ID: 1179224539

View in Genome Browser
Species Human (GRCh38)
Location 21:39442278-39442300
Sequence AAACCGCTGGCCCTTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179224539_1179224548 27 Left 1179224539 21:39442278-39442300 CCAGTGAGAAGGGCCAGCGGTTT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1179224548 21:39442328-39442350 GTGAACAGCTGCAGGGCCTTCGG 0: 1
1: 0
2: 1
3: 23
4: 244
1179224539_1179224544 4 Left 1179224539 21:39442278-39442300 CCAGTGAGAAGGGCCAGCGGTTT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1179224544 21:39442305-39442327 TGAGTCTTGAGACGCAGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 108
1179224539_1179224541 -1 Left 1179224539 21:39442278-39442300 CCAGTGAGAAGGGCCAGCGGTTT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1179224541 21:39442300-39442322 TCAGATGAGTCTTGAGACGCAGG 0: 1
1: 0
2: 0
3: 19
4: 212
1179224539_1179224546 19 Left 1179224539 21:39442278-39442300 CCAGTGAGAAGGGCCAGCGGTTT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1179224546 21:39442320-39442342 AGGCGGGGGTGAACAGCTGCAGG 0: 1
1: 0
2: 1
3: 7
4: 190
1179224539_1179224542 2 Left 1179224539 21:39442278-39442300 CCAGTGAGAAGGGCCAGCGGTTT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1179224542 21:39442303-39442325 GATGAGTCTTGAGACGCAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 124
1179224539_1179224543 3 Left 1179224539 21:39442278-39442300 CCAGTGAGAAGGGCCAGCGGTTT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1179224543 21:39442304-39442326 ATGAGTCTTGAGACGCAGGCGGG 0: 1
1: 0
2: 0
3: 20
4: 237
1179224539_1179224547 20 Left 1179224539 21:39442278-39442300 CCAGTGAGAAGGGCCAGCGGTTT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1179224547 21:39442321-39442343 GGCGGGGGTGAACAGCTGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 168
1179224539_1179224545 5 Left 1179224539 21:39442278-39442300 CCAGTGAGAAGGGCCAGCGGTTT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1179224545 21:39442306-39442328 GAGTCTTGAGACGCAGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179224539 Original CRISPR AAACCGCTGGCCCTTCTCAC TGG (reversed) Intronic
902238019 1:15070160-15070182 AAGCAGCTGGGCCTTCTCCCAGG + Intronic
902936792 1:19770206-19770228 TAACAGCAGGGCCTTCTCACTGG - Intronic
904434250 1:30484009-30484031 AATCCCCAGGCCCTCCTCACTGG + Intergenic
907111779 1:51933331-51933353 AAGGAGCTGGCCCTTCTCAGTGG + Exonic
912412201 1:109487145-109487167 GGACCCCTGGCCCTTCTCCCTGG - Exonic
912488189 1:110045919-110045941 AAACCCCTGTCCCTCCACACGGG + Intronic
915559042 1:156675955-156675977 TAACAGCTGCTCCTTCTCACAGG - Intronic
1067472408 10:46546628-46546650 AAACCGCTGGCCATGCTCTGGGG + Intergenic
1070593782 10:77818572-77818594 GCACCGATGGCCCTTCTCCCTGG + Intronic
1074704542 10:116119237-116119259 AACCTGCTTGCCCTTCTCTCAGG + Intronic
1074840436 10:117345729-117345751 TAACATCTGGTCCTTCTCACAGG - Intronic
1076239705 10:128895112-128895134 TAACAGCTGGTCCTACTCACAGG + Intergenic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1076907151 10:133368486-133368508 AGAGCCCAGGCCCTTCTCACGGG + Intronic
1078498133 11:11841463-11841485 AAAACGCTGTCCATTCTGACTGG + Intronic
1079548736 11:21668525-21668547 AATCCTTTGGCTCTTCTCACAGG + Intergenic
1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG + Exonic
1090923926 11:131233010-131233032 AATCTGCTGGCCTCTCTCACTGG - Intergenic
1092106828 12:5927296-5927318 AGACCTCTGTCCCTTCTCATTGG + Intronic
1102108987 12:110349719-110349741 CAACTGCTGGCTCTGCTCACAGG - Intronic
1108336311 13:49444836-49444858 AAACCACTAGCCCATTTCACAGG + Exonic
1109332253 13:60944233-60944255 AAGCTGCTGTGCCTTCTCACTGG - Intergenic
1109332344 13:60945047-60945069 AAGCTGCTGTGCCTTCTCACTGG + Intergenic
1113499576 13:110762703-110762725 GAAGCACTGGCCCTTCCCACTGG + Intergenic
1124135924 15:27036313-27036335 AAAACGCAGGCCCCTCACACTGG - Intronic
1129760297 15:78125316-78125338 AGAGCCCTGGCCCTTCTCACTGG - Intronic
1130725987 15:86439910-86439932 AACCCTCTGGCCGTTCTCACTGG - Intronic
1136934195 16:34443733-34443755 AAACCCCTTGCCTTTCTCCCCGG - Intergenic
1136970377 16:34968081-34968103 AAACCCCTTGCCTTTCTCCCCGG + Intergenic
1141907999 16:87040410-87040432 CAGCCCCTGGCCCATCTCACTGG - Intergenic
1147339663 17:39745952-39745974 AAGCCGCTGGCTCTCCTCACGGG - Exonic
1154191499 18:12234467-12234489 AACAGCCTGGCCCTTCTCACTGG - Intergenic
1162901803 19:13799698-13799720 AACCCACTGGCCCTTCCTACAGG + Exonic
1166990418 19:46689567-46689589 AGGCAGCCGGCCCTTCTCACTGG + Exonic
1168190636 19:54736041-54736063 AAATCACTCGCCCTTCTCAGAGG + Exonic
1168192856 19:54752437-54752459 AAATCACTCGCCCTTCTCAGAGG + Exonic
1168194945 19:54767265-54767287 AAATCACTCGCCCTTCTCAGAGG + Intronic
1168197193 19:54783707-54783729 AAATCACTCGCCCTTCTCAGAGG + Exonic
1168200780 19:54813912-54813934 AAATCACTGGCCCTTCTCAGAGG + Exonic
1168202996 19:54830169-54830191 AAATCACTCGCCCTTCTCAGAGG + Exonic
1168247574 19:55120920-55120942 GAACTGCAGGCCCTCCTCACTGG - Intergenic
926055511 2:9771696-9771718 CCAGAGCTGGCCCTTCTCACTGG - Intergenic
926358907 2:12066949-12066971 ATTACGCTGGCCCTTATCACGGG + Intergenic
926857533 2:17273091-17273113 AAAACCCTCTCCCTTCTCACTGG - Intergenic
927522404 2:23707254-23707276 AGACCGCTGTCCCTGCTCCCCGG - Exonic
929642599 2:43596430-43596452 AAACCCCTGCCCCATCTCGCAGG - Intergenic
930283667 2:49401653-49401675 AAAGCCCTGGCCCTTCTAAAGGG + Intergenic
934652228 2:96099206-96099228 AACCCGGAGGCCCTTGTCACTGG - Intergenic
939105990 2:137949410-137949432 AAACAGCTAGCTCTTGTCACAGG - Intergenic
948323687 2:237093405-237093427 AACCAGCTGGCCTTTCTCCCTGG - Intronic
948428049 2:237901113-237901135 CCACTGATGGCCCTTCTCACCGG + Intronic
1173109570 20:40174114-40174136 GGACAGCTGGCCCTTCTCAGCGG + Intergenic
1178064025 21:28883994-28884016 AAACCTCTGGAGCTTGTCACTGG - Intronic
1179224539 21:39442278-39442300 AAACCGCTGGCCCTTCTCACTGG - Intronic
1182516013 22:30859524-30859546 AAACCACTGGCCCTACCAACGGG - Intronic
1182740005 22:32560854-32560876 AAGCCACTGTCCCTTCTCATGGG - Intronic
1183830576 22:40416564-40416586 ACACAGCTGCCCCTGCTCACAGG + Intronic
951668212 3:25150420-25150442 AAACAACTGGCCTTTTTCACTGG - Intergenic
955402282 3:58600925-58600947 AAAACGCTGGCTCTTTCCACAGG - Intronic
960779821 3:121307319-121307341 CAACATCTGGGCCTTCTCACAGG - Intronic
964019755 3:151995285-151995307 GAACAGCTGGAACTTCTCACTGG + Intergenic
966748298 3:183299078-183299100 AAACCGCTGCTCCTGCTGACTGG + Intronic
973869505 4:55151125-55151147 ATACCGTTGGCCCTTTGCACAGG + Intergenic
975523402 4:75324119-75324141 AAACTGTTGGCCCTTTTCTCAGG - Intergenic
980156871 4:129117994-129118016 ACACCCCTGGGCCTTCCCACTGG + Intergenic
981045233 4:140258514-140258536 AAAGCACTTGCCCTTCTCTCTGG + Intronic
989100934 5:37822292-37822314 AAACCCCTGAGCCTTCTCTCTGG - Intronic
990652722 5:57920756-57920778 ATGCCTCTGGCCCTTCACACTGG + Intergenic
999053239 5:148546562-148546584 AAACCTCTAGACCTTCTCTCAGG + Intronic
1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG + Intronic
1007720406 6:43881861-43881883 AGAAAGCTGGCTCTTCTCACTGG - Intergenic
1008015194 6:46510786-46510808 AAACCCCTGGATCTTTTCACAGG - Intergenic
1013836311 6:114340876-114340898 AAACAGCTGGTGCTTCTCAAAGG - Intronic
1014345253 6:120262366-120262388 ATGGCGCTGGCCCTTCTCTCAGG - Intergenic
1016005227 6:139082582-139082604 AAGGCTCTGGCCCTGCTCACAGG + Intergenic
1021569404 7:22049268-22049290 ATACAGCTGCCCCCTCTCACAGG + Intergenic
1023684124 7:42717603-42717625 AACCCACTTGCCCTTCTAACAGG + Intergenic
1024477562 7:49829705-49829727 ACACAGCTTGCCCTCCTCACTGG - Intronic
1024908579 7:54419210-54419232 AAACGTCTGTACCTTCTCACAGG - Intergenic
1029151884 7:98486006-98486028 AACCCTCTGGCCATTCTCCCAGG - Intergenic
1029311722 7:99673349-99673371 AAACCTCTAGCCCCTCTGACAGG + Intronic
1029316590 7:99721072-99721094 AAACCTCTAGCCCCTCTGACAGG + Intronic
1029474634 7:100775841-100775863 AAACATCTGGCTCTTCTCGCTGG + Intronic
1030096742 7:105907342-105907364 AAGCCGGTGGCACTTATCACTGG - Intronic
1034133809 7:148746227-148746249 AAACCCCTAGCCCTGCTCTCTGG + Intronic
1035193418 7:157193005-157193027 AAACAGCCAGCCCTTCTTACTGG - Intronic
1047739204 8:127793856-127793878 AGACCGCTGGCCCTCTGCACGGG + Intergenic
1051882398 9:21852740-21852762 AAACCACTGTCCCTTCCCAAGGG - Intronic
1058833136 9:108837330-108837352 AAACCTCTGGCCTTTGTCCCTGG + Intergenic
1060732856 9:126049156-126049178 AAGCCGCTGACCCTGCTCCCTGG + Intergenic
1061766320 9:132883802-132883824 ATACCCATGGCCCCTCTCACTGG - Intronic
1187627592 X:21133264-21133286 AAAAAGCTGGCCATTCTCACCGG - Intergenic
1196052702 X:111322271-111322293 TAAACTCTGCCCCTTCTCACTGG + Intronic
1198619722 X:138492612-138492634 AAACAGCTGGCTCTACCCACTGG + Intergenic
1200080188 X:153572420-153572442 CAACCACCGGCCCTTCTCTCTGG - Intronic