ID: 1179225063

View in Genome Browser
Species Human (GRCh38)
Location 21:39445766-39445788
Sequence GGGTTTCCATGGGGACGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225063_1179225082 20 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225063_1179225071 -4 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225071 21:39445785-39445807 ACCCGCGCGCGGGGCCTCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 133
1179225063_1179225074 5 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225063_1179225076 12 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225063_1179225080 15 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225063_1179225070 -5 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225070 21:39445784-39445806 AACCCGCGCGCGGGGCCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 72
1179225063_1179225079 14 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225063_1179225078 13 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225063_1179225081 19 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225063 Original CRISPR GGGTTTCCATGGGGACGCGC CGG (reversed) Intronic
905174612 1:36127631-36127653 GAGTGTGCATGGGGACGGGCTGG + Intergenic
905341026 1:37277566-37277588 GGGTCTCCATGTGGAGGGGCAGG + Intergenic
907905993 1:58784160-58784182 GAGTCTCCATGGTGACGGGCGGG - Exonic
921989485 1:221349103-221349125 GGGTGTCCATATGGAAGCGCAGG + Intergenic
922212656 1:223497627-223497649 GGGCTTCCATGGGGGTGTGCTGG + Intergenic
922531406 1:226348089-226348111 GGGATTCCATGGGCAGGCTCTGG - Intergenic
1067942848 10:50670548-50670570 AGGTTTCCATGGGGACAGGTTGG + Intergenic
1070439957 10:76433445-76433467 TGGTTTCCATGGGGAGGACCTGG + Intronic
1071344850 10:84683340-84683362 GGGTTTCCATGGGGAAGGCAAGG - Intergenic
1071630989 10:87217738-87217760 AGGTTTCCATGGGGACAGGTTGG + Intergenic
1074359550 10:112814205-112814227 GGTCTTCCATGGGGAGGAGCTGG - Intronic
1077271148 11:1682122-1682144 GTGTTTCCCTGGGGCCACGCGGG - Intergenic
1081661153 11:44889258-44889280 GGGTTTACATGGGGACCAGGAGG - Intronic
1084192219 11:67504437-67504459 CGGTTGCCATGGCGACGGGCGGG - Intronic
1084692430 11:70734961-70734983 GGGTTGCCCTGGAGACGAGCGGG + Intronic
1085295881 11:75431406-75431428 GGGGTGCCATGGGGAGGCACCGG + Intergenic
1087755141 11:102047420-102047442 CCGTTTCCATGGAGACGCGGCGG - Intergenic
1092052738 12:5484044-5484066 GGGTTTCCTGGGGGAGGCACAGG - Intronic
1101641332 12:106587301-106587323 CAGTCTCCATGGTGACGCGCTGG - Intronic
1105836286 13:24215051-24215073 GCGTCTCCCTGAGGACGCGCTGG + Intronic
1105943649 13:25171605-25171627 CGGTTTCCATGGAGACGAGCCGG - Exonic
1107024713 13:35788162-35788184 GTGTTTCCATGGCAACGTGCTGG - Intronic
1107468072 13:40666766-40666788 GGTTTTCCACGGGGAGGCGGCGG + Intergenic
1109677384 13:65695524-65695546 GAGTGTGCATGGGGACGCGGAGG + Intergenic
1112234735 13:97625144-97625166 GGGTTTCCTTGGGGTGGAGCAGG + Intergenic
1112692724 13:101916032-101916054 GGGTTTCCATGGGGTGGGCCTGG - Intronic
1113149276 13:107243484-107243506 GGGTTTGGATGGGGACAGGCAGG - Intronic
1129269262 15:74410914-74410936 GGGATTCCATGGGGCAGCTCAGG + Exonic
1131265089 15:90910975-90910997 GGGTCTGCATGGGGACCCTCTGG + Intronic
1132354216 15:101159344-101159366 GGGTGTCCATGGGGAGCCACTGG - Intergenic
1132604044 16:786231-786253 CGGTGTCCGTGGGGATGCGCAGG + Exonic
1132605697 16:792884-792906 AGGGTTCCATGGGGAGGGGCAGG - Intronic
1147179387 17:38674745-38674767 GGGTTGCGAAGGGGACGCGGCGG - Exonic
1151509958 17:74552167-74552189 GGGTTTCCATGGAGACAGGAAGG + Intergenic
1151537840 17:74748792-74748814 GGGTTCCGATGGGGACGGGACGG - Exonic
1156448555 18:37253966-37253988 GGGTTTCCACGGGGCCGCCCGGG + Intronic
1161798740 19:6403387-6403409 CTGTTGCCATGGGGACGTGCAGG - Intergenic
1162815163 19:13189715-13189737 GGATTTCCATTGGGAGGCTCTGG + Intergenic
1165109940 19:33496487-33496509 GGGTCTCCATGGGGAAGGGCGGG - Intronic
1165172786 19:33905911-33905933 GGGTGTCCCTGGGGACCCACCGG + Intergenic
1166347855 19:42177366-42177388 GGGTTGCCATGGGGACAAGGTGG - Intronic
1166361700 19:42255206-42255228 GTGTCTCCATGGCGACGCGGCGG - Intergenic
1167600840 19:50453967-50453989 GGGTTTGCTTGGGGACACGATGG + Intronic
1168724531 19:58573446-58573468 GAGTTGCCATGGAGACGCGGTGG - Exonic
926154914 2:10448363-10448385 GCGTCTCCATGGCGACCCGCCGG - Exonic
948598736 2:239096488-239096510 GGGTGTCCATGGGGGCGGGGCGG - Intronic
1171783550 20:29442964-29442986 GGGGTTTCAAGGGGATGCGCTGG - Intergenic
1172095338 20:32457532-32457554 CGGTCGCCATGGGGACGCTCTGG - Intronic
1174676910 20:52366893-52366915 GGGTTTCCAGGGGCTCTCGCTGG + Intergenic
1178253093 21:31023390-31023412 TGGTTTCCATGGGAAAGAGCGGG - Intergenic
1179225063 21:39445766-39445788 GGGTTTCCATGGGGACGCGCCGG - Intronic
1181052704 22:20245357-20245379 GGGTTGCCATGGAGACCAGCGGG - Intronic
1182620949 22:31618248-31618270 AGGTGTCCCTGGGGACGCCCCGG + Intronic
1184477682 22:44730214-44730236 AGGTTTCCATGGGAATGCGGAGG - Intronic
949205178 3:1429575-1429597 TGGTTTCCATGGTGACTCCCTGG + Intergenic
952788052 3:37175919-37175941 GGGCTTCCCTGGGGACTGGCCGG - Intronic
954656766 3:52198598-52198620 GGGCCTCACTGGGGACGCGCAGG - Intronic
967163994 3:186764259-186764281 GTGTTTCAATGGGGACAGGCAGG + Intergenic
969154839 4:5201346-5201368 AGGTTTCCATGGGGCCGGACAGG + Intronic
984635336 4:182104250-182104272 TGGTTTCCACGGGGACACACTGG - Intergenic
998281003 5:140807532-140807554 GGTTTTCCATGTGGACGTGGAGG + Exonic
998282778 5:140828436-140828458 GGTTTTCCATGTGGACGTGGAGG + Exonic
998283372 5:140834728-140834750 GGTTTTCCATGTGGACGTGGAGG + Exonic
998284083 5:140841666-140841688 GGTTTTCCATGTGGACGTGGAGG + Exonic
998284738 5:140848840-140848862 GGTTTTCCATGTGGACGTGGAGG + Exonic
998287321 5:140875817-140875839 GGTTTTCCATGTGGACGTGGAGG + Exonic
1003432906 6:6056470-6056492 GGGTTTCCCAGGGGAGGCTCAGG - Intergenic
1006431872 6:34002143-34002165 CGGTCTCCATGGCGACGCGAGGG + Intergenic
1007783689 6:44268491-44268513 TGGTTTCCATGGTGACCAGCCGG + Intergenic
1010616990 6:78025111-78025133 GGGTTTGAACTGGGACGCGCAGG + Intergenic
1015652192 6:135475873-135475895 GGGTTTCCATGGCCACCCCCGGG - Intronic
1017201631 6:151760697-151760719 GGGTTGCGATGGGGAAGAGCAGG - Intronic
1017809435 6:157974372-157974394 GAGTTTGCATGGGGAGGAGCAGG - Intergenic
1018511787 6:164532316-164532338 GTGTTTCCATGGGCACATGCAGG + Intergenic
1018705775 6:166462241-166462263 GGGGTTCCATGGGGAGGGGAAGG - Intronic
1019488132 7:1298875-1298897 GGGTCTCCTTGGGGACCTGCAGG - Intergenic
1019567879 7:1693722-1693744 GGGTTGCCATGGGGACGAGCGGG - Exonic
1022535435 7:31095679-31095701 GGGCTTTCTTGGGGACTCGCGGG - Intronic
1024748623 7:52436460-52436482 GGGTTTCCAAGGTGACGCCTTGG + Intergenic
1032919259 7:136527412-136527434 GGGTAGCCATGGGTACGCCCAGG + Intergenic
1033131608 7:138750184-138750206 CAGTTTCCATGGGGAAGCGTGGG - Intronic
1033719773 7:144046866-144046888 TGGTATCCATGGGGACAGGCTGG - Intergenic
1034985234 7:155509158-155509180 GCGTTTCCATGTGGACTCGCCGG - Intronic
1049379591 8:142305369-142305391 GGGGTTCCGTGTGGACGCCCAGG + Intronic
1049412283 8:142478637-142478659 GGGTGTCCATGGGGAAGTGGAGG + Intronic
1053425641 9:38008277-38008299 GGGTTTCCATGGCGACCAGCGGG - Intronic
1056431625 9:86533972-86533994 TGCTTTCCATGGGGACGGGCAGG - Intergenic
1056851764 9:90090921-90090943 GGGTTTCCATGGGGCTGCAGTGG - Intergenic
1060931559 9:127492383-127492405 GGGTTTCCAAGAGCAGGCGCAGG + Intronic
1061208027 9:129175463-129175485 GGGTTTACATGGGGGTGGGCGGG + Intergenic
1061894163 9:133638472-133638494 GGGTTTCCATGGGAAAGGCCAGG + Intronic
1061894639 9:133640870-133640892 GGGTTTCCATGGGAAAGGCCAGG + Intronic
1185557413 X:1032194-1032216 GGTTTTCCAGGAGGAAGCGCAGG + Intergenic
1192533886 X:71911644-71911666 GGTTTTGGCTGGGGACGCGCTGG + Intergenic
1192799367 X:74451033-74451055 GGGTTTCCATGGGGATCTGTGGG + Intronic