ID: 1179225073

View in Genome Browser
Species Human (GRCh38)
Location 21:39445787-39445809
Sequence TTCCCAGGAGGCCCCGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225073_1179225080 -6 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225073_1179225076 -9 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225073_1179225085 18 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225073_1179225079 -7 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225073_1179225087 26 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225087 21:39445836-39445858 CGCATGCGCACTCGGGCAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 55
1179225073_1179225082 -1 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225073_1179225086 19 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225073_1179225081 -2 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225073_1179225078 -8 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225073 Original CRISPR TTCCCAGGAGGCCCCGCGCG CGG (reversed) Intronic
900102301 1:967041-967063 GTCCCGGGAGGCCCCGCCCGCGG - Intronic
900183940 1:1324432-1324454 CTCCCACCAGGGCCCGCGCGGGG + Intronic
900545506 1:3226789-3226811 TTCCCTGGGGTCCCCGTGCGGGG - Intronic
900953803 1:5874693-5874715 TTCCCAGGAGGACCCACAGGAGG + Intronic
901269488 1:7940885-7940907 TTCCCATGAGACCCCGCCCCTGG - Exonic
903639522 1:24848741-24848763 TGCCCAGGTGGCCCCTCCCGCGG - Intergenic
906308995 1:44739665-44739687 TTCCCAGAAGGCACAGCGCTCGG + Intergenic
907397286 1:54200175-54200197 TTCCCAGCAGGCCCTGCGCGCGG + Exonic
916773559 1:167936790-167936812 CGCCCTGGAGGCCCGGCGCGCGG + Intronic
919902862 1:202056958-202056980 TCCCCAGGAGGCCCAGGGCTGGG - Intergenic
922471010 1:225877321-225877343 TTCCCAGAAGGCCCTGGGTGGGG + Intronic
923698991 1:236282038-236282060 CTCCCACAAGGCCCCGCGCTTGG - Intergenic
924701816 1:246462198-246462220 TACCCAGCAGGCCCCGCGGGAGG - Intronic
924701825 1:246462229-246462251 TACCCAGCAGGCCCCGCGGGAGG - Intronic
924701834 1:246462260-246462282 TACCCAGCAGGCCCCGCGGGAGG - Intronic
924701843 1:246462291-246462313 TACCCAGCAGGCCCCGCGAGAGG - Intronic
1065028629 10:21563234-21563256 TTTTCTGGAGGCCCGGCGCGTGG + Intronic
1065102084 10:22340967-22340989 GCCCCGGGAGGCCCCGCGGGAGG + Intergenic
1069795602 10:71049851-71049873 TTCCCAGGAGGCCCTGCCCTTGG - Intergenic
1075093311 10:119455254-119455276 TTCCGAGGCGGCCCCGGCCGGGG + Exonic
1076618610 10:131772577-131772599 TCCCCAGGAGCCCCCACGCCTGG + Intergenic
1077235695 11:1481084-1481106 TTCCCAGGAGGTGCCACGCAAGG - Intronic
1077298717 11:1837704-1837726 TTCCCAGGCGGCCCGGAGAGGGG - Intergenic
1077877571 11:6320672-6320694 TTCCCAGCAGGCCCCCGGCGCGG - Intergenic
1083325274 11:61869906-61869928 CTCCCAGGAGGCCCAGCGGCTGG + Intergenic
1083665227 11:64270456-64270478 CTCCCAGGAGGCTCCACGCCGGG + Intronic
1083896750 11:65623987-65624009 TGGCCAGGAGGCCCCGGGAGGGG + Intronic
1084085639 11:66853888-66853910 TCCCCAGGAGGCCCCGTCCCGGG + Intronic
1091306492 11:134539505-134539527 TTCCCAGGTGGCCCCAAGCATGG + Intergenic
1092139269 12:6171663-6171685 TTCCAAGGAGGCCCCAGGCATGG - Intergenic
1094828759 12:34290302-34290324 TTCCCAGCAGCCCCTGCGAGGGG - Intergenic
1094829398 12:34293070-34293092 TTCCCAGCAGTCCCTGCGTGGGG - Intergenic
1094829442 12:34293263-34293285 TTCCCAGCAGCCCCTGCGTGGGG - Intergenic
1094829568 12:34293876-34293898 TTCCCAACAGCCCCTGCGCGGGG - Intergenic
1094829659 12:34294282-34294304 TTCCCAGCAGCCCCTGCGTGGGG - Intergenic
1094830650 12:34298658-34298680 TTCCCAGCAGCCCCTGCGTGGGG + Intergenic
1094830932 12:34299935-34299957 TTCCCAGCAGCCCCTGCGTGGGG + Intergenic
1094831021 12:34300339-34300361 TTCCCAGCAGCCCCTGCGCAGGG + Intergenic
1094831067 12:34300545-34300567 TTCCCAGTAGCCTCTGCGCGGGG + Intergenic
1094831416 12:34301979-34302001 TTCCTAGTAGACCCTGCGCGGGG + Intergenic
1094831690 12:34303226-34303248 TTCCCAGCAGTCCCTGCACGGGG + Intergenic
1094832361 12:34306203-34306225 TTCCCAGCAGCCCCTGCGCGGGG + Intergenic
1094832455 12:34306622-34306644 TTCCCAGCAGCCCCTGCGCGGGG + Intergenic
1094832831 12:34308293-34308315 TTCCCAGCAGTCCCTGTGCGGGG + Intergenic
1094833658 12:34312260-34312282 TTCCCAGCAGTCCCTGCACGGGG - Intergenic
1094835308 12:34319413-34319435 TTCCCAGCAGCCCCTGCACGGGG - Intergenic
1094835848 12:34321697-34321719 TTCCCAGGAGACCCTACGCGTGG - Intergenic
1094836609 12:34325064-34325086 TTCCCAGCAGCCCCTGCACGGGG - Intergenic
1094837579 12:34329341-34329363 TTCCCAGCAGCCACTGCGCGGGG - Intergenic
1102140893 12:110614098-110614120 TTCCCGTGATGCCCCGCGCCTGG + Intronic
1104953795 12:132454156-132454178 TTCCCAGGAGGCCCGGGCTGGGG - Intergenic
1104979759 12:132568591-132568613 GGCACAGGAGGCCCCGCACGTGG + Intronic
1113082777 13:106535360-106535382 GTCACAGGCGGCCCCGCTCGGGG - Intergenic
1113805926 13:113110044-113110066 GCCCCAGGAGGATCCGCGCGAGG + Intronic
1113914888 13:113864145-113864167 TTCCCGGGAGGATCCGGGCGCGG + Intergenic
1114075374 14:19158748-19158770 TTCCCAGCAGCCCCTGCGCTAGG + Intergenic
1114086896 14:19241232-19241254 TTCCCAGCAGCCCCTGCGCTAGG - Intergenic
1124129511 15:26971609-26971631 ATCCCCGGAGGCCCCGAGCTGGG + Intronic
1124789784 15:32717466-32717488 CTCCCCGGCGGCCCCGCCCGAGG - Intergenic
1128743205 15:70097140-70097162 TCCCCAGCAGGTCCGGCGCGGGG + Exonic
1132463811 16:68455-68477 TTCCCAGAAAGCCCCTCGGGGGG + Intronic
1132523389 16:401758-401780 GTCCCAGCAGGCCGCGGGCGGGG + Intronic
1132631311 16:918989-919011 AGCCCAGGAGGCCCCGTGGGAGG - Intronic
1132834028 16:1943432-1943454 TCCCCAGCAGGCCCCGCCCATGG + Intergenic
1137556747 16:49475050-49475072 TTTCCAGGAGGCTCAGCGGGGGG - Intergenic
1139420939 16:66849177-66849199 GTCCCAGGAGGCCTCGTGCATGG + Intronic
1139950229 16:70664861-70664883 GTCCCAGGAGGCCCAGCCAGTGG - Intronic
1141895304 16:86955363-86955385 TTCCCAGGAGGCCTGGTGCTGGG - Intergenic
1142234901 16:88917432-88917454 TTCCCTGCAGGCCCTGCACGTGG - Intronic
1142638290 17:1270982-1271004 GTCCCCGGTGTCCCCGCGCGCGG - Exonic
1142656697 17:1399533-1399555 TTCCCCGGAGGCCCCGTGTGGGG - Intronic
1142982395 17:3679747-3679769 TTCCCAGGAGGCCGAGGACGAGG - Exonic
1143033692 17:3982414-3982436 TACCCAGGAGGCTCCGTGTGCGG - Intergenic
1143370218 17:6434870-6434892 CTCCCCGGAGGCCCAGCGCTGGG + Intronic
1144519513 17:15944786-15944808 GTCCCAGGAGCCGCCGCGAGAGG - Intergenic
1144522622 17:15963988-15964010 TTCCCAGGAGGCCCTGGCCCCGG - Intronic
1146923636 17:36729754-36729776 TTCCCTGGAGGCCCCACCCTGGG - Intergenic
1147123992 17:38352842-38352864 TTCCGAGAAGGACCCGCGAGTGG - Exonic
1147340433 17:39750499-39750521 TTCCCAGGAGGTCCCAGGCTGGG - Intergenic
1147369305 17:39980802-39980824 TTCCCAGAAGGCCCAGCGCCGGG + Exonic
1148593024 17:48830929-48830951 GTCCCAGCAAGCGCCGCGCGGGG + Intergenic
1152080217 17:78182618-78182640 GGCCCAGGAGGCCCTGGGCGTGG - Exonic
1152245458 17:79182775-79182797 CTCCCCGGAGGCCCGGCGCGCGG + Intronic
1152689569 17:81712000-81712022 TCCCCAGGAGGCCCGGCCCCTGG - Intergenic
1152748331 17:82051402-82051424 GCCCCCGGAGGCTCCGCGCGGGG - Intronic
1203162494 17_GL000205v2_random:64086-64108 TTCCCATCAGCCCCCGCGCATGG - Intergenic
1153934956 18:9913576-9913598 TTCCCAGCAAGCACCGCGCAGGG + Intergenic
1160223980 18:76998222-76998244 TGCACAGGAGGCCCCTCGGGTGG - Intronic
1161314931 19:3613317-3613339 CTCCGAGGAGGGCCCGGGCGGGG + Exonic
1161699671 19:5787806-5787828 TTCCGGGGAGGCCCCGAGAGAGG - Intronic
1162952717 19:14081545-14081567 TTCCCAGAAGGCCACGCGAGTGG + Intergenic
1166581228 19:43901841-43901863 TTCCCAGAAGTCACCGCGCTAGG - Intergenic
1167612434 19:50513946-50513968 TTCCCCGCAGGCCCAGCGTGGGG + Intronic
1168414423 19:56159617-56159639 TTCCCAGCAGGCACCGCCCCTGG + Exonic
1168682598 19:58326938-58326960 TTCCCAGCAGGCACCGCGCCTGG + Intergenic
926027204 2:9555727-9555749 TTCCCAGTAGGCGGCGCGGGAGG - Exonic
927125958 2:20012595-20012617 GTCCCGGGAGGCGGCGCGCGGGG + Exonic
929539873 2:42811113-42811135 CTCCCCGGACGCCCCGCGCTAGG - Intergenic
937054490 2:118921693-118921715 TTCCCACAAAGCCCCACGCGGGG + Intergenic
938383668 2:130850208-130850230 TTCCCAAGAGGCCCCTAGAGAGG - Intronic
938489393 2:131753993-131754015 TTCCCATCAGGCCCTGCGCTTGG + Intronic
939957646 2:148540126-148540148 TTCCCATGAGGGCCCATGCGTGG - Intergenic
946395346 2:219441570-219441592 TTCCAGAGAGGCCCCGCGGGAGG + Intronic
947741209 2:232485788-232485810 TGCCCAGGGGTCCCTGCGCGCGG - Intronic
947885592 2:233566836-233566858 TTCCCATAAGGCCCCGTGCGAGG - Intergenic
948383301 2:237566541-237566563 CTCCGAGGAGGCCCCGCTGGAGG - Intergenic
1171143289 20:22761092-22761114 TTACCAGGTGGCCCTGCGCTAGG - Intergenic
1171223540 20:23421578-23421600 TTCCCAGGAGGCCCCGGGGCGGG + Intergenic
1172271630 20:33658610-33658632 TTCCCATGAGGCCCCAGGCCGGG - Intronic
1172732033 20:37096235-37096257 CTCCCAGCAGGCTCTGCGCGCGG - Intergenic
1175246881 20:57587550-57587572 TTCCCAGGAGTCCCTGCTCAAGG - Intergenic
1175826977 20:61941793-61941815 ATCCCAGGAGGCCCGGCCCAGGG - Intergenic
1176038551 20:63052196-63052218 TTCTCAGGAGGCCCCGCAGGGGG - Intergenic
1179225073 21:39445787-39445809 TTCCCAGGAGGCCCCGCGCGCGG - Intronic
1180945714 22:19692058-19692080 TTCCCGGGAGCCCCCGCCCAAGG + Intergenic
1181065781 22:20305293-20305315 TACCCAGGAGACCCCAAGCGAGG - Intergenic
1181595872 22:23914051-23914073 TCCCCAGCATGCTCCGCGCGGGG + Intergenic
1182097717 22:27637370-27637392 TCCCCAGGAGGCCCCACAGGAGG + Intergenic
1182285298 22:29243557-29243579 TCCCCAGGAGGCCCTGGGAGTGG + Intronic
1183098758 22:35570589-35570611 TCCCCAGGAGGCCTCGCCAGGGG - Intergenic
1183942141 22:41301914-41301936 TTTCCAGGTGGCCCGGCGCGCGG - Intronic
1184568860 22:45309845-45309867 GTCCCCGGAGGCCCCGCCCCGGG - Intronic
1185317600 22:50185767-50185789 TTCCCAGGGGGTAGCGCGCGGGG - Intergenic
1185397489 22:50600484-50600506 CGCCCTGGAGGACCCGCGCGGGG - Intronic
950185175 3:10940292-10940314 TTCCCAGCAGGCCCCAGGCAAGG + Exonic
950641868 3:14353665-14353687 TTCCCAGCAGGGCCCCCGCCTGG + Intergenic
954259651 3:49429333-49429355 ATCCCGGGAGGCCCCGCGTACGG + Intergenic
955414744 3:58681478-58681500 ATCCAAGGAGGCCCAGCGTGGGG + Intergenic
961643865 3:128382043-128382065 TTCCCAGGTGGCCCCAGGCAAGG + Intronic
966818781 3:183909154-183909176 TGCCCAGGAGGACCTGCGTGAGG - Intergenic
968225187 3:196968747-196968769 GTCCCAGGAGGCCCCGGAGGCGG + Exonic
968445778 4:651358-651380 TTTCCAGGAGGCCCCCCCTGAGG - Intronic
968554912 4:1241979-1242001 TTCCCAGGAGCCACCGGGAGAGG + Intronic
968693582 4:2009086-2009108 CTCCCGGGAAGCCCCGCTCGTGG - Exonic
968923052 4:3532483-3532505 TTCCCAGGAGACCGCGCGGTGGG - Exonic
969239070 4:5887865-5887887 CTCCCCGCAGGCCTCGCGCGGGG - Intronic
969323313 4:6426117-6426139 TTCCCAGCAGGCTCCGCCCTGGG + Intronic
985722292 5:1495901-1495923 TTCCAAGGTGGCCCCACGAGAGG - Intronic
986759667 5:10868475-10868497 CTCCCAGGAGGCCCTGAGCAAGG - Intergenic
987772701 5:22327192-22327214 TTCCCAGGAGTCCTCGAGTGTGG - Intronic
991720803 5:69493028-69493050 TTCCCACGAGTCCCAGCTCGGGG - Intronic
995512255 5:112921553-112921575 TGCCCAGCAGGCCCTGCGAGAGG - Intronic
1002299088 5:178247540-178247562 TTCCCTGGAGGCCCTGCAGGAGG + Exonic
1003314923 6:5003663-5003685 CTCCCAGGATGCGCCGGGCGTGG - Intronic
1005991848 6:30908147-30908169 TTCCCAGCATCCCCCGCGCCCGG + Intergenic
1015310733 6:131764403-131764425 TTTCCAGGAGACCCCGCACTGGG - Intergenic
1015700523 6:136031447-136031469 TTACCAGGAGGGGCCGGGCGCGG + Intronic
1016678773 6:146803843-146803865 ATCCCGGCAGGCCGCGCGCGCGG - Intronic
1017446312 6:154510187-154510209 TTCCCGGGAGGGCGCGCCCGCGG + Exonic
1019508228 7:1404128-1404150 TTCCCAGGCAGCTCCGCGCCTGG + Intergenic
1019517338 7:1445877-1445899 TTCCTAGGAGCCCCCACCCGGGG + Intronic
1021998330 7:26201610-26201632 TTCCCAGCGGGCGCGGCGCGCGG + Intronic
1023617430 7:42034399-42034421 TTCCCTGGAGGCCCCCCACAAGG - Intronic
1027569624 7:79847599-79847621 TTCCCTGGTGCCCCCGCGCAGGG - Intergenic
1029640042 7:101815253-101815275 CTCTCAGGGGGCCGCGCGCGTGG - Intergenic
1029782446 7:102748875-102748897 TTCCCAGGAGGCAATGCGCAGGG - Intergenic
1031043516 7:116862815-116862837 GTCACCCGAGGCCCCGCGCGGGG + Intronic
1034286328 7:149885444-149885466 TTCCCAGGAGGCCGGGGGCAGGG + Intergenic
1035244592 7:157554043-157554065 TGCCCAGGAGGGCACGCGAGCGG - Intronic
1035569536 8:662957-662979 TTCCCAGGAGGCCACACATGAGG - Intronic
1039978877 8:42390182-42390204 TTCTGAGGGGGCCCCGGGCGCGG - Intergenic
1040106425 8:43544817-43544839 TTCCCAACAGGCCCTGCGCTGGG - Intergenic
1040106787 8:43546150-43546172 TTCCCGGCAGGCCCTGCGCCGGG - Intergenic
1040275566 8:46012018-46012040 TTCCCAGTAGTCCCTGCGTGGGG - Intergenic
1040277339 8:46020782-46020804 TTCCCAGAAGCCCCTGTGCGGGG - Intergenic
1041045079 8:53880750-53880772 TACCCCCGAGGCCCCACGCGGGG - Intronic
1046909902 8:119614353-119614375 TTCCTAGGAGGGGCCGGGCGTGG - Intronic
1049637066 8:143694766-143694788 TCCCCAGGATGCCCGGCGCCGGG - Exonic
1052338143 9:27339859-27339881 TTCCCAGGAGGCCCACAGCCAGG + Intronic
1053022036 9:34701625-34701647 GTCCCTGGGGTCCCCGCGCGCGG + Intergenic
1053173400 9:35906470-35906492 TTCCCAGGTGGCCCCGCCGCCGG - Exonic
1053471179 9:38347006-38347028 TCACCAGAAGGCCCCGCGCTGGG + Intergenic
1057439631 9:95073494-95073516 ATCCCAGCAGGCCGGGCGCGGGG + Intronic
1058040201 9:100294345-100294367 TTCCCAGGAGGTCCAGGGAGAGG + Intronic
1058870267 9:109195313-109195335 TTCCCACGTGGCCCCGTGCTGGG - Intronic
1061052233 9:128203675-128203697 ATCCCTGGAGTCCCCGCCCGGGG + Intronic
1061149409 9:128820418-128820440 TTCCCAGGAGACCCTGGGTGGGG + Exonic
1062534961 9:137017382-137017404 TGCCCAGGAGGCCGGGCGTGCGG - Intronic
1189258449 X:39658986-39659008 GTCCCAGCAGGCCGGGCGCGCGG + Intergenic
1191250426 X:58257572-58257594 TTCCCAGCAGTCCCTGCGCCGGG + Intergenic
1191250759 X:58259118-58259140 TTCCCAGGAGCCCCTGTGCTGGG + Intergenic
1191251065 X:58260454-58260476 TTCCCAGCAGCCCCTGCGCCAGG + Intergenic
1191251255 X:58261226-58261248 TTCCCAGCAGCCCCTGCGCCAGG + Intergenic
1191251971 X:58264113-58264135 TTCCCAGCAGCCCCTGCGCCGGG + Intergenic
1191252153 X:58264881-58264903 TTCCCAGCAGCCCCTGCGCCCGG + Intergenic
1191252298 X:58265414-58265436 TTCCCAGCAGCCCCTGCGCCAGG - Intergenic
1191252401 X:58265825-58265847 TTCCCAGCAGCCCCTGCGCAGGG - Intergenic
1191258665 X:58290999-58291021 TTCCCAGCAGACCCTGCGCCAGG + Intergenic
1199736813 X:150693356-150693378 TACCCACAAGGCCGCGCGCGCGG - Exonic
1200154622 X:153968959-153968981 TTCTCAGCAGCCCCCGGGCGGGG - Intronic