ID: 1179225069

View in Genome Browser
Species Human (GRCh38)
Location 21:39445777-39445799
Sequence GCCCCGCGCGCGGGTTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225069_1179225085 28 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225069_1179225079 3 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225069_1179225086 29 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225069_1179225076 1 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225069_1179225074 -6 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225069_1179225080 4 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225069_1179225082 9 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225069_1179225081 8 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225069_1179225078 2 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225069 Original CRISPR GCCCCGCGCGCGGGTTTCCA TGG (reversed) Intronic
900119237 1:1041518-1041540 GCCGCGTGCGCGGGTTCACACGG - Exonic
902214265 1:14924520-14924542 GCCCCGCGCCGGGGTTCCCCGGG + Intronic
903164214 1:21509534-21509556 GCCCCGCGCCCTGGTTCCCCAGG + Intronic
922205738 1:223444438-223444460 GCCCCACGCGCGGGCCTCCAGGG + Intergenic
923630944 1:235649427-235649449 CACCCGCGCGCGGGCTTCCCCGG + Intronic
1064665239 10:17644126-17644148 GCTCCGCGCGGGGGCTTCCTCGG + Exonic
1072918464 10:99555428-99555450 GACACGCGTGAGGGTTTCCACGG - Intergenic
1081545173 11:44066519-44066541 GCCCCACTTGCGGGATTCCAAGG + Exonic
1083263029 11:61533284-61533306 GCCCCGGGCATGGGTCTCCAGGG - Intronic
1084285568 11:68128510-68128532 GCCCCGCCCGCTGTTTTCCTGGG - Intergenic
1084741605 11:71143433-71143455 GCCCGATGCGCGGGTTCCCACGG + Intronic
1085958988 11:81436727-81436749 CCCCCGCGTCCTGGTTTCCACGG + Intergenic
1093164374 12:15788920-15788942 GCCCTGGGCGCGGGTCTGCACGG + Intronic
1099955746 12:89351609-89351631 GCCCCGCGCGCGGAGTTCCCTGG + Intronic
1103967071 12:124646705-124646727 CCCCCGCGCTCGGGTTTCTGTGG - Intergenic
1121137305 14:91510295-91510317 GCCCCGCGCGCCGCTTTTGAGGG - Intronic
1132577451 16:670574-670596 GCCCCGCACGCTGGTTCCCCAGG + Intronic
1136003587 16:27313920-27313942 GCGCCGCGCGGGGCTTTCCTGGG - Exonic
1138105870 16:54286929-54286951 GCCCCGCGCGCGGGATCCGCGGG - Intergenic
1142656889 17:1400274-1400296 GCCCCCCGCGCCAGTTGCCAGGG - Exonic
1142762334 17:2049989-2050011 GCCCCGCCCCCGCGTCTCCAGGG - Intergenic
1143321147 17:6070226-6070248 GCCCCGCGCGCGTGTTCTCGCGG + Intronic
1149038524 17:52159625-52159647 ACCCAGCGCGCGGCTCTCCAGGG + Intronic
1152357946 17:79815603-79815625 CACCCGCGCACGGGTTTCCAAGG + Intergenic
1157794074 18:50559551-50559573 CCCGCGCGCGCGGGTCTCCCCGG + Intergenic
1167293502 19:48636758-48636780 TCCCCGCACGCAGGTTTCTATGG + Intronic
1167621438 19:50563175-50563197 GCCCCTCTCGTGGGTCTCCAAGG + Intronic
926283054 2:11465956-11465978 CCCCCACGCGCCGATTTCCAAGG + Exonic
931762453 2:65430663-65430685 GCCCCGCGCGCGTCTTTGCAGGG - Intronic
932613124 2:73214314-73214336 GGGCCGCGCGCGGGTCTCCGTGG + Exonic
937993390 2:127675947-127675969 GCCCAGCTCCCAGGTTTCCAGGG + Intronic
948168009 2:235878054-235878076 GCCACACTCTCGGGTTTCCACGG - Intronic
1172894861 20:38293413-38293435 GCCCAGAGGCCGGGTTTCCATGG - Intronic
1175394724 20:58650482-58650504 GCCCCGGGCCGGGTTTTCCACGG - Intergenic
1178922615 21:36748245-36748267 GCCCCGCGCGCCGGTGCCGAGGG + Exonic
1179225069 21:39445777-39445799 GCCCCGCGCGCGGGTTTCCATGG - Intronic
1180821745 22:18833597-18833619 CCCCCACGCGCCGATTTCCAAGG - Intergenic
1181191234 22:21142448-21142470 CCCCCACGCGCCGATTTCCAAGG + Intergenic
1181207965 22:21268062-21268084 CCCCCACGCGCCGATTTCCAAGG - Intergenic
1183675127 22:39294900-39294922 GCCTCTCGCTCTGGTTTCCAAGG - Intergenic
1185388442 22:50547046-50547068 GCCGCGCGCGTGGGCGTCCAGGG - Intergenic
1203218955 22_KI270731v1_random:27354-27376 CCCCCACGCGCCGATTTCCAAGG + Intergenic
1203271870 22_KI270734v1_random:59473-59495 CCCCCACGCGCCGATTTCCAAGG - Intergenic
963602177 3:147388239-147388261 GCTCCCCGCGCGTATTTCCATGG + Exonic
966449064 3:180037088-180037110 GGCACGCGCGCGCGTTCCCAGGG + Intergenic
966711997 3:182980676-182980698 GCCCCGCGCGGGGCTTCCCCCGG + Intronic
969442201 4:7224084-7224106 GCCTGGCGTGCTGGTTTCCAGGG + Intronic
998040084 5:138946216-138946238 GCCCAGAGCCCGGGTTGCCATGG + Intergenic
999374972 5:151080742-151080764 GCCCGGCGCGCGGGGTCCCGGGG - Intronic
1016340925 6:143060826-143060848 CGCCCGCGCCCGGGTTCCCACGG + Intronic
1021415060 7:20374572-20374594 GCCCCGCCCCTGTGTTTCCATGG - Intronic
1028601759 7:92608769-92608791 GCCCCGCGGGCTGCTTTCCGAGG - Exonic
1035125933 7:156607724-156607746 GCCCCGCGCGAGGTTTTTCCAGG - Intergenic
1062264744 9:135681827-135681849 GCCCCTGGCGCCGGTTCCCAAGG - Intergenic
1198310096 X:135421997-135422019 GCCCCGCCCCCGTGTTCCCAAGG - Intergenic
1200277784 X:154750894-154750916 GCCCCGCGGGCGGGTGCCCCGGG + Intronic