ID: 1179225065

View in Genome Browser
Species Human (GRCh38)
Location 21:39445775-39445797
Sequence CCCGCGCGCGGGTTTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 25}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225065_1179225085 30 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225065_1179225080 6 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225065_1179225078 4 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225065_1179225079 5 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225065_1179225076 3 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225065_1179225082 11 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225065_1179225081 10 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225065_1179225074 -4 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225065 Original CRISPR CCCGCGCGCGGGTTTCCATG GGG (reversed) Intronic