CTCGGCTGGGAGTGAGGAGCAGG - Intronic
1153972032 18:10235742-10235764 CTGGGTTCCCAGTGAGGGGCTGG - Intergenic
1157604076 18:48914788-48914810 CTGGGCTGGGGGTGAGAGGCTGG - Intergenic
1158023635 18:52870681-52870703 CTGGGTGGGGGGTGGGGCACGGG - Intronic
1158282281 18:55840799-55840821 CTGGGGTGGGAGGGAGGCTCAGG + Intergenic
1158483472 18:57843582-57843604 CTGTAATGGGAGTGAGGAGCAGG + Intergenic
1160560136 18:79750968-79750990 CAGGCTTGGGAGGGAGGGGCTGG + Intronic
1160560207 18:79751173-79751195 CAGGCTTGGGAGGGAGGGGCTGG + Intronic
1160640285 19:124903-124925 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1160806782 19:995418-995440 CTGGGCTGGGATCCAGGCGCTGG - Intronic
1161151414 19:2712042-2712064 CTGGGTTAGGGGTGAGGGGTGGG + Intergenic
1161300179 19:3538789-3538811 GTGGGTGAGGAGTGAGGAGCTGG + Intronic
1161401408 19:4067418-4067440 GTGGGTTGGGGGTGAGGCGGTGG + Intergenic
1162830657 19:13282311-13282333 CTGGGTTGGGAGGGAAGGGTTGG + Intronic
1162967748 19:14164086-14164108 CTGGGTGGGGGGTGGGGAGCAGG - Intronic
1163833230 19:19557783-19557805 CTGGGTTGGGGGGGTGGGGCGGG + Intergenic
1163848352 19:19650046-19650068 CTGGGTGGGTAGGGAGGTGCGGG - Intronic
1164536589 19:29090430-29090452 TTGGGTTGGGAGTGAGAGGGAGG + Intergenic
1165490613 19:36120976-36120998 CTGGGGTGGGAATGAGGGCCGGG + Intronic
1165806686 19:38584708-38584730 CCAGGTTGGGTGTGGGGCGCAGG - Intronic
1166035582 19:40165780-40165802 CTGGGTGTGCAGAGAGGCGCTGG - Intergenic
1166727530 19:45037815-45037837 CTGGGTGGGGAGGGAGGTGGAGG + Exonic
1166929923 19:46296468-46296490 CTGGGGTGGCAGGGAGGGGCTGG + Intergenic
1167049445 19:47069407-47069429 GTGGGTTTGCAGTGAGGGGCAGG - Intronic
1167291285 19:48626352-48626374 CGGGGATGGGGGTGAGGTGCTGG + Exonic
1167590734 19:50402999-50403021 CTGTGTTGGGAGTGAGGGGCAGG + Intronic
1168187315 19:54708543-54708565 CTGAGCTGGGAATGAGGAGCGGG + Intergenic
925574206 2:5343809-5343831 GTGGGTGGGGAGTCAGGCCCTGG - Intergenic
925932323 2:8718542-8718564 CTAGGTTGGGAGGGTGGCTCAGG - Intergenic
926075261 2:9937873-9937895 CTGGATTGGGAGTCAGGAGTAGG - Intergenic
926348835 2:11976637-11976659 CTGGGTTGGGGGTGGGGCGCTGG + Intergenic
926742802 2:16126193-16126215 CTGGGTTGGGTGTGGGAAGCAGG + Intergenic
927898228 2:26799372-26799394 CTGGGTGGGGTGTGTGGCCCAGG + Intronic
927947994 2:27148922-27148944 CTGGGTTAGGAGGCAGGCGGAGG + Intergenic
929399529 2:41563919-41563941 CAGGGTTGTGAGTGAGGAGGTGG - Intergenic
929605860 2:43233734-43233756 ATGGGTTTGGAGGGAGGCTCAGG + Intronic
929711348 2:44270164-44270186 CTGGGTGGGGAGTGGGGCTGGGG - Intergenic
930101841 2:47609446-47609468 CTGGGTTGCTGGTGAGGGGCTGG + Intergenic
931117911 2:59184413-59184435 CTGGGGTGGGAGGAAGCCGCAGG + Intergenic
934770566 2:96905110-96905132 CTGGGGTGGGGGTGGGGGGCAGG + Intronic
934854008 2:97717923-97717945 CTGGGCTGTGAGTGTGGGGCAGG + Intronic
937289993 2:120776374-120776396 CTTGGTTGTGAGTGAGGTCCAGG + Intronic
938579116 2:132630420-132630442 GAGGGTTGGGTGTGAGGAGCAGG + Intronic
938765905 2:134460317-134460339 CAGGGCTGGGAGGGAGGCCCTGG - Intronic
938817577 2:134919265-134919287 GGGGGTTGGGAGTGTGGCTCAGG + Intronic
939983996 2:148812621-148812643 CTGGGTCAGGAGTGTGGAGCAGG + Intergenic
940249849 2:151663156-151663178 CCCGGTTGGGAGGGAGGGGCTGG + Intronic
940453747 2:153871887-153871909 CTGGGGTGGGAGGGGGGCGGGGG + Intergenic
941674425 2:168328647-168328669 CTGAGATGTGAGTGAGGCACTGG + Intergenic
941864650 2:170322168-170322190 CTGGGGTGGGAGTGGGGTGAAGG - Intronic
942241218 2:173965002-173965024 CGGGGAGGGGAGGGAGGCGCAGG + Intronic
942459205 2:176158077-176158099 TTGGGTGGGGAGAGAGGAGCGGG - Intronic
942947481 2:181685363-181685385 GTGGGTTGGGAGAGAGGACCCGG + Intergenic
944594080 2:201245672-201245694 CCAGGTTTGGAGTGAGGCGTAGG + Intronic
945413083 2:209535082-209535104 CTGGGGTGGGAGAGAGGAGAAGG - Intronic
946138020 2:217664172-217664194 GTGGGTTTGGGGTGAGGCCCAGG - Intronic
946209650 2:218137394-218137416 TTGGGTTGGGGGTGAGGGGATGG - Intergenic
947749950 2:232526693-232526715 CTGGGTTGGGAGGGAGGGCAGGG + Intronic
948260361 2:236599989-236600011 CAGGGTGGGGAGTGAGGGGAGGG - Intergenic
948281780 2:236752631-236752653 CTGGGCCAGGAGTGAGGAGCTGG + Intergenic
948341534 2:237256606-237256628 CTGGGCTGGGAGGGAGACGGTGG - Intergenic
948474704 2:238209769-238209791 CTGGGGTGGGAGTGAGGAGTTGG + Intergenic
948664090 2:239523781-239523803 CTGGGGTGGTAGTGAGGAGGAGG - Intergenic
948801738 2:240436268-240436290 CTGGCGAGGGAGTGCGGCGCGGG - Intronic
949060314 2:241953157-241953179 CTCAGTCGGGAGTGAGGCTCAGG + Intergenic
1168751918 20:288600-288622 CTGGGTGGGGATAGAGGCTCAGG - Intronic
1168993700 20:2116457-2116479 CTGGGTTTGGAATGAGGCCCAGG - Intronic
1169270026 20:4192172-4192194 CTGTGTTGGAAATGAGGGGCTGG + Intergenic
1169326813 20:4683411-4683433 CTGGGTGGGGAGTGGGGTGTAGG - Intergenic
1171102235 20:22394962-22394984 CTGGATTGGGACTCAGGAGCTGG - Intergenic
1171953485 20:31441491-31441513 GTGGGTTAGGAGAGAGGCGGGGG + Intronic
1172443872 20:34983160-34983182 CTGGGTGGGGAGGGAGGCCTCGG - Intronic
1172838694 20:37888996-37889018 CTGGGGTGGGGGTGAGGGGTGGG + Intergenic
1172929974 20:38579628-38579650 CTGGGTTGGGGGTGATTCCCTGG - Intergenic
1173002454 20:39114414-39114436 CTGGGTTGGGAGTTAGGGCAGGG - Intergenic
1173163637 20:40671007-40671029 GTGGCTGGGGAGTGAGGTGCTGG - Intergenic
1173852537 20:46228077-46228099 CTGGGTTGAGAGTCAGGTCCTGG - Intronic
1174082407 20:47979780-47979802 CTGACTTGGGAGTCAGGAGCTGG - Intergenic
1175439671 20:58981601-58981623 TTGGGGTGGGGGTGAGGCGCCGG + Intronic
1175445460 20:59016560-59016582 CTGGGTGGGGAGGGAGGCTCGGG + Intergenic
1175888215 20:62303988-62304010 CTGGGTTGGAGGTGTGGCCCTGG + Intronic
1176041794 20:63069591-63069613 CGGGGTTGGGAGGGAGGACCGGG + Intergenic
1176101777 20:63367727-63367749 CTGGATTGGGAGGGGGGTGCTGG - Intronic
1176423310 21:6533049-6533071 CTGGGTAGGGGCTGAGGGGCTGG + Intergenic
1177027425 21:15936644-15936666 CTGGGGTGGGTGAGAGGAGCAGG - Intergenic
1178481612 21:32984130-32984152 CTGTGTTGGAAGTGAGGCCCTGG - Intergenic
1178510571 21:33201828-33201850 CTGGGTTGGGGGATAGGGGCAGG + Intergenic
1179223664 21:39432670-39432692 CTGGGTTGGGAGTGAGGCGCAGG - Intronic
1179698803 21:43141365-43141387 CTGGGTAGGGGCTGAGGGGCCGG + Intergenic
1179992980 21:44958251-44958273 CTGGGTTTGGGGCGAGGCCCAGG + Intronic
1180074769 21:45456822-45456844 CTGGGTCGGGAGCGAGGCACAGG - Intronic
1180086250 21:45509261-45509283 CTGGGCTGGGTGAGAGGGGCTGG - Intronic
1180099711 21:45578903-45578925 CTGGATTGGGAGCGGGGCGGGGG - Intergenic
1180840176 22:18955417-18955439 CTGGGTTGGGTGTGTGGGTCTGG - Intergenic
1181038457 22:20180983-20181005 GTGAGCTGGAAGTGAGGCGCTGG - Intergenic
1181054992 22:20256655-20256677 CTGGCCTGGGAGGGAGGCACCGG - Intronic
1181061717 22:20284997-20285019 CTGGGTTGGGTGTGTGGGTCTGG + Intergenic
1181260254 22:21592261-21592283 CTGGGGTGGGAGTGGGGGGGTGG - Intronic
1181522617 22:23458320-23458342 CTGGGTTGGGAGGAGGGCGAAGG + Intergenic
1181725361 22:24807057-24807079 GTGGGGTGGGAGTGGGGCGGGGG - Intronic
1181797432 22:25320278-25320300 CTGGGTTCTCAGTGTGGCGCTGG + Intergenic
1182529149 22:30941858-30941880 CTGGGAAGGGAGGGAGGCCCTGG - Intronic
1183466886 22:37984437-37984459 GTGGGCTGGGAGGGAGGGGCGGG + Exonic
1183807152 22:40221074-40221096 CAGAGTTGGGAGGGAGGGGCAGG - Intronic
1184110287 22:42390130-42390152 CTGGGCTGGGACAGAGCCGCCGG + Intronic
1184148936 22:42627531-42627553 TTGGGGTGTGGGTGAGGCGCAGG - Intronic
1184246968 22:43240748-43240770 CTGGATTGGGAGTGGGAGGCAGG - Intronic
1184268005 22:43360303-43360325 GTGGGTGGGGAGTGAAGCGGGGG + Intergenic
1184658852 22:45956018-45956040 CTGCGGTGGGGGTGAGGGGCAGG + Intronic
1185253838 22:49820796-49820818 CTGGGGTGGTTGTGAGGGGCAGG - Intronic
1185365985 22:50436926-50436948 CTGGGTGGGGTCTGGGGCGCTGG + Intronic
1185380977 22:50507475-50507497 CGGGGTTGGGAGTGAGGGCCAGG - Intronic
949676325 3:6458049-6458071 TAGGGCTGGGAGTGAGGCGATGG - Intergenic
949712393 3:6886338-6886360 CCTGTTTGGGAGTGAGGGGCTGG + Intronic
950252155 3:11474860-11474882 ATGGGGTGGGAGTGGGGGGCCGG + Intronic
951017083 3:17742847-17742869 GTAGGTGGGGAGTGAGCCGCGGG + Intronic
952056633 3:29454302-29454324 TTGGGGTGGGAGTGAGGAGAAGG + Intronic
952403955 3:32988991-32989013 CTGGGGTGGGGGTGGGGTGCTGG + Intergenic
952712837 3:36448903-36448925 CTGGGTCGGGAGTGGGGGGGGGG - Intronic
952722298 3:36545986-36546008 CTAGGTTTGGAATGAGGCCCAGG - Intronic
953508638 3:43512049-43512071 CTGGGGTGGGAGTGTGGAGAAGG + Intronic
953742232 3:45547766-45547788 GTGGGTGGGGGGTGAGGGGCAGG - Exonic
954314354 3:49793119-49793141 CCAGGTTGTGAGTGAGGGGCAGG - Intronic
954447724 3:50555561-50555583 TTGGGTTGGGGGAGAGGGGCAGG + Intergenic
954699029 3:52442084-52442106 CTGGGTAGGGACAGAGGGGCAGG - Intronic
954735991 3:52706733-52706755 GAGGGTTGGGAGGGAGGCGGGGG - Intronic
955711463 3:61783639-61783661 TTGGGGTGGGAGTGGGGAGCTGG + Intronic
955735353 3:62033088-62033110 CTGGGCTGGGAGGCAGGAGCCGG - Intronic
956723592 3:72138969-72138991 CTGGGTTTGGAGAGAGGGGCAGG - Intergenic
957861588 3:85958898-85958920 CAGGGTTGGGGGTGAGGGGAGGG + Intronic
961501757 3:127341163-127341185 CTGGGTTGGGTGAGAGGGGCTGG - Intergenic
961688968 3:128654470-128654492 CTGGCTCGGGAGTGAAGCGGAGG - Intronic
962219257 3:133550099-133550121 GTGGGCTGGGAGTGAGGGGCAGG - Intergenic
962259928 3:133895756-133895778 CGGCGCTGGGAGAGAGGCGCGGG + Exonic
962692492 3:137913282-137913304 GTGGGTTGGGGGTGAGGGGAGGG + Intergenic
964634849 3:158847585-158847607 CTGGGGTGGGAGGGTGGTGCTGG + Intergenic
964662066 3:159131301-159131323 CTTGGGTGGGGGTGAGGCGGGGG - Intronic
965467211 3:169044868-169044890 AAGGGTTGCGAGTGAGGCGGGGG + Intergenic
968066724 3:195763042-195763064 CTGGGCCGGGAGGAAGGCGCTGG + Intronic
968477905 4:821002-821024 CTGGGTTTGGCGTGAGGGGGAGG - Intronic
968626270 4:1628018-1628040 CTGGGTGGGGAGGGTGGCACGGG + Intronic
968653133 4:1767764-1767786 CGGGGTCGGGAGCGGGGCGCGGG - Intergenic
968697823 4:2041460-2041482 CTGGGTTGGGGGTGGGTAGCCGG + Intronic
968948945 4:3680275-3680297 CTGGGCTGGGGGTGCGGGGCTGG + Intergenic
969002255 4:3991808-3991830 CTGGGTTAGGAGGGAGGCTGGGG + Intergenic
969633455 4:8351781-8351803 CAGGCTTGGGAGTTAGGCCCAGG - Intergenic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
971757326 4:30720872-30720894 CTGGGTTTGGAGTGAGTGCCTGG + Exonic
971779075 4:31007065-31007087 CTTGCTTGGAAGTGAGGCACTGG + Intronic
973788599 4:54358109-54358131 CTGGATGGGGAGTGGGGCTCAGG - Intergenic
974892268 4:67896652-67896674 AGGGGTTGGGGGTGAGGCTCAGG + Intergenic
975847099 4:78536229-78536251 TTGGGGTGGGAGTGAGAGGCAGG - Intronic
976267951 4:83203293-83203315 CTGGGGTGGGAGTGAGTGGTTGG - Intergenic
977231040 4:94451862-94451884 CTGGGTCGGGGGTGGGGCGAGGG + Exonic
979099803 4:116599734-116599756 CTGGGTGGGCAGGGAGGGGCTGG + Intergenic
980750116 4:137077166-137077188 CAGGGTTGGGACTGAGCCTCAGG - Intergenic
980841121 4:138262621-138262643 CTGGGTAGGAAGTGAGGCAAAGG - Intergenic
981315492 4:143336535-143336557 CAGGGTTGGCAGCGAAGCGCGGG - Intergenic
984625569 4:182004208-182004230 GGGGGTTGGGGGTGAGGCGAGGG - Intergenic
984973637 4:185210718-185210740 CGGGCTTGGGGGTGAGGCGCTGG - Intronic
985493187 5:191041-191063 CTGGTTACCGAGTGAGGCGCAGG + Intergenic
985818174 5:2142005-2142027 CGGGGCTGGGAATGAGGCACGGG + Intergenic
985889667 5:2705701-2705723 CTGTGCTGGGAGTGAGGGGAGGG + Intergenic
985936469 5:3101502-3101524 CTGGGTTGGGAGAGGGGAGCAGG - Intergenic
985937270 5:3106629-3106651 CTGGGAGGGGAGTGAGGGGAGGG - Intergenic
987065763 5:14288328-14288350 CTGGGTGGGGAGAGAGAGGCTGG - Intronic
987312092 5:16690752-16690774 GGGTGCTGGGAGTGAGGCGCAGG + Intronic
988625532 5:32870862-32870884 CTGGGCTGGGAGAGAGGCATTGG + Intergenic
988799782 5:34685451-34685473 CTAGGTTGGGAGAGAGGTGAGGG + Intronic
994133803 5:96262283-96262305 GTGGGTTGGGAGGGAGGAGAAGG + Intergenic
995028528 5:107452213-107452235 CGGGGTTGGGGGTGAGGGGAGGG + Intronic
997998292 5:138604001-138604023 CTGGGTTGGCAGGGAGGCCAGGG + Intergenic
998130241 5:139648205-139648227 CTGCGCTGGGAGGGAGGCGGCGG + Intronic
998143391 5:139712075-139712097 CTCGGTTTGGAGCGAGGAGCTGG + Intergenic
998875356 5:146593674-146593696 CTGGGTTTGGGGTGAGGGGAAGG + Intronic
999251390 5:150184290-150184312 CTGGATTGAGAGGGAGGCCCTGG + Exonic
999533180 5:152485353-152485375 CTGGGGTGGTAGTGAGGAGTTGG - Intergenic
999621270 5:153476813-153476835 TTGGGTTAGGAGTGAGGCATTGG - Intergenic
1002068536 5:176664889-176664911 CTGGGGTGGGTGGGAGGGGCAGG - Intergenic
1002180138 5:177427004-177427026 CTGGGCGGGGTGTAAGGCGCAGG - Intronic
1002424431 5:179166979-179167001 CTGGGCAGGGAGGGAGGCGCCGG + Intronic
1002737063 5:181401469-181401491 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1002747634 6:73310-73332 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1003563558 6:7203558-7203580 CTGGGTTTGGAGAGAAGCTCTGG + Intronic
1005657970 6:27963049-27963071 TTGGGTTGGAAGTGAAGAGCAGG - Intergenic
1006283330 6:33073918-33073940 CTGGGATGGGGGTGGGGCTCGGG - Intronic
1007748011 6:44055062-44055084 CTGGGGTGGCAGTGTGGGGCCGG + Intergenic
1009813045 6:68694465-68694487 CTGGTATGGGAGTGAGGTGGGGG + Intronic
1010218706 6:73428599-73428621 CTGGGTTGGGTCTGGGGGGCAGG - Intronic
1010454427 6:76038715-76038737 CTGGGGTGGGAGTGAGGCCAAGG - Intronic
1010540748 6:77089133-77089155 CTGGCTTTGGAATGAGGCCCAGG - Intergenic
1010929857 6:81788715-81788737 TTGGGTTAGGAGATAGGCGCTGG - Intergenic
1011276970 6:85641953-85641975 CTGGGTGCGGAGTCAGGGGCGGG - Intronic
1011769067 6:90655400-90655422 CTGGATAGGGAGGGAGGGGCCGG - Intergenic
1013818232 6:114124256-114124278 CTGGGTTGGGACTCAGGAGCTGG - Intronic
1016104828 6:140148718-140148740 CTGGGTTGGGGGTGAGGTAAGGG + Intergenic
1016339716 6:143049650-143049672 CCGGGTTGGGACTGAGCCCCAGG - Intergenic
1018035324 6:159876546-159876568 CTGGGTGGGGTCTGAGGCACAGG - Intergenic
1018838874 6:167505125-167505147 GTGGGTCTGGAGTGAGGCCCAGG + Intergenic
1019147713 6:169985623-169985645 CTGGGCTCGGGGAGAGGCGCGGG - Intergenic
1019242159 6:170677039-170677061 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1019442288 7:1053398-1053420 CTGGGTTGGCTGTGAGGGTCGGG + Intronic
1019588710 7:1818224-1818246 CTGGGTTGGGAGGAGGGCGAAGG - Intronic
1020107288 7:5428040-5428062 CTCGGTGGGGTGTGGGGCGCTGG - Intergenic
1022573316 7:31474379-31474401 CTGGGGTGGGAGTAGGGGGCAGG - Intergenic
1022780041 7:33572084-33572106 CTGGGAGGGTAGTGAGGAGCAGG - Intronic
1023034407 7:36118244-36118266 GTGGGTTGGGAGTGGGGAGCAGG - Intergenic
1023743561 7:43302224-43302246 CTGGCTTGGGAGGGAGCCTCAGG - Intronic
1024043698 7:45573984-45574006 CTGGGTTCGCAGTCAGACGCGGG + Intergenic
1024599213 7:50964708-50964730 GTGGGATGGGAGTGGGGGGCGGG - Intergenic
1025926714 7:65966384-65966406 CTGGGGTGGGAATGAGGGGCTGG + Intronic
1025937789 7:66051008-66051030 CTGGGTTGGGAGTGGAGAGCAGG - Intergenic
1026467017 7:70662779-70662801 CAGGGTTGGGAGTTAGGCACAGG + Intronic
1026899162 7:74027659-74027681 CGGGGTGGGGGCTGAGGCGCGGG + Intergenic
1029107811 7:98192954-98192976 CTGTGTTGGGAGTGAGTCTGGGG - Exonic
1029669452 7:102019181-102019203 GTGGGGTGGGAGGGGGGCGCGGG - Intronic
1030050383 7:105532229-105532251 CTGGGTAGTGAGTGTGTCGCTGG + Exonic
1030595424 7:111532538-111532560 CAGGGTTGGGAGTAAGGAGTAGG + Intronic
1030729511 7:112969412-112969434 CTGTGTTAGGAGTGATGCACAGG + Intergenic
1031660383 7:124416931-124416953 ATGGGTGGGGGGTGAGGGGCGGG - Intergenic
1032476448 7:132214544-132214566 CTGGGGTGGGAGGAAGGGGCAGG - Intronic
1032538432 7:132683910-132683932 CTGGGATGGGAAGGAGGCACCGG - Intronic
1035505959 8:131112-131134 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1036410326 8:8493989-8494011 CTGGGTTGGAAGAGAGGGGAAGG + Intergenic
1037542673 8:19887616-19887638 CTGGGGTGGGAGGCAGGGGCAGG - Intergenic
1040915467 8:52563869-52563891 CTGGGTGTGGAAGGAGGCGCTGG - Intronic
1041044468 8:53878025-53878047 CTGGGTTGGGCGTGGGTCCCAGG - Intronic
1041467120 8:58168001-58168023 CTGGGTGGGGGGTGGGGAGCTGG - Intronic
1043956086 8:86361147-86361169 CTAGGTTGGGAGTGAAGAGTGGG + Intronic
1043968841 8:86508449-86508471 CTGAGTAGGAAGTGAGGAGCGGG + Intronic
1045475239 8:102547006-102547028 CTGGGTTAAGAGGGAGGAGCTGG + Intergenic
1047540642 8:125762312-125762334 CTGGGGTGGGAGGGATGCGGGGG + Intergenic
1047753263 8:127898708-127898730 CTGTGGTGGGGGTGAGGCGGTGG + Intergenic
1047898078 8:129388919-129388941 CTGGATGGGGACTGAGGTGCGGG + Intergenic
1047991615 8:130292402-130292424 CTGGGATGGGATTGGGGGGCAGG - Intronic
1048607243 8:135982412-135982434 CTGGGTGAGGAGTGGGGCTCAGG - Intergenic
1048995233 8:139789946-139789968 CTGGGTCGGGAGGGACGCACCGG - Intronic
1049696270 8:143985690-143985712 CAGGGTTGGGGTTGAGGTGCTGG - Intronic
1049812828 8:144583144-144583166 GTGGGCTGGGAGGGAGGGGCTGG - Intronic
1051968970 9:22863747-22863769 CTGTGTTGGGTGTGTGGCTCTGG - Intergenic
1053344803 9:37370532-37370554 GTGGCATGGGAGTGAGGGGCTGG + Intergenic
1053362750 9:37500969-37500991 GGGGGTTGGGAGTGAGGAGCAGG + Intronic
1055729425 9:79265203-79265225 ATGGGTGGGGAGGGAGGCTCAGG + Intergenic
1059406001 9:114098607-114098629 CTGGGTTGGGGGTGGGGTGGGGG + Intronic
1059432104 9:114256521-114256543 TGGGGGTGGGAGTGAGGCCCTGG + Intronic
1059841912 9:118227007-118227029 CTGGGGAGGGAGTGTGGCTCTGG + Intergenic
1060435765 9:123591425-123591447 CCGGGTTGGGAGCGTGGGGCTGG + Intronic
1060938061 9:127527335-127527357 GCGGGTGGGGAGTGAGGCCCAGG + Intronic
1060988731 9:127836252-127836274 CCGGGCTGGGGGTGAGGGGCTGG - Intronic
1061198614 9:129122920-129122942 TTGGGTTGGGAGTCAGGGTCAGG + Intronic
1061666316 9:132162677-132162699 TTGGGGTGGGGGAGAGGCGCGGG - Intronic
1061767035 9:132888024-132888046 CTGGGTTAGGGGTGAGGAACTGG - Intronic
1061835136 9:133323689-133323711 CTGGATTGGGAGGGTGGGGCTGG - Intergenic
1062167384 9:135114684-135114706 CTGGGGAGGGAGGGAGGGGCTGG + Intronic
1062344836 9:136109849-136109871 CTGGGCTGGGGGAGGGGCGCCGG + Intergenic
1062703324 9:137919592-137919614 CTGGGTTGGAGGTGAGGGGCGGG - Intronic
1203602350 Un_KI270748v1:26261-26283 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1185462301 X:339063-339085 CTGGGTGGGGACTGAGGCGTGGG + Intronic
1185764283 X:2712212-2712234 AGGGGTTGGGAGTGAGGGGTGGG + Intronic
1187562749 X:20418223-20418245 CTGTGTTGGGAGTGGGGTGGGGG + Intergenic
1190105293 X:47556346-47556368 CTGGGTTGGCAGAGAGGAGCTGG + Intergenic
1190511743 X:51179720-51179742 GTGGGTTGGCAGTGAGGCTGAGG + Intergenic
1192244566 X:69361825-69361847 CTGGGATGGGTGTGAGGAGCAGG + Intergenic
1193640299 X:84003743-84003765 CTGGATTTGGAGGGGGGCGCTGG - Intergenic
1193696344 X:84710809-84710831 CTGGGTTGGCAGTAATGAGCAGG - Intergenic
1195256330 X:103094340-103094362 CGGGGGTGGGGGTGAGGCTCAGG - Intergenic
1195530112 X:105944515-105944537 AGGAATTGGGAGTGAGGCGCTGG - Intronic
1195923232 X:110002809-110002831 CGGGGCTGGGCGGGAGGCGCGGG + Intronic
1196818602 X:119685343-119685365 CTGGGTGGGGAGAGAGTCGTAGG - Intronic
1196820234 X:119695160-119695182 CTGGGTTGGCAGTGACACGGGGG + Intergenic
1200232079 X:154449087-154449109 CTGTCTGGGGAGTGAGGCCCAGG + Intronic
1200471772 Y:3594638-3594660 CAGGGTTGGGAGTGGACCGCCGG - Intergenic