ID: 1179225074

View in Genome Browser
Species Human (GRCh38)
Location 21:39445794-39445816
Sequence CGGGGCCTCCTGGGAAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 291}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225069_1179225074 -6 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225065_1179225074 -4 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225060_1179225074 19 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225063_1179225074 5 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225067_1179225074 -5 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225058_1179225074 30 Left 1179225058 21:39445741-39445763 CCACGACTGCGCCAACGCCGCAG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1179225061_1179225074 13 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG 0: 1
1: 0
2: 4
3: 23
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225074 Original CRISPR CGGGGCCTCCTGGGAAGCGC CGG Intronic
900176533 1:1293751-1293773 CGGGGCCTCCAGGGCAGGGGCGG - Intronic
900176543 1:1293771-1293793 CGGGGCCTCCAGGGCAGGGGCGG - Intronic
900211690 1:1459423-1459445 GGGGGCCTCCCGGGCAGAGCTGG + Intronic
900217462 1:1489457-1489479 AGGGGCCTCCCGGGCAGAGCTGG + Intronic
900224499 1:1526723-1526745 GGGGGCCTCCCGGGCAGAGCTGG + Intronic
900238341 1:1603098-1603120 CGGGGGCTCGTGGGCAGCCCTGG + Intergenic
900391810 1:2436924-2436946 TGAGGCCTCCTGGGGAGCTCTGG + Intronic
900474730 1:2870736-2870758 CTGGGCCTTCTGGGCAGGGCTGG - Intergenic
900540144 1:3198534-3198556 CGTGGCCTTCTGGGACGCGTGGG + Intronic
900581206 1:3410558-3410580 TGGGGCCTCCTGAGAACCTCAGG + Intronic
901679831 1:10906509-10906531 GGTGGCCTCCTGGGCAGCGGTGG - Intergenic
902389431 1:16094525-16094547 TGCGGCCTCCTGGGAACAGCTGG - Intergenic
903033496 1:20479859-20479881 GGGGGCCTGGTGGGAAGCTCTGG - Intergenic
903744128 1:25575215-25575237 GGGGGCCTCCTGGGAAAGCCAGG + Intergenic
903769514 1:25755014-25755036 GGGGGCCTCCTGGCAGGAGCTGG + Intronic
903883802 1:26529880-26529902 CGGGGCCGCCGGAGGAGCGCGGG + Intronic
904608966 1:31714862-31714884 GGGGGCCTCGTGGGGGGCGCAGG + Intergenic
904895799 1:33817182-33817204 CTGGGCCTTCAGGGAAGCCCAGG + Intronic
905169205 1:36099423-36099445 CCGGCCCCCCTGGGAAGCCCGGG - Exonic
905647273 1:39633270-39633292 CGGGGCCTTCTGGGAGGCCAGGG - Intronic
905734603 1:40316751-40316773 CGGCGCCCCCTGGGAGGCGGCGG + Intronic
907520706 1:55021708-55021730 AGGGGCTTCCTGGGAAGAGAGGG + Intergenic
908555733 1:65254803-65254825 CGGGACCGCTGGGGAAGCGCAGG + Intronic
912967970 1:114252997-114253019 CAGGGCCCCCTGGGTAGCTCTGG - Intergenic
914804516 1:150982707-150982729 TGGGGTCTCCTGGGCAGTGCAGG - Intronic
915362581 1:155294979-155295001 TGGGGACTCCTGGGACGGGCTGG + Intronic
915622719 1:157095731-157095753 CAGGGCCTGCTGGGACTCGCTGG - Intronic
915724562 1:158008281-158008303 TGGGGCCTGCTGGGCAGCCCAGG - Intronic
918048137 1:180953666-180953688 AGGGGCCTTCTGTGAACCGCGGG - Intergenic
919221649 1:194638285-194638307 TGGGGCCTCCTGGAAGGCGGAGG - Intergenic
919801854 1:201359117-201359139 CGGGCCCTCCTGGGCACCCCAGG - Exonic
921365260 1:214367690-214367712 CGGGGTCTCCTGACAAGCACAGG + Intronic
1062957630 10:1550843-1550865 CACGGCGGCCTGGGAAGCGCGGG - Intronic
1063567078 10:7180471-7180493 GGGGCCCTTCTGGGAAGGGCAGG - Intronic
1064856694 10:19776268-19776290 TGGGGCCTCGTGGGAGGCACTGG - Intronic
1067711642 10:48655576-48655598 CGGGGCCTGCCGGGCAGCGCTGG + Intronic
1068845161 10:61663230-61663252 CGGGGCCGGCTGGGGGGCGCCGG - Intronic
1069137042 10:64780445-64780467 CGGGGGTTCCTGGGAACCACCGG - Intergenic
1072313976 10:94183941-94183963 TGGGGCCTCGTGGGAGGTGCTGG - Intronic
1072916656 10:99540958-99540980 CGGGCCCGCCTGGGAAGCAGCGG - Intergenic
1073196408 10:101695064-101695086 CGGGGCCCCCCGGGAACGGCGGG - Exonic
1073363362 10:102917948-102917970 CAGGGGCCCCTGGGGAGCGCGGG + Intergenic
1073577574 10:104639260-104639282 CGGGGGCTCTCGGGAATCGCTGG + Intergenic
1075103920 10:119524679-119524701 CGGAGCCTCCTGGGCAGAGAGGG - Intronic
1076027531 10:127128543-127128565 CGGGGCCTGCTGGGGAGTGGGGG - Intronic
1076782179 10:132730392-132730414 CGGGGCTGCGTGGGCAGCGCGGG + Intronic
1077298722 11:1837711-1837733 CCGGGCCGCCTGGGAAGACCGGG + Intergenic
1077351303 11:2094440-2094462 TGGGGTCTCCTGGGCAGAGCTGG - Intergenic
1077877309 11:6319523-6319545 TGGTGCCTTCTGGAAAGCGCTGG + Exonic
1078541591 11:12217662-12217684 CGTGGCCTCCTGGGATGCTAAGG + Intronic
1078900703 11:15639788-15639810 CTTGGCATCCTGGGAAGCACAGG - Intergenic
1081623734 11:44634623-44634645 CCAGGCCTCCTGGGAAGGGGGGG - Intergenic
1082819897 11:57537715-57537737 GGGGCCCTCCTGGGAGGCTCTGG - Intergenic
1083665571 11:64272363-64272385 TGGGGCCTCCTGGCAACCCCTGG + Intronic
1083799000 11:65035535-65035557 CAGGGCCTCCTGGGCAGGGCTGG - Exonic
1084386278 11:68844318-68844340 CGAGGCCTCCCGGGGAGCTCCGG + Intronic
1084413853 11:69019157-69019179 CATGGCCTCCTGGGAATCACGGG + Intergenic
1084474524 11:69381222-69381244 CGGGGCCCCCTGGGAGGAGCAGG + Intergenic
1088678122 11:112216041-112216063 TGGGGCCTAGTGGGAAGTGCTGG - Intronic
1089310893 11:117557474-117557496 CAGGGACTCCTGGGAAGCTGCGG - Intronic
1090396759 11:126424292-126424314 AGGGGCCTCCAGGAAAGGGCCGG + Exonic
1091311431 11:134577778-134577800 GGGGGCCTCTTGACAAGCGCGGG + Intergenic
1091504884 12:1057373-1057395 CTTGGCCTCCTGGAAAGCGCTGG + Intronic
1091993764 12:4977036-4977058 CAGGGCAGCCTGGGAAGAGCCGG - Intergenic
1092060661 12:5547833-5547855 GGGGGCCTCCAGGGAGGAGCTGG + Intronic
1092129053 12:6095841-6095863 GGGGGCCTCCTGGGGAGTGGGGG - Intronic
1092462443 12:8698229-8698251 TGGGGCCTTCGAGGAAGCGCGGG - Exonic
1096686364 12:53290914-53290936 GGAGGCCTCCTGGGCAGGGCCGG - Exonic
1099682128 12:85843425-85843447 AGGAGCCTCCTGGGAAGCGCAGG + Intergenic
1101452077 12:104788991-104789013 AGGGGTTTCCTGGGAAGGGCAGG + Intergenic
1103053644 12:117801863-117801885 CAGGGCCTCTTGGGAATCCCAGG - Intronic
1103521320 12:121538150-121538172 CGGGGCCGCCAGGGAGGCGGAGG + Intronic
1103719686 12:122966542-122966564 CGGAGCCTCCCGGGAGGGGCGGG + Intronic
1103899431 12:124295593-124295615 CGGGGGCTCCGAGGAGGCGCCGG - Intronic
1103914500 12:124369486-124369508 CAGGGCCTCCCGGGAAGGGCTGG - Intronic
1103981681 12:124740937-124740959 CGGGATCAACTGGGAAGCGCTGG - Intergenic
1104588856 12:130068540-130068562 CGGGGGCTTCTGGGGAGCTCGGG - Intergenic
1104714874 12:131009964-131009986 CGGGGGCTCCTGGCATGGGCAGG + Intronic
1105378103 13:19863328-19863350 CGGGGCCTCGAGGGCAGCTCGGG - Intronic
1105389155 13:19959037-19959059 CGGGGCCTCGGGGGCAGCTCGGG + Intronic
1106187867 13:27424837-27424859 ATGAACCTCCTGGGAAGCGCGGG - Exonic
1107372853 13:39771428-39771450 CGGGTCTCCCTGGGGAGCGCTGG - Intronic
1112795150 13:103048680-103048702 TGGGGCCTGATGGGAAACGCTGG + Intronic
1113173163 13:107529610-107529632 CGGGGCCATCTTGGAAGAGCTGG - Intronic
1113254769 13:108495451-108495473 CGCGGTCTCCTGGAACGCGCGGG + Intergenic
1113592090 13:111508232-111508254 GGGGGCCTCCGGGCAAGTGCTGG - Intergenic
1113891988 13:113740959-113740981 CGGTCTCTCCTGGGAAGCCCTGG - Intergenic
1114613211 14:24055364-24055386 AGGGCACTCCTGGGAAGGGCTGG - Intronic
1115753009 14:36508749-36508771 CGGGGCCTTCAGGGAAGCCCAGG - Intronic
1117846730 14:59919935-59919957 CTGGGGCTCCTGGGAAACGGCGG - Intronic
1119322531 14:73740286-73740308 CGGGGCATCCTGGGAGGCTGTGG - Intronic
1119781699 14:77280270-77280292 AGGGGCCTCCTGGGATGGGTTGG - Intronic
1120949289 14:90026297-90026319 TGTGGCCTCCTGGGAAACCCTGG - Intronic
1121180672 14:91926241-91926263 CTGGGGCTGCTGGGAAGCCCTGG + Intronic
1121332415 14:93057979-93058001 TGGGGCCGCCTGGGAAGATCGGG - Intronic
1121671599 14:95714378-95714400 CGGGGCCTCGAGGAAGGCGCGGG - Intergenic
1122055443 14:99095075-99095097 CTGGGCCGCCTGGGCAGGGCCGG - Intergenic
1122097603 14:99382983-99383005 AGGGCTCTCCTGGGATGCGCTGG + Intergenic
1122113313 14:99515975-99515997 AGGGGCCCTCTGGGAAGGGCAGG + Intronic
1122975466 14:105168960-105168982 CGGGGCCTCGGGGTCAGCGCGGG + Intergenic
1123476473 15:20595123-20595145 CTGGGCCTCCTGGGAATCTCTGG - Intergenic
1123641538 15:22405241-22405263 CTGGGCCTCCTGGGAATCTCTGG + Intergenic
1124115480 15:26838962-26838984 CCTGGCCTCCTCGGAAGGGCAGG - Intronic
1125874735 15:43133914-43133936 TGCGGCCTCCTGGGGGGCGCGGG - Exonic
1129058769 15:72843344-72843366 CGGGGCCTGTTGGGGAGCGGGGG - Intergenic
1129524259 15:76204071-76204093 CAAGGCCTTCTGGGAAGGGCAGG - Exonic
1130997598 15:88912571-88912593 GGAGGCCTCCTGGGAGGCGGAGG + Intronic
1131284223 15:91044007-91044029 CGGGAAGTCCTGGGCAGCGCAGG + Intergenic
1131934774 15:97491288-97491310 CGGGGCCTCTCGGGAAGTGGGGG + Intergenic
1132541980 16:514420-514442 CGGAACCTCCTGGGAACAGCAGG + Intronic
1132668919 16:1094846-1094868 CAGGGCCTCCTGGGCAGCCCGGG + Exonic
1132702520 16:1228190-1228212 CGGGGCCTCCTGGGCAGCCCTGG - Intronic
1132704756 16:1238990-1239012 CGGGGCTTCCTGAGAGGCGCCGG + Intergenic
1132705804 16:1242678-1242700 CGGGGCCTCCTGGGCAGCCCTGG + Intergenic
1133199209 16:4192235-4192257 CCGGGCCTCCTGGGTAGCCTCGG - Exonic
1134054673 16:11162226-11162248 TGGGGGCTCCTGGGAAGTGGGGG + Intronic
1134121308 16:11586760-11586782 TGGGGCCTCCTGGGATGCCAGGG - Intronic
1134614881 16:15643247-15643269 CGGGGCATGCTGGGAACCCCGGG + Exonic
1139504827 16:67393604-67393626 CGGGGCCTCGTGGGCGGGGCCGG - Intergenic
1140127334 16:72128984-72129006 CTGGGCCTCCAGGGATGCGGAGG - Intronic
1141618773 16:85225391-85225413 TGGGGCTTCCTGGGAAGAGCAGG + Intergenic
1141833393 16:86522381-86522403 CCTGTCCTCCTGGGAAGGGCTGG - Intergenic
1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG + Intergenic
1141989496 16:87602283-87602305 CGGGGGCCCCGGGGAAGCCCAGG + Intronic
1141989917 16:87603653-87603675 CGTGGCTTCCAGGGAAGCCCGGG - Intronic
1142108705 16:88319651-88319673 CGGGGCTTCCTAGGGAGGGCTGG - Intergenic
1142603997 17:1071699-1071721 CAGGGTCTCCTAGGAAGCGAAGG - Intronic
1143018313 17:3903655-3903677 GGGGGCCTCCTGGGGAGGGGCGG - Intronic
1143036915 17:4004750-4004772 CTGGGGCTCCTGGAAAGCGCCGG + Exonic
1143121204 17:4608113-4608135 TGGGGCCTCCTGGGAAGAACAGG - Exonic
1143445338 17:7005957-7005979 CGGGGCCTGCTGGGACTCCCAGG + Exonic
1143713923 17:8753618-8753640 CGGGGCCTCCTGAGGAAGGCAGG - Intronic
1144522624 17:15963995-15964017 CAGGGCCTCCTGGGAAGACTCGG + Intronic
1145276836 17:21436691-21436713 CGGGGCCTCCTGGGGAGATGGGG + Intergenic
1145908463 17:28529033-28529055 AGGGCCCTCCTGGGAAAGGCTGG + Intronic
1147562175 17:41516041-41516063 CGGGGCCTCCTCGGAGACTCAGG + Intronic
1147657385 17:42098536-42098558 CGGGGCCTCGAGGGAGGGGCCGG - Intergenic
1149862305 17:60128829-60128851 CGGGGCCTCCTTGACAGAGCAGG + Intergenic
1152241944 17:79165493-79165515 CGGGGGCCCCTGGGCAGAGCTGG + Intronic
1152245452 17:79182768-79182790 CCGGGCCTCCGGGGAGGCGGGGG - Intronic
1152471099 17:80490473-80490495 CGGGGCCTCCATGGATGCTCGGG + Intergenic
1152612474 17:81322572-81322594 CGGGCGCCCCTGAGAAGCGCAGG - Intronic
1160531670 18:79568744-79568766 CGCAGCCACCTTGGAAGCGCTGG + Intergenic
1160823340 19:1068157-1068179 CGGGGCCTGCGGGGAGGCGCGGG - Intronic
1160838703 19:1136826-1136848 CGGGGGCTTCTGGGAAGCTCAGG - Intronic
1160894141 19:1394943-1394965 CGGGTCCTCGTGGGATGCCCGGG + Intronic
1160915721 19:1495652-1495674 TGGGGATTCCTGGGAGGCGCTGG + Intronic
1160989680 19:1855430-1855452 CGGGGTCTCCCGGGAAGGGGCGG + Intronic
1161587407 19:5113182-5113204 AGGGGGCTCCTGGGAGGAGCAGG - Intronic
1161590282 19:5126396-5126418 CGGGGCCTCCCCGGAGGCTCAGG - Intronic
1161590677 19:5127858-5127880 CGGGGCCTCCTGGGAGCTGAGGG - Intronic
1161701991 19:5800685-5800707 AGTGGCCTCCTGGGGAGGGCAGG + Intergenic
1162003513 19:7763300-7763322 CTGGGCCTCCTGGGTAAGGCTGG + Exonic
1162465114 19:10835193-10835215 TGAGGCCGCCTGGGAAGGGCAGG + Intronic
1163668193 19:18612837-18612859 CGAGGCAGCCTGGGAAGCGGGGG - Exonic
1163770272 19:19186864-19186886 TGGGGCCTGCTGGGAGGAGCAGG - Intronic
1164406913 19:27957375-27957397 CAGGGCCTCCTGGGAGGTGTTGG - Intergenic
1164537013 19:29093365-29093387 CGGGGCCTCCTGGTCAGTTCAGG - Intergenic
1164609196 19:29620893-29620915 AGGGGCCTCCGCAGAAGCGCGGG - Intergenic
1164977105 19:32581441-32581463 CGAGGCCGCCAGGGCAGCGCAGG - Intronic
1165394855 19:35558544-35558566 GGGGGCCTCCAGGGAATCCCGGG - Intronic
1166726660 19:45032556-45032578 CAGGGCCTCCTGGGAAGGTCGGG + Exonic
1166783594 19:45354729-45354751 CGTGGCCTCCTGGTATGAGCAGG - Exonic
1167517187 19:49930148-49930170 CGGGGCCTCTGGGGAATCGGGGG + Intronic
1167838685 19:52095954-52095976 CGGGGCCTCCAGGGGTGGGCGGG + Intergenic
1168686841 19:58354031-58354053 CGGGTAGGCCTGGGAAGCGCAGG - Intergenic
925764558 2:7218639-7218661 TGGGGACTGCTGGGAAGCGTGGG - Intergenic
928201440 2:29250042-29250064 CTGGGCCTCCTGGGAAGGAGAGG - Intronic
929575076 2:43046402-43046424 CGGGGCTTCCAGGGCAGGGCTGG - Intergenic
930688155 2:54330929-54330951 AGGAGCCTCCTGGGAAGAACAGG - Exonic
932892482 2:75609046-75609068 CTGGGGCTCCTGGGACGAGCTGG + Intergenic
933666728 2:84970885-84970907 CGCGGCCTGCTGGCTAGCGCGGG + Intergenic
935763488 2:106342780-106342802 CGGGGACGCCTGGGAGGCTCTGG - Intergenic
937859428 2:126696414-126696436 TGGGGCCCCCTGGGCAGTGCAGG + Exonic
941670981 2:168292074-168292096 CGGGGCCTGTTGGGAAGAGGGGG - Intergenic
941801522 2:169665006-169665028 GAGGGACTCCTGGGAAGAGCTGG + Intronic
948492342 2:238321152-238321174 CGGAGCCTCCTTGTAAGCGGCGG - Intronic
948763265 2:240205559-240205581 CTGGTCCTCCTGGGAGGGGCGGG - Intergenic
1169214833 20:3786797-3786819 CGGGATCTCGCGGGAAGCGCGGG + Intronic
1173959168 20:47057904-47057926 CAGGCCCTCCTGGGAAGGGGTGG - Intronic
1175107528 20:56625871-56625893 CGGGCCCTCCTCGGAAGCTTGGG + Intergenic
1175174827 20:57104825-57104847 TGGGGCCTCTTGGCAAGTGCAGG - Intergenic
1175826981 20:61941800-61941822 CCGGGCCTCCTGGGATGGCCAGG + Intergenic
1175911604 20:62407700-62407722 CGGGCCCTTCCGGGAAGCGGTGG - Intergenic
1175952609 20:62591362-62591384 CGGGGGCTGGGGGGAAGCGCTGG + Intergenic
1176260669 20:64177881-64177903 GGGGGCATCCTGGAAAGCCCAGG - Intronic
1176389865 21:6157951-6157973 CGGGGCCTTCTGGAAGGCGGTGG - Intergenic
1176653820 21:9572497-9572519 AGGGGCTTCCTGGGAAGAGAGGG + Intergenic
1177602808 21:23336958-23336980 CGGGGCCTGGTGGGAGGCGATGG + Intergenic
1178466381 21:32852268-32852290 CGGAGCCTCTTGAGAAGCCCTGG - Intergenic
1179092784 21:38282927-38282949 CGGGGCCTCGAGGGATGCGTAGG + Intronic
1179225074 21:39445794-39445816 CGGGGCCTCCTGGGAAGCGCCGG + Intronic
1179610081 21:42544670-42544692 AGGGGCCTCCTGGGATGGGTGGG + Intronic
1179674923 21:42974785-42974807 CGGGCCCTCGAGGGCAGCGCCGG - Intronic
1179733602 21:43380289-43380311 CGGGGCCTTCTGGAAGGCGGTGG + Intergenic
1179958118 21:44752270-44752292 AGAGGCCTCCTGGGCAGAGCTGG - Intergenic
1179985563 21:44918838-44918860 CAGGGCCTCCTGGCAGGGGCTGG - Intronic
1180086600 21:45510475-45510497 GGGGGCCTCATGGGATGCCCTGG - Intronic
1180118429 21:45727474-45727496 CAGGGCCACATGGGAAGCACCGG + Intronic
1180144883 21:45913496-45913518 GGGCCCCTCCTGGGATGCGCAGG - Intronic
1180695693 22:17750199-17750221 CGGCCGCTCCTGGGAAGCCCTGG + Intronic
1180954054 22:19733565-19733587 CTGGGCGGCCTGGGAAGGGCAGG - Intergenic
1181441308 22:22936532-22936554 CAGGGCCTCTTGGGCAGTGCAGG + Intergenic
1184119067 22:42438524-42438546 CGCCGCGTCCTGGGAAGGGCAGG + Intergenic
1185333542 22:50261852-50261874 CGGAGCCTGGGGGGAAGCGCAGG + Intergenic
951362640 3:21742669-21742691 CAGGGCCTCCTGGCAGGAGCAGG - Intronic
952860947 3:37811767-37811789 CTGGGCCTCCTGGGAAGACATGG - Intronic
954430065 3:50465953-50465975 CCGGGCCTCCTGGGGAGTGGGGG - Intronic
960970325 3:123134831-123134853 CCGGGCCTCCTGGGCAGGACAGG + Intronic
961208549 3:125107592-125107614 CGCTGCCTCCTGGGAGGGGCAGG - Exonic
961362409 3:126376177-126376199 AGTGGCCTCCTGGGAAGCAGAGG + Intergenic
961393547 3:126570633-126570655 CAGGGCCTCCTGGAAGGGGCTGG + Intergenic
962416934 3:135191858-135191880 TGGGGGCTGCTGGGAAGAGCTGG - Intronic
963941238 3:151098086-151098108 CGGGGCATCCAGGGGAGAGCTGG + Intronic
964358582 3:155871351-155871373 CGGGGCCTCCTGTGCGGCGTTGG + Intronic
966767851 3:183478802-183478824 CGGGCCCTGCAGGGAAGCGTAGG - Intergenic
968230608 3:197002936-197002958 CGGGGCCTCCTGGGACGGCCTGG + Exonic
968623004 4:1612386-1612408 CAGGGCCTCCCGAGAAGCCCAGG + Intergenic
968644795 4:1735089-1735111 AGGCGCCTCCTGGGCACCGCAGG - Intronic
968649551 4:1755073-1755095 GGGTGCCTCCTGGGCAGCTCTGG + Intergenic
968690745 4:1988556-1988578 CGGAGCCTCCCGGACAGCGCTGG + Intronic
968808021 4:2787742-2787764 CAGGCCCTCCTGGGGAGTGCTGG + Intergenic
969291913 4:6245537-6245559 AGGGGCTTCCTGCGCAGCGCGGG + Intergenic
971200885 4:24508191-24508213 CTGCTCCTCCTGGGAAGCCCAGG + Intergenic
971679549 4:29678880-29678902 CGGGGCCTGTTGGGGGGCGCGGG + Intergenic
972863645 4:43203021-43203043 TGGGGGCTGCTGGGAAGGGCAGG + Intergenic
973600493 4:52537982-52538004 CCAGGCCTCCTGGGAATCGAGGG - Intergenic
976032468 4:80772716-80772738 CGGGGCCTTTTGGGAGGCGGAGG - Intronic
981569537 4:146136997-146137019 AGGAGCCTCCTGGGAAGAACTGG - Intergenic
983649845 4:170026683-170026705 CAGGGCCTCCGCGGCAGCGCGGG + Intronic
984898614 4:184564315-184564337 GGGGAGCTCCTTGGAAGCGCAGG + Intergenic
985289754 4:188375692-188375714 CGGGGCCTTTTGGGATGCGACGG + Intergenic
988968804 5:36445587-36445609 GGGGGCCTCCTGGGAGGTGACGG - Intergenic
990186144 5:53212146-53212168 AGGGGCCTCCTGGGAGGGTCTGG - Intergenic
990968985 5:61482336-61482358 CGGGGCCTGTTGGGGAGCGTGGG + Intronic
992098292 5:73381983-73382005 CCGGGCCTGCTGGGAGGCGTGGG + Intergenic
992195471 5:74334981-74335003 CAGGGCCACGTGGGAAGCACCGG + Intergenic
995462552 5:112419248-112419270 GGGAGCCGCCGGGGAAGCGCCGG + Exonic
999410758 5:151347652-151347674 CGAGGACTCCTGGGAAGAGGAGG + Intergenic
1001422693 5:171599545-171599567 CAGGGCCCCCTGGGAGGCCCAGG + Intergenic
1002282983 5:178144020-178144042 CGGGGCCTCCTGCCAAGAGGCGG - Exonic
1002455503 5:179343997-179344019 CGTTGCCTCCGGGGAAGCTCGGG + Exonic
1002525902 5:179816087-179816109 CGGGCCCTGCTGGGAAGCATTGG + Intronic
1003120932 6:3318571-3318593 CAGGGCCTCCTGGGAAGCACTGG - Intronic
1003256849 6:4482571-4482593 CGGGGACTCCTGGGAGACGGTGG + Intergenic
1003409705 6:5851495-5851517 GGGGAGCACCTGGGAAGCGCTGG + Intergenic
1006116151 6:31777116-31777138 CTGGGTCTCCTGGGCAGGGCTGG + Exonic
1007409734 6:41654703-41654725 CTGGGCCTCCAGTGAAGCCCAGG - Intergenic
1007738103 6:43994412-43994434 CTGATCCTCCTGGGAAGGGCAGG + Intergenic
1010399546 6:75432834-75432856 CGGGGCCTGTTGGGAAGTGGGGG - Intronic
1012401914 6:98848228-98848250 CAGGGCCTCCTGGGCTGTGCTGG + Intergenic
1015565622 6:134567577-134567599 AAGGGTCTCCTGGGAAGAGCAGG - Intergenic
1017324748 6:153131539-153131561 CCGGGCCTCCCGCGAAGCTCCGG - Intergenic
1018799940 6:167214210-167214232 CTGGGCCACCTGGGAAGAGGAGG - Intergenic
1018813063 6:167311676-167311698 CTGGGCCACCTGGGAAGAGGAGG + Intronic
1018860406 6:167707087-167707109 CGGGGCCACATGGGAAGGCCGGG - Intergenic
1019179199 6:170176406-170176428 CGGGGGCGCCTGGGAAGGACGGG + Intergenic
1019268072 7:130036-130058 CGGGGCAGCCGGGGAAGCGGAGG - Intergenic
1019325781 7:437595-437617 CGAGGCCTCCTGGAAATGGCTGG - Intergenic
1019373145 7:674036-674058 AGGGCCCTCCTGGGAAACCCAGG + Intronic
1019473853 7:1234916-1234938 CGCGCCCTCCTGGGGAGGGCAGG + Intronic
1019608657 7:1923736-1923758 CTGGGTCACCTGGGAAGTGCTGG + Intronic
1019917107 7:4140594-4140616 CAGGGTATCCTGGGAAGAGCTGG + Intronic
1021845383 7:24757718-24757740 CGGGGCCTCTCGGGAAGAGTGGG + Exonic
1023875703 7:44285162-44285184 CGGGGCCTCCTGGTGGGCACCGG - Intronic
1025280164 7:57621163-57621185 AGGGGCTTCCTGGGAAGAGAGGG + Intergenic
1025286541 7:57667045-57667067 CGGGACCTTCTGAGAAGCTCTGG + Intergenic
1025304569 7:57844338-57844360 AGGGGCTTCCTGGGAAGAGAGGG - Intergenic
1025858800 7:65307374-65307396 AGGGGCTTCCTGGGAAGGGCAGG + Intergenic
1025990902 7:66496050-66496072 GAGAGCCACCTGGGAAGCGCAGG + Intergenic
1025999431 7:66549640-66549662 GGGGGCCTCCTGGGTAGCAGAGG + Intergenic
1026449445 7:70514592-70514614 CGGGGCCTAGTGGGAGGTGCTGG - Intronic
1026539478 7:71267863-71267885 TGGGGCCTGCTGGGAAGTGGGGG - Intronic
1027266317 7:76496986-76497008 CGGGGTCTCCTGGGTGGGGCTGG - Intronic
1027317697 7:76995104-76995126 CGGGGTCTCCTGGGTGGGGCTGG - Intergenic
1032165363 7:129540709-129540731 CGGGCCCTCCTGGGATGAGCAGG + Intergenic
1034900192 7:154903499-154903521 TGGGGCCACCTGGGCAGCCCAGG + Intergenic
1035161066 7:156950149-156950171 CGCGGCTTCCTGGGAGGCGAGGG - Exonic
1035752023 8:2002812-2002834 TGGGGCCGCCGGGGAGGCGCAGG - Exonic
1036655057 8:10672522-10672544 CGGCCCCTCCTGCGATGCGCTGG - Intronic
1036754941 8:11465892-11465914 TGGGACCTCCTGGGAAGATCTGG - Intronic
1037386104 8:18343843-18343865 TGGGGCCTAGTGGGAAGCACTGG + Intergenic
1037769077 8:21788511-21788533 AGGCCCCTCCTGGGAAGCGCAGG - Exonic
1039718636 8:40138372-40138394 CGGGGCCTGCTGGGAGGTGGGGG - Intergenic
1039984577 8:42436728-42436750 CTGGGCTTCCAGGGAAGGGCTGG - Intronic
1040471549 8:47738619-47738641 GGGGGCGTCCTTGGACGCGCGGG - Exonic
1040829336 8:51660383-51660405 TGGGGCCTCCTGGTAATCCCTGG + Intronic
1042919868 8:73910363-73910385 CGGGGGTTCCTTGGAAGCACCGG + Intergenic
1043823938 8:84902193-84902215 CGGGGCCTCCTCGGAAGCTGAGG - Intronic
1044961601 8:97536562-97536584 CGGGGCCTGTTGGGAAGTGGGGG + Intergenic
1049062467 8:140286741-140286763 AGGGGCCAGCTGGGAAGGGCTGG + Intronic
1049105349 8:140609110-140609132 CGTGGCCCCCAGGGAAGGGCTGG - Intronic
1049191415 8:141289863-141289885 CGGGGCCTCCAGGGCAGAGTTGG - Intronic
1049704618 8:144035478-144035500 CGGGGACTCCCAGGAGGCGCTGG - Intronic
1056580807 9:87887118-87887140 CTGGGCCTCCTGGGTATCTCGGG + Exonic
1056820168 9:89835847-89835869 CGGGGCCTCCAGGACAGCTCAGG - Intergenic
1056826635 9:89880411-89880433 TGGGGCCCCCTGGGAAGTCCTGG + Intergenic
1057361080 9:94374485-94374507 CGGGGCCTCCTGCCCGGCGCCGG + Intergenic
1059251663 9:112891712-112891734 CGAGGCCACCTGGGAAGTGGAGG - Intergenic
1060599524 9:124868909-124868931 CAGGGGCTCCTCGGAGGCGCGGG + Exonic
1060743854 9:126117070-126117092 CGGGCCCTCCTGGGGAGCAGGGG + Intergenic
1061022193 9:128023113-128023135 TGTGGCCTCCTGGGCAGCCCTGG - Intergenic
1061420357 9:130470178-130470200 CTGGGCCTCCTGGGCAGAGGTGG + Intronic
1061497410 9:130982870-130982892 CGTGCCCTCCTGGGCAGCGCAGG - Intergenic
1061573453 9:131491793-131491815 CAGGGCCTCCTGGGGAGCTGGGG - Intronic
1061613272 9:131762669-131762691 GGGTGGCTCCTGGGAGGCGCCGG - Intergenic
1061875123 9:133539757-133539779 CGGACACTCCTGGGAAGCGAAGG - Exonic
1061972906 9:134054367-134054389 CGTGCCCTCCTGGGACACGCAGG - Intronic
1062109310 9:134773297-134773319 CGGGGCCTGCTGGGCTGCGAGGG + Intronic
1062266896 9:135690660-135690682 CGGGGGCTCCTTGGAAGAGGAGG - Intergenic
1062309648 9:135928998-135929020 AGGGGCTGCCTGGGAGGCGCGGG + Intergenic
1062689695 9:137834880-137834902 CTGGGCCTCCTGGGCCGCGCTGG - Exonic
1203631541 Un_KI270750v1:75949-75971 AGGGGCTTCCTGGGAAGAGAGGG + Intergenic
1185507068 X:639365-639387 CTCGGCCTCCTCGGAAGCCCTGG - Intronic
1185920503 X:4086835-4086857 TGGGGCCTCATGGGAATTGCAGG + Intergenic
1189293784 X:39904560-39904582 CGGGGGCACCTGGGGAGAGCTGG - Intergenic
1200012445 X:153128896-153128918 TCGGGCTTCCTGGGAAGCACAGG - Intergenic
1200027154 X:153271023-153271045 TCGGGCTTCCTGGGAAGCACAGG + Intergenic
1200216220 X:154369315-154369337 GGGGGCCTGATGGGAAGCCCTGG - Intronic