ID: 1179225060

View in Genome Browser
Species Human (GRCh38)
Location 21:39445752-39445774
Sequence ACGCGCCGGCGCTGCGGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 61}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225060_1179225064 -1 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225064 21:39445774-39445796 TCCCCATGGAAACCCGCGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 39
1179225060_1179225076 26 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225060_1179225068 1 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225068 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 28
1179225060_1179225070 9 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225070 21:39445784-39445806 AACCCGCGCGCGGGGCCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 72
1179225060_1179225074 19 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225060_1179225078 27 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225060_1179225066 0 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225066 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 44
1179225060_1179225080 29 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225060_1179225071 10 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225071 21:39445785-39445807 ACCCGCGCGCGGGGCCTCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 133
1179225060_1179225079 28 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225060 Original CRISPR ACGCGCCGGCGCTGCGGCGT TGG (reversed) Intronic
900522397 1:3111964-3111986 ATGGGCCGGCGCGGCGGCGAGGG + Intronic
907883981 1:58576658-58576680 AGGCGCCGGCGGTGGGGCGGTGG + Exonic
909957918 1:81801684-81801706 TCGCGCCGACCCTGCGGCCTGGG - Intronic
918283009 1:183023736-183023758 CCGCGCCGGCCCTGCGGCCCCGG + Exonic
921472576 1:215567241-215567263 ACGCGCCAGCCCCGCGGCGTTGG + Intergenic
922943705 1:229492147-229492169 ACGCCCCGGCACTGCAGCCTGGG - Intronic
923506250 1:234609037-234609059 ACGGGCGGCGGCTGCGGCGTCGG + Exonic
1077322315 11:1947806-1947828 CCGCGCCCGCGCTGCGGTGGGGG - Intronic
1077327088 11:1968580-1968602 AGGCGCCGGAGCAGCGGCCTGGG + Intronic
1077489814 11:2855612-2855634 ACTGGCTGGCCCTGCGGCGTGGG + Intergenic
1090385505 11:126355753-126355775 TCGCGCCAGCGCTGCGCCGCCGG + Intronic
1090788522 11:130070170-130070192 GCGGGCCGGCGGTGCGGCGCCGG + Intronic
1202805333 11_KI270721v1_random:3119-3141 CCGCGCCCGCGCTGCGGTGGGGG - Intergenic
1202810070 11_KI270721v1_random:23760-23782 AGGCGCCGGAGCAGCGGCCTGGG + Intergenic
1094828804 12:34290498-34290520 CCGCGCAGGCGCTGCTGAGTAGG + Intergenic
1095261755 12:40105995-40106017 GCGCTCCGACGCTGCGGAGTTGG + Intronic
1104602127 12:130161588-130161610 AGGCCCCGGCTCTGCGGCTTCGG + Intergenic
1105943645 13:25171591-25171613 ACGAGCCGGAGCCGCGGCGGCGG - Exonic
1106512062 13:30421179-30421201 ACGCGCCCTCGCTGAGGCGCGGG + Intergenic
1107624839 13:42272039-42272061 GCGGGCCGGAGCTGCGGCGGCGG + Intergenic
1121803840 14:96797425-96797447 ACGCGACGGGTCTGCGGCTTAGG + Exonic
1122779166 14:104136402-104136424 ACGCGCGGGCGGGGCGGCGGTGG + Intergenic
1123036807 14:105474964-105474986 ACGCCGCGGCTCTGCGGCGCGGG - Intronic
1129428227 15:75480582-75480604 GCGCGGCTGCGCTGCGGCCTGGG + Intronic
1129852279 15:78800298-78800320 ACGCGGCGGCGCGGCGGCCTGGG - Exonic
1132055539 15:98648452-98648474 GCGCGCCGCTGCTGCGGCGGTGG + Intergenic
1146062213 17:29613364-29613386 GCAGGCTGGCGCTGCGGCGTGGG - Exonic
1147971142 17:44219578-44219600 AGGCGGCGGCGCTGGGGCGGCGG + Intronic
1152093342 17:78258667-78258689 AGGCGCAGGCGCTGGGGTGTGGG + Intergenic
1152625615 17:81386805-81386827 ACGCGGCGGCGCGGCGGGTTCGG + Intergenic
1155032721 18:21998305-21998327 ACCCGCCGGCTCTGGGGCCTTGG + Intergenic
1163799436 19:19355800-19355822 ACGCGCAGGCCCTGCGGAGCTGG - Exonic
1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG + Exonic
1168718934 19:58544397-58544419 ATGCGCGTGCGCGGCGGCGTCGG + Intronic
924962368 2:46287-46309 GCGCGCCGGCCGCGCGGCGTCGG + Exonic
928086192 2:28347855-28347877 ACGCCCCGGGGCTGGGGCCTGGG - Intergenic
929805842 2:45144422-45144444 ACGCGCCGGCGCTGAGGGGTTGG + Intergenic
940918884 2:159286542-159286564 ACGGGCCGGCTCAGCGGCGGTGG - Exonic
948473660 2:238203194-238203216 AGGCGCCGGCGCGACCGCGTGGG - Intronic
1169437991 20:5610746-5610768 ACGCGGCGGGCCTGGGGCGTCGG - Intronic
1173939062 20:46894752-46894774 ACGCGCCCACGCAGCGGCGCGGG + Exonic
1176163125 20:63658631-63658653 TGGCGCTGGCGCCGCGGCGTTGG + Intronic
1179225060 21:39445752-39445774 ACGCGCCGGCGCTGCGGCGTTGG - Intronic
1180737015 22:18024621-18024643 AGGCCGCGGAGCTGCGGCGTGGG + Intergenic
1182325208 22:29507402-29507424 ACGCTCCTGCGCTCCGGCTTGGG - Exonic
1184698015 22:46150530-46150552 ACGCGGCGGCCCCGCGGCGGGGG + Intronic
956229594 3:66998573-66998595 ACCCGCCGGCGCTGCGCCCCAGG + Intronic
961858250 3:129893668-129893690 CCGCGCCGGGGCTGAGGCGGCGG - Intergenic
967685274 3:192409901-192409923 AGGCGGCGGCGCGGCGGCGGGGG - Intronic
982616151 4:157637978-157638000 GCGCGGCTGCGCTGCGGCGCGGG - Intergenic
997654230 5:135543820-135543842 ACGCGTGGGCACTGCCGCGTGGG + Intergenic
999153470 5:149442009-149442031 ACATGCCGGGGCTGCGGCTTTGG + Intergenic
1015773538 6:136792276-136792298 AGGCGGCGGCGCGGCGGCGAGGG - Exonic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1017311761 6:152983622-152983644 AGGCGCCTGCGCAGAGGCGTGGG - Intergenic
1018757435 6:166862477-166862499 AGGGGACGGCGCTGCGGCTTCGG + Exonic
1023637587 7:42228070-42228092 CCGCGCCGCCGCCGCGGCCTGGG - Intronic
1028160094 7:87475668-87475690 ACGCGCGGGCGCTGCAGCAGAGG + Exonic
1029148083 7:98460731-98460753 ACGCGCCTGCACTCCAGCGTGGG + Intergenic
1033477165 7:141702115-141702137 ACGCGGCGCCGCTGCTGCGCTGG - Exonic
1036910712 8:12755187-12755209 TCGCGGCGGCGCTGCGCCGCGGG - Exonic
1037788891 8:21919663-21919685 GCGCGCAGGCGCAGCGGCGACGG + Exonic
1049694458 8:143976644-143976666 GCGTGCGGGCGCTGCGGGGTGGG - Intronic
1062507668 9:136886458-136886480 ACGCGGCGGAGCGGCGGCGGCGG + Intronic
1200128765 X:153830212-153830234 GGCCGCCGGCGCTGCGGCGGGGG - Intronic