ID: 1179225065

View in Genome Browser
Species Human (GRCh38)
Location 21:39445775-39445797
Sequence CCCGCGCGCGGGTTTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 25}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225065_1179225078 4 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225065_1179225076 3 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225065_1179225082 11 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225065_1179225081 10 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225065_1179225085 30 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225065_1179225080 6 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225065_1179225074 -4 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225065_1179225079 5 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225065 Original CRISPR CCCGCGCGCGGGTTTCCATG GGG (reversed) Intronic
900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG + Intronic
906068285 1:42998342-42998364 CCCGCGCCTGGCCTTCCATGTGG + Intergenic
910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG + Intergenic
923630947 1:235649429-235649451 CCCGCGCGCGGGCTTCCCCGGGG + Intronic
924896960 1:248349438-248349460 ACCGTGCTCGGGTTTCCAAGAGG + Exonic
1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG + Intergenic
1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG + Intronic
1096585683 12:52618206-52618228 CCCGCCCGGGGGTATCCATCAGG - Exonic
1119379493 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG + Intergenic
1129719732 15:77871546-77871568 CACGGGCGCTGGTTTGCATGTGG - Intergenic
1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG + Intronic
1141156560 16:81601300-81601322 CCTGCCTGCTGGTTTCCATGGGG - Intronic
1166852748 19:45768331-45768353 CCTGCGCGCGCGCTACCATGAGG - Exonic
936518903 2:113199392-113199414 CGTGCACGCGGGTGTCCATGTGG - Intronic
937046101 2:118852840-118852862 GCCGCTCGCGGGTTTGCAGGCGG + Intergenic
941905641 2:170715003-170715025 CCCAAGCGCGGGTCTCCAGGCGG + Intergenic
948854384 2:240723366-240723388 CCCGCACGGTGGTGTCCATGTGG - Intronic
1175023219 20:55873584-55873606 CCAGCGCCCAGGATTCCATGGGG + Intergenic
1175936248 20:62515462-62515484 CCCACCTGCGGGTTTCCAGGTGG - Intergenic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
960902286 3:122564655-122564677 CCGGCCCCCGGGTTTCCAGGCGG + Intronic
998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG + Intergenic
1002538430 5:179891081-179891103 CCCACGCGTGAGTTTCCATCAGG - Intronic
1019475361 7:1241633-1241655 CCCGCGCGGGGGGTTCCGTCCGG - Intergenic
1036186151 8:6624130-6624152 CCCGCCCGTGGGTTTTCAGGAGG + Intronic
1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG + Exonic
1049557605 8:143290979-143291001 CCCGAGCGTGGGCTTCCTTGGGG - Intronic
1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG + Intergenic
1198177610 X:134172151-134172173 CCCGCGCGCGGTTTCCCGAGCGG - Intergenic