ID: 1179225067

View in Genome Browser
Species Human (GRCh38)
Location 21:39445776-39445798
Sequence CCCCGCGCGCGGGTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225067_1179225074 -5 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225067_1179225085 29 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225067_1179225086 30 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225067_1179225080 5 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225067_1179225082 10 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225067_1179225078 3 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225067_1179225081 9 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225067_1179225076 2 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225067_1179225079 4 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225067 Original CRISPR CCCCGCGCGCGGGTTTCCAT GGG (reversed) Intronic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
913250783 1:116910455-116910477 CCCCGCGCGCGGGGTGCAAGTGG + Intronic
922205740 1:223444439-223444461 CCCCACGCGCGGGCCTCCAGGGG + Intergenic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
1075785598 10:125048144-125048166 GCCCACGTGGGGGTTTCCATTGG - Intronic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1103967069 12:124646704-124646726 CCCCGCGCTCGGGTTTCTGTGGG - Intergenic
1117912398 14:60648396-60648418 ACCCGCGCGTGGGTTTCTCTGGG - Intronic
1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG + Intergenic
1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG + Exonic
1132641850 16:981698-981720 CCCCGCGCCCGGCTACCCATTGG - Intergenic
1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG + Intronic
1162799473 19:13102901-13102923 CCCCGCCCGCTGGTTTCCTCCGG - Intronic
1165952194 19:39480764-39480786 CCCCTCCCCCGCGTTTCCATTGG + Exonic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1168641411 19:58034142-58034164 CACCGCGCGCGGGCTTCGCTCGG - Exonic
926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG + Exonic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1180821743 22:18833596-18833618 CCCCACGCGCCGATTTCCAAGGG - Intergenic
1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG + Intergenic
1181207963 22:21268061-21268083 CCCCACGCGCCGATTTCCAAGGG - Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1203218957 22_KI270731v1_random:27355-27377 CCCCACGCGCCGATTTCCAAGGG + Intergenic
1203271868 22_KI270734v1_random:59472-59494 CCCCACGCGCCGATTTCCAAGGG - Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
1002902081 6:1417612-1417634 CCACGCACGCGCGTTTCCCTTGG + Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1033306888 7:140231466-140231488 CACGGCCCGCGGGCTTCCATTGG - Intergenic
1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG + Intergenic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1198205418 X:134460442-134460464 CCCCGCCTGCGGGGTTCCCTGGG - Intronic