ID: 1179225072

View in Genome Browser
Species Human (GRCh38)
Location 21:39445786-39445808
Sequence TCCCAGGAGGCCCCGCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 207}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225072_1179225082 0 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225072_1179225076 -8 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225072_1179225085 19 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225072_1179225087 27 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225087 21:39445836-39445858 CGCATGCGCACTCGGGCAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 55
1179225072_1179225081 -1 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225072_1179225078 -7 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225072_1179225086 20 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225072_1179225080 -5 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225072_1179225079 -6 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225072 Original CRISPR TCCCAGGAGGCCCCGCGCGC GGG (reversed) Intronic
900376738 1:2358270-2358292 TCCCAGGAGCACCCGAGGGCCGG + Intronic
900401884 1:2476087-2476109 TCCCAGGAGGGCCCTCCCGTTGG + Intronic
900608243 1:3533311-3533333 CCCCAGGAGGCCCCGCAGACAGG - Intronic
901065111 1:6490687-6490709 TCCCAGGAAGGGCCCCGCGCCGG + Intronic
902323549 1:15684241-15684263 TCCCCGGAGTCCCCAGGCGCAGG + Intergenic
902832754 1:19028371-19028393 TCCCAGGAGGCTCCACCCTCTGG - Intergenic
904751153 1:32742004-32742026 ACCCGGGCGGCCCCCCGCGCAGG + Exonic
905375142 1:37514825-37514847 TCTCCGGAAGCCGCGCGCGCAGG - Intergenic
906308996 1:44739666-44739688 TCCCAGAAGGCACAGCGCTCGGG + Intergenic
907069354 1:51519476-51519498 TCCAAGGCGGCCCCGGGGGCAGG - Intergenic
907518877 1:55010479-55010501 TCCCAGGTGGCCCAGGGTGCAGG - Exonic
910145691 1:84077957-84077979 TCGCAGGCGGGCGCGCGCGCCGG - Intergenic
912515900 1:110216416-110216438 TCCCTGCAGGCCCTGCCCGCAGG + Intronic
914437198 1:147670516-147670538 TCCCAAGTGGACCCGCGCACAGG + Intergenic
914728821 1:150352376-150352398 TCCAAGGAGGCCGGGCGCGGTGG + Intronic
915912704 1:159924523-159924545 CCCCAGGAGGCACAGGGCGCGGG + Intronic
916119022 1:161511769-161511791 TCCCAGGAGACCCTGAGTGCAGG + Intronic
917934425 1:179850904-179850926 TCCCAGGAGGCCCAGAGTCCTGG - Exonic
919232014 1:194785598-194785620 TCACAGGAGGCCGGGCGCGGTGG - Intergenic
920331568 1:205211773-205211795 TCCCAGGAGACCCCGCGGCGAGG - Intergenic
920528750 1:206686166-206686188 TCCCCGGAGCCGCCCCGCGCGGG - Intronic
921866769 1:220094496-220094518 TCTCTGGAGGCCCCGCGCCGAGG - Intronic
922728554 1:227937994-227938016 TCCCAGGTGGCCCCCAGGGCAGG - Intronic
922809241 1:228406711-228406733 GCCCTGGAGTCCCCGCGCCCCGG - Exonic
923698990 1:236282037-236282059 TCCCACAAGGCCCCGCGCTTGGG - Intergenic
923706428 1:236348238-236348260 TCCCAGAAGGCTTCGCGCTCGGG - Intergenic
924188233 1:241519317-241519339 TCCGAGGAGGCGCCGGGAGCGGG + Intronic
1063099433 10:2936404-2936426 TCCCAGCAGGCCAAGCGGGCAGG + Intergenic
1065102086 10:22340968-22340990 CCCCGGGAGGCCCCGCGGGAGGG + Intergenic
1071579281 10:86755814-86755836 TCACAGGAGCCCGGGCGCGCCGG + Intergenic
1072420944 10:95290475-95290497 TCCCCGCAGATCCCGCGCGCTGG - Intronic
1073088713 10:100913395-100913417 TCCCAGTAGCCCCTGCGCGGAGG - Intronic
1073137355 10:101227373-101227395 GCCCCGAAGGCCCCGGGCGCTGG - Exonic
1074503452 10:114045396-114045418 TCCGAGGCGGCCCCGGGCGATGG - Exonic
1075690105 10:124388807-124388829 TCCCGGGAGGCCCTGCCCACAGG + Intergenic
1075709926 10:124525541-124525563 TCTCAGGAGGCCCAGCGTCCGGG - Intronic
1076166567 10:128286934-128286956 TCGGAGGAGCCCCCGCCCGCCGG + Intergenic
1076417356 10:130301123-130301145 TCCCAGCAGGGCCTGCACGCAGG - Intergenic
1076629068 10:131841876-131841898 CCCCAGGAGGCCCTGCACGGTGG - Intergenic
1077877570 11:6320671-6320693 TCCCAGCAGGCCCCCGGCGCGGG - Intergenic
1078566427 11:12418310-12418332 GCCCAGCAGGCCCCGCCCACAGG + Intronic
1083184099 11:61007643-61007665 TCCCAGAGCGCCCCGCACGCGGG - Exonic
1083232683 11:61333113-61333135 TCCCGTGATGCCCCGCGCCCCGG - Exonic
1085574321 11:77589301-77589323 CTCCAGGAGGCCCTGCGCACCGG + Intronic
1087141609 11:94769703-94769725 TCTCAGGAGGCCGCACGCTCAGG - Intronic
1091113637 11:132994224-132994246 TGCCAGGAGCCGGCGCGCGCGGG + Intronic
1093090392 12:14913617-14913639 TCCCAGGAGGCCCTTGGCTCAGG - Intergenic
1093412556 12:18884110-18884132 TCCCAGTAGGACCCGGGAGCTGG + Intergenic
1096019121 12:48307496-48307518 TCCCAGGAGTCTCAGCGCGGTGG - Intergenic
1096598656 12:52714304-52714326 TCCGAGGACGCCCCTGGCGCGGG + Intergenic
1099846587 12:88035441-88035463 TCCCAGAAGGCGCCGCGGCCAGG + Exonic
1100318494 12:93467457-93467479 TCCCAGAATGCCCCGCGGGCTGG + Intergenic
1101448794 12:104757417-104757439 ACCCAGGAGGCCCTGCGCAAAGG + Exonic
1103521317 12:121538142-121538164 TCCCTGGCGGCCCCGCGCCGCGG - Intronic
1104979760 12:132568592-132568614 GCACAGGAGGCCCCGCACGTGGG + Intronic
1105039232 12:132948825-132948847 TCCCAGGTGACCCCACGCTCAGG + Intronic
1105525760 13:21176631-21176653 CCCCAGGAGACCCCGCGAGACGG + Exonic
1105578015 13:21670935-21670957 TCCCAGGAAGTCCTGCGCTCTGG + Intergenic
1110236877 13:73226224-73226246 TTCCAGGAGGCCCCTCTCCCTGG + Intergenic
1112506672 13:99980240-99980262 TGGCAGGAGGCTCTGCGCGCGGG - Intergenic
1112771455 13:102799091-102799113 TCCCAGGGAGCCCGGGGCGCCGG - Exonic
1113914889 13:113864146-113864168 TCCCGGGAGGATCCGGGCGCGGG + Intergenic
1114516311 14:23302157-23302179 TACCTGGAGGCCGCGGGCGCGGG + Exonic
1118366774 14:65102762-65102784 TCCCAGGAGGCGCCGCGCCGCGG - Intergenic
1118776741 14:68978467-68978489 TCCCGGGAGGCCCGCCGCTCAGG + Intronic
1121552433 14:94812832-94812854 TCTCAGGAGGCCCCTCAGGCTGG + Intergenic
1122300266 14:100727314-100727336 TCCCAGGGGTCCCAGGGCGCAGG + Intronic
1122779822 14:104138879-104138901 TCCCCGGAGGTCCCGCCTGCGGG - Intronic
1124575442 15:30903871-30903893 TCCCACCTGGCTCCGCGCGCCGG - Exonic
1125920824 15:43524671-43524693 TCCCAGGAGCCCCCAGGCCCAGG + Exonic
1126732151 15:51694741-51694763 TCCCAAGAGGCCGAGCGCGGTGG + Intronic
1126746291 15:51829607-51829629 TCCCAGGATGCCCCGCGGCACGG + Intronic
1126852503 15:52805784-52805806 TCCCGCCAGGGCCCGCGCGCAGG - Intergenic
1131451204 15:92541655-92541677 TCCCAGGAGGCCCCGGGGACAGG - Intergenic
1132480849 16:165448-165470 CCCCAGGAGACGCCGCGGGCCGG - Intronic
1132523390 16:401759-401781 TCCCAGCAGGCCGCGGGCGGGGG + Intronic
1132665221 16:1078420-1078442 TCCCGGGAGGGGCCGCCCGCTGG + Intergenic
1132682096 16:1146578-1146600 TCCCATGAGGCCACGCCCTCTGG + Intergenic
1132968528 16:2673345-2673367 TCTGAGGAGGCCCCGAGCGGCGG - Intergenic
1137250340 16:46736617-46736639 TCCCAGGAGGCCTCGCAGGATGG - Intronic
1137582289 16:49640760-49640782 TTCCAGGAGGCCCCTTGAGCTGG - Intronic
1137591791 16:49698305-49698327 GCCCAGGATGCCCCGTGAGCAGG - Intronic
1139678071 16:68539203-68539225 TCCCAGAGGCCCGCGCGCGCAGG - Exonic
1142927768 17:3256251-3256273 CTCCAGGAGGCCCAGCGCGGTGG + Intergenic
1143066822 17:4256139-4256161 TCCCAGGTGGCCAGGCGCGGTGG + Intronic
1143326034 17:6099040-6099062 GCCCAGGTGGCCCAGCGTGCAGG + Intronic
1143370219 17:6434871-6434893 TCCCCGGAGGCCCAGCGCTGGGG + Intronic
1144522621 17:15963987-15964009 TCCCAGGAGGCCCTGGCCCCGGG - Intronic
1144846992 17:18225383-18225405 TCCCGGCAGGCCCCGCGCCGCGG + Intergenic
1145110197 17:20155832-20155854 TGCCAGAAGGCCCCGCGCCGTGG - Intronic
1145254861 17:21316885-21316907 TCCCCGGAAGCCCCGAGGGCCGG - Intergenic
1145321739 17:21771080-21771102 TCCCCGGAAGCCCCGAGGGCCGG + Intergenic
1147224667 17:38967443-38967465 TCCCAAGAGCCCCCGCGGGAAGG + Intergenic
1148593025 17:48830930-48830952 TCCCAGCAAGCGCCGCGCGGGGG + Intergenic
1150002698 17:61451754-61451776 GCCCAGGGGGCCGCGGGCGCTGG - Intergenic
1152650033 17:81488426-81488448 ATCCCGGAGGCCCCGGGCGCCGG - Intergenic
1152782057 17:82231032-82231054 ACCCCGGTGGACCCGCGCGCCGG + Intronic
1155053453 18:22166761-22166783 GCCCAGGAAGCTCCACGCGCGGG + Intergenic
1157095037 18:44679798-44679820 TCGCAGGAGGCGGCGCGCGGAGG - Intergenic
1160461493 18:79042096-79042118 TCGCAGGAGGCCCCGTGGGCTGG + Intergenic
1160868494 19:1266578-1266600 CCCCACGGGGCCCCGCCCGCCGG - Intronic
1161057202 19:2196616-2196638 CCCAAGGAGGCCCGGCGCGGTGG - Intronic
1161323440 19:3651849-3651871 TCCAGGGTGGCGCCGCGCGCGGG - Exonic
1161550533 19:4909937-4909959 TCGCGGGGCGCCCCGCGCGCAGG - Intronic
1161590680 19:5127866-5127888 TCCCAGGAGGCCCCGTTGGTCGG + Intronic
1161681203 19:5680739-5680761 TCCCAGGAGGCTCCGCGGCCAGG - Exonic
1162122903 19:8482910-8482932 TCGCAGGTGACCCCGCACGCTGG + Intronic
1162952718 19:14081546-14081568 TCCCAGAAGGCCACGCGAGTGGG + Intergenic
1162959715 19:14118393-14118415 ACCCAGGAGGCCCCGCGGCCTGG - Intergenic
1163026781 19:14517593-14517615 TCCGAGGCGGCCCCGCTCTCCGG + Intronic
1163128888 19:15259638-15259660 TCCCAGGATGCCCCCCACTCAGG - Intronic
1163720289 19:18895454-18895476 GACCAGGGGGCCCCGCGCGGTGG - Intronic
1166127622 19:40725217-40725239 TCCCAGGAAGCCCCTGGCCCTGG + Intronic
1166129368 19:40736887-40736909 TCCCAGGAGGCCGGGCGCGGTGG - Intronic
1167101615 19:47407322-47407344 GCCCAGGAGGGCCCGCGGGCCGG - Intronic
1167216829 19:48170666-48170688 TCCCACAATGCCCCGCGCCCAGG - Intergenic
1167792103 19:51689298-51689320 CCCCAGGGGGCCCCCCGCCCCGG - Intergenic
1168682599 19:58326939-58326961 TCCCAGCAGGCACCGCGCCTGGG + Intergenic
926035179 2:9630717-9630739 GGCGCGGAGGCCCCGCGCGCAGG + Intronic
926317797 2:11724318-11724340 TCCCAGGAGAGCCCATGCGCAGG + Intronic
927125959 2:20012596-20012618 TCCCGGGAGGCGGCGCGCGGGGG + Exonic
934515355 2:94982745-94982767 CCCCAGGAGGCCCAGGGCACTGG + Intergenic
934766599 2:96883407-96883429 TCCCAGGAAGCCACTCGCTCTGG + Intronic
935250078 2:101253122-101253144 GCCCGGGGGGCCCCGCGGGCAGG + Exonic
936057291 2:109270594-109270616 TCCCAGGAGGCCACGGGTGCAGG + Intronic
936061736 2:109299161-109299183 TCAGAGGAGGCCCCGTGAGCAGG - Intronic
936092964 2:109512626-109512648 TCCCACGAGGCCCAGCAAGCCGG - Intergenic
938374586 2:130797373-130797395 CCCAAAGAGGCCCCGCGCGGTGG - Intergenic
938403678 2:131015177-131015199 TCCCAGGAGGGCCCAGACGCAGG + Intronic
942288769 2:174448822-174448844 TCCCAGTAGGCCGGGCGCGGTGG - Intronic
947741208 2:232485787-232485809 GCCCAGGGGTCCCTGCGCGCGGG - Intronic
947885591 2:233566835-233566857 TCCCATAAGGCCCCGTGCGAGGG - Intergenic
948383300 2:237566540-237566562 TCCGAGGAGGCCCCGCTGGAGGG - Intergenic
1170349093 20:15419575-15419597 GCCCAGGAGGCCCCCCTCTCAGG + Intronic
1171223541 20:23421579-23421601 TCCCAGGAGGCCCCGGGGCGGGG + Intergenic
1171557545 20:26092102-26092124 TCCCAGGAGGGCCCCCGGCCTGG + Intergenic
1172224654 20:33297343-33297365 TCCCAGGTGGCCCTGCAGGCTGG + Intronic
1172732032 20:37096234-37096256 TCCCAGCAGGCTCTGCGCGCGGG - Intergenic
1174345916 20:49929728-49929750 TCCCAGGAGGCCGGGCGCGGTGG + Intergenic
1174509494 20:51040393-51040415 TCCCAGGAGCCCCCAGGAGCTGG - Intergenic
1176035424 20:63033990-63034012 GCCCAGGAGGCCCTGCTTGCTGG + Intergenic
1176038550 20:63052195-63052217 TCTCAGGAGGCCCCGCAGGGGGG - Intergenic
1176089852 20:63313920-63313942 TTCCAGGAGGCCCCACGAGGTGG - Intronic
1176138965 20:63536905-63536927 TCCCTGCAGGCCCCATGCGCTGG - Intronic
1176181479 20:63751751-63751773 TCCCATGAAGCCCCGCCCCCCGG + Intronic
1176181519 20:63751839-63751861 TCCCATGAAGCCCCGCCCCCCGG + Intronic
1178534854 21:33403223-33403245 TTCCGGGAGGCTCCGCGCTCTGG + Exonic
1178922612 21:36748236-36748258 ACCGCGGAGGCCCCGCGCGCCGG + Exonic
1179225072 21:39445786-39445808 TCCCAGGAGGCCCCGCGCGCGGG - Intronic
1179494662 21:41764092-41764114 TCCCAGGAGGGCCCCCTGGCAGG + Intronic
1179625289 21:42645810-42645832 TCCCAGGAGGCCCCGGGCTGAGG + Intergenic
1179775067 21:43657081-43657103 GCCCAGGAGGCCCGGCGCAGTGG + Intronic
1180071623 21:45439633-45439655 GACCCGGAGGCCCCGCGCACAGG - Intronic
1181934507 22:26429238-26429260 TCCCACAATGCCGCGCGCGCTGG - Intergenic
1183337174 22:37256480-37256502 TCCCAGGAGGCCCTCCCAGCGGG + Intergenic
1184036854 22:41922512-41922534 TCCCAGCTGGCCCCGCCAGCCGG - Intergenic
1184568859 22:45309844-45309866 TCCCCGGAGGCCCCGCCCCGGGG - Intronic
1184955195 22:47881250-47881272 CCCCAGGAGGCCCCGGGCTGAGG - Intergenic
1185238670 22:49728969-49728991 CCCAAGGAGGCCCTGCACGCTGG + Intergenic
950431821 3:12955318-12955340 TCCCAGGAGGCCTGCCGGGCTGG + Intronic
951362644 3:21742677-21742699 TGCCAGGAGGCCCTGGGCCCTGG + Intronic
953406646 3:42663151-42663173 TCCCAGGTGACCCCTCGGGCAGG - Intronic
953729120 3:45430086-45430108 TCCCAGGAGGCCAAGCTTGCAGG - Intronic
956414741 3:69013785-69013807 ACCCAGGAGGGCCAGGGCGCGGG + Exonic
959909468 3:111747643-111747665 TCCCAGGAAGCCTCTCCCGCAGG + Intronic
963038285 3:141051067-141051089 ATCCGGGAGGACCCGCGCGCAGG + Intergenic
963335940 3:143973002-143973024 TCCCAGGACGCCCCCTGCCCTGG - Intronic
968693581 4:2009085-2009107 TCCCGGGAAGCCCCGCTCGTGGG - Exonic
968741855 4:2335146-2335168 TCCCAGACGGCCCCGCTGGCAGG + Intronic
968835772 4:2963510-2963532 TCCCAGCAGGCCACGCGCCGCGG + Intergenic
969239069 4:5887864-5887886 TCCCCGCAGGCCTCGCGCGGGGG - Intronic
969619398 4:8271443-8271465 TCCCAGGAACCCCAGCGTGCTGG - Intronic
975533657 4:75426496-75426518 TCCCAGGAGGCCACCCAGGCTGG + Intergenic
985575349 5:671138-671160 TCCCAGGCGGCCCCTCAGGCAGG - Intronic
985782263 5:1877604-1877626 GCCCAGGAGGCCTCACGCCCAGG + Exonic
1001639300 5:173233914-173233936 TCCCGGGAGGCCGCAGGCGCTGG - Intronic
1002091709 5:176810267-176810289 TCCCTGGAGACCCCGCGGGGCGG + Intergenic
1002160559 5:177311944-177311966 CCCCGGGACGCCCCGCCCGCGGG + Exonic
1002791683 6:441799-441821 TCCCAGGAGGGGCCGGGCTCAGG + Intergenic
1003314922 6:5003662-5003684 TCCCAGGATGCGCCGGGCGTGGG - Intronic
1005492598 6:26360503-26360525 TCCAAGGAGGCCGGGCGCGGTGG - Intergenic
1005684950 6:28245348-28245370 TCCCAGGACTCCCCGTGCTCAGG + Exonic
1007320943 6:41028407-41028429 TCCCGGGCGCCCCCGCGCTCGGG + Exonic
1018942534 6:168319206-168319228 GACATGGAGGCCCCGCGCGCAGG - Intronic
1019625293 7:2012800-2012822 GCCCAGGAGGCCCCAGGCCCAGG - Intronic
1020074428 7:5248467-5248489 TCCCAGGAGGCCCCGTCTCCCGG + Intergenic
1020074455 7:5248582-5248604 TCCCAGGAGGCCCTGCTGGGTGG - Intergenic
1021554599 7:21906372-21906394 TCTCAGGAGGCCGCGCACTCCGG + Exonic
1024220512 7:47282930-47282952 TCCCAGGATGCTCCCCGAGCAGG - Intronic
1025204645 7:56985225-56985247 TCCCAGGAGGCCCTGCTGGGTGG + Intergenic
1025667292 7:63591710-63591732 TCCCAGGAGGCCCTGCTGGGTGG - Intergenic
1027260498 7:76461651-76461673 TCCCAGAAGGCCGCACGCCCCGG + Intergenic
1027266321 7:76496994-76497016 ACCCAGGAGACCCCGTGCCCCGG + Intronic
1027311875 7:76959764-76959786 TCCCAGAAGGCCGCACGCCCCGG + Intergenic
1027317701 7:76995112-76995134 ACCCAGGAGACCCCGTGCCCCGG + Intergenic
1029363133 7:100101213-100101235 CCCCGGGAGGCTCCCCGCGCAGG + Intronic
1029419571 7:100465931-100465953 CCCCAGGAGGCCCCTAGCCCCGG - Intronic
1030084225 7:105803337-105803359 TCCCAGCAGGCCACGCTCCCAGG - Intronic
1031043517 7:116862816-116862838 TCACCCGAGGCCCCGCGCGGGGG + Intronic
1035061827 7:156075103-156075125 TCCCAGGAGGCCGTGAGGGCAGG - Intergenic
1035244591 7:157554042-157554064 GCCCAGGAGGGCACGCGAGCGGG - Intronic
1037786200 8:21904778-21904800 TCCAAGGAGGCCCGGCGTGGTGG + Intergenic
1038883433 8:31639349-31639371 GCCCAGGAGGACCCACTCGCGGG + Intergenic
1041107684 8:54458463-54458485 ACCCAGGCGGCCGGGCGCGCTGG + Intronic
1043545202 8:81307151-81307173 TCCCAGGAGGCCCCATTCCCAGG + Intergenic
1045568477 8:103345539-103345561 TCCCTGGAGGCCCAGTGCTCTGG - Intergenic
1048020611 8:130535738-130535760 TCCCAGCAGGACCCTCGAGCTGG - Intergenic
1049496701 8:142939002-142939024 TCCCAGAAGGCCCCGGGGTCAGG + Intergenic
1049554220 8:143274170-143274192 TTCCAGCAGGCCCAGCGCACTGG - Intronic
1049578892 8:143401831-143401853 AGCCAGGATGCCCCGCCCGCTGG - Intergenic
1049693700 8:143973594-143973616 ACCCAGGATGCCCCACGGGCGGG + Intronic
1049765334 8:144352754-144352776 TCCTAGGAGGCCCTGCACCCTGG + Intronic
1049785504 8:144448815-144448837 TCCCAGCAGGCCACACGCCCTGG + Intergenic
1053022037 9:34701626-34701648 TCCCTGGGGTCCCCGCGCGCGGG + Intergenic
1057146956 9:92764882-92764904 CCCCAGCGGGCCCCGCGCGCCGG - Intergenic
1057439632 9:95073495-95073517 TCCCAGCAGGCCGGGCGCGGGGG + Intronic
1057439650 9:95073567-95073589 TCCCAGCAGGCCGGGCGCGGTGG + Intronic
1057459048 9:95242856-95242878 TCCCTGGAGGCCCTGAGCTCAGG + Intronic
1061328511 9:129878468-129878490 TCCCAGGAGGCCCCCAGGGCAGG - Intronic
1062381892 9:136290720-136290742 TCCCAGGAGCCCCCGGGACCTGG + Exonic
1062534960 9:137017381-137017403 GCCCAGGAGGCCGGGCGTGCGGG - Intronic
1186441068 X:9587132-9587154 GCCCTGGAGGCACCGAGCGCTGG + Intronic
1187915725 X:24150363-24150385 GCCCCGGAGGCCCGGCGCGGCGG + Intronic
1198312643 X:135436720-135436742 GCCCAGCAGGCCTCGCTCGCGGG - Intergenic
1199736812 X:150693355-150693377 ACCCACAAGGCCGCGCGCGCGGG - Exonic