ID: 1179225061

View in Genome Browser
Species Human (GRCh38)
Location 21:39445758-39445780
Sequence ATGGGGACGCGCCGGCGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225061_1179225078 21 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225061_1179225080 23 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225061_1179225070 3 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225070 21:39445784-39445806 AACCCGCGCGCGGGGCCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 72
1179225061_1179225081 27 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225061_1179225079 22 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225061_1179225076 20 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225061_1179225066 -6 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225066 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 44
1179225061_1179225071 4 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225071 21:39445785-39445807 ACCCGCGCGCGGGGCCTCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 133
1179225061_1179225064 -7 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225064 21:39445774-39445796 TCCCCATGGAAACCCGCGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 39
1179225061_1179225082 28 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225061_1179225068 -5 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225068 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 28
1179225061_1179225074 13 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225061 Original CRISPR ATGGGGACGCGCCGGCGCTG CGG (reversed) Intronic
900226732 1:1536515-1536537 ATGGAGGCGCGCAGGCACTGAGG - Intronic
900637013 1:3671017-3671039 ATGGGGGTGCGCGGGCCCTGAGG + Intronic
900671274 1:3856695-3856717 ACGGGGCCGCGCCGGCTCTTCGG + Intronic
903068684 1:20715840-20715862 ATGGGGAAGAGCCTGAGCTGTGG + Intronic
903627942 1:24745013-24745035 CGGAGGACGCGCAGGCGCTGCGG + Intergenic
904944549 1:34189732-34189754 ATGGGGACTTGCAGGAGCTGTGG - Intronic
905108285 1:35576935-35576957 CTGGGGTCCCGCTGGCGCTGGGG - Intronic
905108291 1:35576952-35576974 CTGGGGTCCCGCTGGCGCTGGGG - Intronic
905108297 1:35576969-35576991 CTGGGGTCCCGCTGGCGCTGGGG - Intronic
905108303 1:35576986-35577008 CTGGGGTCCCGCTGGCGCTGGGG - Intronic
905108309 1:35577003-35577025 CTGGGGTCCCGCTGGCGCTGGGG - Intronic
905108315 1:35577020-35577042 CTGGGGTCCCGCTGGCGCTGGGG - Intronic
905584449 1:39105724-39105746 CCGGGGACTGGCCGGCGCTGAGG + Intronic
909622446 1:77683293-77683315 TTGGGGAGGCGCCGCCGCCGTGG + Intronic
915902079 1:159854667-159854689 CTGGGGACACGTCGGGGCTGGGG - Exonic
918283007 1:183023730-183023752 ATCGGGCCGCGCCGGCCCTGCGG + Exonic
1067587571 10:47485008-47485030 ATGGGGCAGCTCCGGGGCTGGGG - Intergenic
1067634626 10:47992774-47992796 ATGGGGCGGCTCCGGGGCTGGGG - Intergenic
1068690278 10:59906759-59906781 CTGGGAACGCGCAGGCACTGCGG + Intergenic
1069868062 10:71516294-71516316 ATGGGGAAGGGCTGGAGCTGGGG + Intronic
1073099158 10:100998040-100998062 AAGGGGACCCGCAGGCGCTCAGG - Intronic
1073108495 10:101047130-101047152 CTGGGGACCCGCGGGCTCTGCGG - Intergenic
1075337746 10:121620741-121620763 GTGGAGACGCGCGGGGGCTGTGG - Intergenic
1076584027 10:131533155-131533177 ATGGGGAAGCGCCTGTGCAGAGG - Intergenic
1078371570 11:10751017-10751039 TCGGGGCCGCGCCAGCGCTGAGG + Exonic
1081938161 11:46918644-46918666 AAGGGGCCGGGCCGGCGCTGGGG - Intergenic
1083658343 11:64241068-64241090 ACGAGGACGCGCCTGCGCAGAGG + Intronic
1083717254 11:64584601-64584623 ATGGGGAAGCGTGGGTGCTGGGG - Intergenic
1084319460 11:68365379-68365401 ATGTGGACGGGCCAGCGATGAGG + Intronic
1085784446 11:79438423-79438445 ATGGGGACGGGATGGGGCTGGGG - Intronic
1087117486 11:94541358-94541380 ATGGGGACACGGGGGGGCTGCGG - Intergenic
1089842124 11:121427390-121427412 CTGGGGAGGCGCCGGCGCGGCGG - Intergenic
1103962457 12:124617604-124617626 ATGGGGGCACGCCGGGGTTGGGG - Intergenic
1104970394 12:132528241-132528263 AGGGGGACGGGCTGGCCCTGTGG + Intronic
1105943647 13:25171597-25171619 ATGGAGACGAGCCGGAGCCGCGG - Exonic
1112494874 13:99896445-99896467 CTGGGGTCCCGCCGGCCCTGGGG + Exonic
1113764203 13:112870755-112870777 TTTGGGACGCTCCTGCGCTGTGG - Intronic
1117910849 14:60637429-60637451 AGGGGGCCTCGCCGGCACTGGGG - Intergenic
1123491123 15:20783556-20783578 GTGAGGACTCGCCTGCGCTGGGG - Intergenic
1123547625 15:21352647-21352669 GTGAGGACTCGCCTGCGCTGGGG - Intergenic
1125677858 15:41512073-41512095 ATGGGGCGGCGCCGGCGCCGGGG - Intronic
1126592504 15:50354612-50354634 ATGGGGTCGCGCCGAGGCAGCGG - Intronic
1128987450 15:72231445-72231467 ATGGGGACGCGGCGGGGCAACGG + Intronic
1131094951 15:89649001-89649023 ATGTGGCTGCCCCGGCGCTGAGG + Exonic
1202955955 15_KI270727v1_random:79877-79899 GTGAGGACTCGCCTGCGCTGGGG - Intergenic
1132854330 16:2038108-2038130 ATGGGGGCTCACCGGGGCTGGGG - Exonic
1136462041 16:30417580-30417602 GTGGGGACGCGCCGGGTCGGCGG - Exonic
1143150729 17:4806758-4806780 CGGGGGACGCGCCTCCGCTGCGG - Intergenic
1145783208 17:27577549-27577571 AAGGAGACGCTGCGGCGCTGTGG + Exonic
1147192754 17:38747413-38747435 CTGGGGAAGCCCGGGCGCTGGGG - Intronic
1148443008 17:47721390-47721412 CTGGGGACGCCCGGGCGATGGGG + Intergenic
1151951135 17:77354724-77354746 ATGGCTTCGCGCCTGCGCTGGGG - Intronic
1152654409 17:81513167-81513189 GCGGGGCCGCGCCGGAGCTGGGG + Intronic
1157867266 18:51197432-51197454 CTGGGGAGGCGGCGGGGCTGGGG + Intronic
1160655580 19:267107-267129 CTGGGGACCGGCCGGCGCTGCGG - Intergenic
1160688218 19:447276-447298 AAGGGGACGCGTGGGCGCCGGGG + Intronic
1161047544 19:2144135-2144157 AAGGGGACGCGCCGGCGAAGTGG + Intronic
1161250176 19:3276071-3276093 ATGGGGAGGAGCTGGCTCTGGGG + Intronic
1161495660 19:4584501-4584523 ATGGGGGCGCGCAGGCATTGGGG - Intergenic
1162013183 19:7830278-7830300 AGGGGGCCGGGCCGGGGCTGCGG + Intronic
1163675288 19:18652753-18652775 ATGGGGACGCCCCAACACTGTGG - Intronic
1165496098 19:36152518-36152540 CTGGGGACGCGGCGGGGCTGGGG + Exonic
1166785167 19:45363222-45363244 ATGGGGACGCCCCTGCCCTCAGG + Intronic
928186508 2:29115611-29115633 CTGGGGACGCGGGGGCGCGGAGG - Exonic
929805839 2:45144416-45144438 TAGAGGACGCGCCGGCGCTGAGG + Intergenic
938406324 2:131035104-131035126 GCGGGGCCGCGCCGGGGCTGCGG - Intronic
946191868 2:218011709-218011731 ATGGGGACGGGCAGGGCCTGAGG - Intergenic
1169044933 20:2527620-2527642 AGGGGGACTCGCCGGCTCAGTGG + Intergenic
1170934376 20:20796951-20796973 GTGGGCGTGCGCCGGCGCTGGGG + Intergenic
1171959552 20:31484157-31484179 AGAGGGCCGCGCCTGCGCTGTGG + Exonic
1173166250 20:40689003-40689025 CTGGGGACGCGGCGGCGCGCCGG + Exonic
1175262068 20:57681079-57681101 ATGGGGACTCCCAGGCCCTGGGG - Intronic
1176885376 21:14248997-14249019 AGGGGGACGGGCTGGAGCTGTGG + Intergenic
1179225061 21:39445758-39445780 ATGGGGACGCGCCGGCGCTGCGG - Intronic
1181026293 22:20129639-20129661 ATGGGGTCCTGCCGGTGCTGGGG + Intronic
1181910622 22:26235516-26235538 ATGGGGAAGCACCGAGGCTGTGG + Intronic
1185204912 22:49532310-49532332 ATGGGGACGCGCCTGGGTGGGGG - Intronic
1185204923 22:49532347-49532369 ATGGGGACGCGCCTGGGTGGGGG - Intronic
950116555 3:10454219-10454241 ATGGGGACCCCCAGGTGCTGTGG + Intronic
958470203 3:94507639-94507661 ATGGGCATTCTCCGGCGCTGCGG - Intergenic
960576979 3:119240097-119240119 ATGGGGACGTGGCGGTGGTGAGG - Intronic
963730845 3:148970574-148970596 ATGGTGAAGCGCAGGCTCTGGGG - Intergenic
967685278 3:192409907-192409929 CTGGGGAGGCGGCGGCGCGGCGG - Intronic
978282854 4:107037309-107037331 ACTGGGACGCGCTGGCGCTTGGG + Intronic
978741814 4:112145636-112145658 ACGGGGACGCGCTGGCGGAGCGG + Exonic
988993079 5:36690257-36690279 AAGGGGAAGCGCGGCCGCTGCGG - Intergenic
989633946 5:43514885-43514907 GTGGGCAGGCGCCGACGCTGCGG - Exonic
998156539 5:139789987-139790009 ACGGGGCCGGGCGGGCGCTGAGG + Intergenic
998287426 5:140876758-140876780 ATGGGGGCTCGCCTTCGCTGTGG + Exonic
1002121122 5:177005939-177005961 CTGGAAACGCGCCGGCCCTGCGG + Intronic
1002607356 5:180391054-180391076 ATGGGGTGGGGCCGGCTCTGTGG - Intergenic
1004312567 6:14558523-14558545 ATGGGGACCGGCAAGCGCTGCGG - Intergenic
1008160349 6:48068722-48068744 GTGGGGAGGCGGCGGCGGTGGGG - Intergenic
1017201628 6:151760689-151760711 ATGGGGAAGAGCAGGTGCTGGGG - Intronic
1019112031 6:169724301-169724323 AGGGAGTCGCGGCGGCGCTGAGG - Intronic
1019562759 7:1666425-1666447 ATGGGGACGCCCGGGAGCCGCGG - Intergenic
1019597305 7:1864104-1864126 ATGGGGACGGGGCGGCCCTGCGG + Intronic
1036723582 8:11200537-11200559 GTGGGGGCGGGCCGGCCCTGAGG - Intronic
1037807497 8:22066727-22066749 ATGAGGACGCGCCAGCCCGGGGG + Exonic
1038531016 8:28317882-28317904 ATGGGGAAGCGCCAGATCTGGGG + Intronic
1040512171 8:48105393-48105415 AAGGGGCCGCGGCGGCCCTGTGG - Intergenic
1049163962 8:141115483-141115505 ACGGGGAGGCACCGGGGCTGTGG + Intergenic
1049625485 8:143617831-143617853 AAGGAGCCTCGCCGGCGCTGGGG + Intronic
1053365785 9:37521607-37521629 ATGGTGATGGGCCGGCGCAGTGG + Exonic
1056138016 9:83648182-83648204 GTGGGGAGGCGCCTGTGCTGGGG - Intergenic
1057869880 9:98709242-98709264 AGGGGGAGGCGCTGGCGCTGCGG + Intergenic
1058087076 9:100759445-100759467 ATGGGTACTCCCCGGTGCTGTGG + Intergenic
1061431375 9:130533405-130533427 ATGGGGAAGAGCCAGCACTGGGG + Intergenic
1061942248 9:133890074-133890096 ATGGTGACTCGCAGGGGCTGAGG + Intronic
1062119797 9:134828081-134828103 CTGGGGACAGGCCGGCCCTGGGG + Intronic
1185894049 X:3843124-3843146 CGGGGGACTCGCCGGGGCTGGGG + Intronic
1185899167 X:3881548-3881570 CGGGGGACTCGCCGGGGCTGGGG + Intergenic
1185904284 X:3919977-3919999 CGGGGGACTCGCCGGGGCTGGGG + Intergenic
1189968654 X:46396395-46396417 ATGGGGTCGCGGCGGGGCAGAGG + Intergenic
1194765612 X:97843654-97843676 CTGTGGACGCTCCGACGCTGGGG - Intergenic
1195702681 X:107716656-107716678 CTCGGGAGGCGCCGGAGCTGGGG + Intronic