ID: 1179225075

View in Genome Browser
Species Human (GRCh38)
Location 21:39445799-39445821
Sequence GCAGGCCGGCGCTTCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225075_1179225088 22 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225088 21:39445844-39445866 CACTCGGGCAGCAGGAGCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 204
1179225075_1179225089 25 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225089 21:39445847-39445869 TCGGGCAGCAGGAGCCGCGGCGG 0: 1
1: 0
2: 1
3: 29
4: 238
1179225075_1179225092 30 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225092 21:39445852-39445874 CAGCAGGAGCCGCGGCGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 449
1179225075_1179225091 27 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225091 21:39445849-39445871 GGGCAGCAGGAGCCGCGGCGGGG 0: 1
1: 0
2: 8
3: 71
4: 556
1179225075_1179225090 26 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225090 21:39445848-39445870 CGGGCAGCAGGAGCCGCGGCGGG 0: 1
1: 1
2: 5
3: 56
4: 420
1179225075_1179225085 6 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225075_1179225086 7 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225075_1179225087 14 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225087 21:39445836-39445858 CGCATGCGCACTCGGGCAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225075 Original CRISPR GCAGGCCGGCGCTTCCCAGG AGG (reversed) Intronic
900539572 1:3196118-3196140 GCAGCCAGGCTCTTGCCAGGTGG + Intronic
900568948 1:3348960-3348982 CCAGGCCAGCGCTGCCCCGGTGG - Intronic
900709281 1:4102522-4102544 GCAGGCCGGCTCTTTCTAAGGGG - Intergenic
905169203 1:36099418-36099440 CGAGGCCCGGGCTTCCCAGGGGG + Exonic
905562998 1:38941880-38941902 GCAGGCCGGCCCAGCCCAGCTGG - Intergenic
907569929 1:55473764-55473786 GCATGCCAGCTCTTCACAGGAGG + Intergenic
908423392 1:63981391-63981413 GAAGGCTGAAGCTTCCCAGGTGG + Intronic
910870705 1:91830380-91830402 GCAGGCAGTCGATTTCCAGGGGG + Intronic
915038102 1:152945406-152945428 GGAGTCCAGCCCTTCCCAGGAGG - Intergenic
915601217 1:156924306-156924328 GCAGGCCGGCGCCTCCCCTCTGG + Intronic
919082732 1:192886474-192886496 GGTGGCAGGCGCTTCCAAGGTGG + Intergenic
922025176 1:221742854-221742876 GGAGGCGGACGCTTCCCGGGCGG - Intergenic
922570930 1:226634329-226634351 CCAGGCTGGTGCTTCCTAGGGGG + Exonic
922573046 1:226644967-226644989 GCAGCCCAGCCCTTCCCAAGGGG - Intronic
922743312 1:228029041-228029063 GAAGGCCGGCGTTCCCCAGGTGG - Intronic
922763289 1:228145323-228145345 GCATGCCGGCCCTTCCAACGTGG + Intronic
922811149 1:228416407-228416429 GCCGGCCGCCGCGTCCCTGGAGG - Intronic
924957665 1:248944884-248944906 GCACGCCGGCGCCTCCCCGGAGG - Intergenic
1064976855 10:21126021-21126043 GCTGGCCAACGCTTGCCAGGTGG - Exonic
1065025290 10:21534820-21534842 GCAGGCCGGCGCGCCCCGGCGGG - Intronic
1067572833 10:47384384-47384406 GAAGGCTGGAGCTTCCCTGGGGG - Intergenic
1068845159 10:61663225-61663247 GCAGCCCGGCGCCCCCCAGCCGG + Intronic
1069677384 10:70258206-70258228 GCAGGCCACCCCTTCACAGGAGG + Intronic
1072916653 10:99540953-99540975 GCCGGCCGCTGCTTCCCAGGCGG + Intergenic
1073074594 10:100815848-100815870 GCTGGGCTGCCCTTCCCAGGAGG + Intronic
1073110631 10:101061339-101061361 GCGGGCTGGCGCCTCCCCGGCGG - Intergenic
1074184860 10:111092374-111092396 GGAGGCAGGCTCTTCCCTGGCGG - Intergenic
1075105511 10:119537673-119537695 GGAGGCCAGGGGTTCCCAGGTGG + Intronic
1076963509 10:133786402-133786424 GCACGCCGGCGCCTCCCCGGAGG - Intergenic
1078060005 11:8037145-8037167 GCATGCCGGCACCTGCCAGGTGG - Intronic
1078210433 11:9265469-9265491 GCCGGCCGCAGCTTCCCGGGAGG + Intergenic
1083367040 11:62147639-62147661 GCTGCCCGGTGTTTCCCAGGAGG - Intronic
1090934782 11:131331750-131331772 CCAGGCAGGCACTTCACAGGAGG - Intergenic
1096686362 12:53290909-53290931 GGAGCCCGGCCCTGCCCAGGAGG + Exonic
1098692355 12:73504190-73504212 GCAGGGGGGCGGTTCCAAGGTGG - Intergenic
1103457037 12:121076095-121076117 TCAGGCGGGCGGTTGCCAGGCGG - Intergenic
1112475860 13:99730375-99730397 GCAGCCCAGCACTGCCCAGGTGG + Intronic
1113505072 13:110811100-110811122 CCAGCCCAGCGCTTCCCAGCAGG - Intergenic
1113989943 13:114353242-114353264 GCACGCCGGCGCCTCCCCGGAGG - Intergenic
1117072185 14:52067887-52067909 GCAGGTAGGCGCTTACGAGGAGG - Exonic
1117743158 14:58839381-58839403 GCAGAACGGTGCTTGCCAGGGGG - Intergenic
1121640878 14:95484122-95484144 CAAGGCCAGCACTTCCCAGGTGG - Intergenic
1122940535 14:104979057-104979079 GCAGGGCGGCACTGCCCTGGGGG + Intergenic
1122986871 14:105216524-105216546 GCAGGCTGGTGCTTCTCAGCCGG - Intronic
1123224083 14:106883673-106883695 GCACGCCGGCGCATCCCCGGAGG - Intergenic
1202858269 14_GL000225v1_random:64556-64578 GCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1202859580 14_GL000225v1_random:72842-72864 GCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1124118534 15:26868316-26868338 GAAGGCCTTCGCTTCCGAGGTGG + Intronic
1124220503 15:27846587-27846609 GCAGGCAGGTCCTGCCCAGGTGG + Intronic
1131522503 15:93127000-93127022 CCAGGCCAGCATTTCCCAGGTGG + Intergenic
1131888620 15:96947912-96947934 GCGGGCCGGCGCGGGCCAGGCGG - Intergenic
1135509311 16:23068656-23068678 GAAGTCCTGCTCTTCCCAGGTGG + Exonic
1138592997 16:58012809-58012831 CCAGGCCGTGGCTTCCCTGGAGG - Intronic
1142243228 16:88956532-88956554 ACAGGTCGGGGCTTCCCAGCAGG + Intronic
1144522625 17:15964000-15964022 TCAGGCCGAGTCTTCCCAGGAGG - Intronic
1144826442 17:18108139-18108161 ACAGGCAGGCTCTGCCCAGGGGG + Intergenic
1145906929 17:28521446-28521468 GCAGGCCCGAGCTCTCCAGGAGG + Intronic
1147263695 17:39223093-39223115 GCTGGCCAGTGATTCCCAGGGGG + Intronic
1148787776 17:50153852-50153874 GCAGGGGGGCGGTTACCAGGAGG - Intergenic
1151382827 17:73737323-73737345 GCAGGGCTGTGCTTCCCTGGAGG + Intergenic
1151596224 17:75079413-75079435 GCAGGCCTGTGCTTTCAAGGAGG + Intergenic
1152929550 17:83102889-83102911 GCAGGTGGGTGCTTCCCAGGGGG + Intergenic
1156733870 18:40229228-40229250 GCAGACTGGCGATTGCCAGGGGG - Intergenic
1157493181 18:48137930-48137952 GCTGGCCAGAGCCTCCCAGGTGG - Intronic
1160170279 18:76547509-76547531 GCAGGCCAGAGCTTCACAGCTGG - Intergenic
1160317088 18:77858484-77858506 GGAGGCAGGCACTTACCAGGTGG + Intergenic
1160537947 18:79604902-79604924 GCTGAACAGCGCTTCCCAGGGGG + Intergenic
1160633346 18:80262629-80262651 GCACGCCGGCGCGTCCCCAGAGG - Intergenic
1160873527 19:1287242-1287264 GCAGGCTGCAGCTTCCCTGGGGG + Intronic
1160980760 19:1815583-1815605 GCAGGCCCGCTCTTCCCGGTGGG + Exonic
1161397777 19:4053936-4053958 GCAGGACGGCGCCTCCCCCGCGG + Intronic
1162378876 19:10320702-10320724 GCAGGCGGGCGCTGCTGAGGGGG + Exonic
1162465116 19:10835198-10835220 ACAGCCCTGCCCTTCCCAGGCGG - Intronic
1166325951 19:42051326-42051348 GCAGGCTGGCGCTGCCCCTGGGG - Intronic
1166529362 19:43533497-43533519 GCAGGACGGCCCCTCCCCGGGGG - Exonic
1167308220 19:48720932-48720954 GCAGGCGCGAGCTCCCCAGGGGG + Exonic
1168689796 19:58369383-58369405 GGAGGTTGGCGGTTCCCAGGAGG + Intronic
1168728644 19:58606856-58606878 GCACGCCGGCGCCTCCCCGGAGG - Intergenic
926901200 2:17753736-17753758 GCCGGCACGCGGTTCCCAGGGGG - Exonic
927500130 2:23577077-23577099 GCAGCCTGGAGCTTCACAGGCGG + Intronic
927964567 2:27261330-27261352 CCAGGCCAGAGCTTCCCTGGAGG + Intronic
931016101 2:57982471-57982493 GCAGGCAGGTGCTTGCCAGTGGG + Intronic
932752593 2:74380723-74380745 GGAGGCAGGCCCTGCCCAGGAGG + Intronic
934078954 2:88451864-88451886 GCTGGCAGGTGCTTCCCAGCCGG - Intronic
935641404 2:105294052-105294074 TCAGGCTGGCGCTTCCCACAGGG - Intronic
936569858 2:113603848-113603870 GTACGCCGGCGCCTCCCCGGAGG + Intergenic
937872978 2:126798974-126798996 TCCGGCCAGGGCTTCCCAGGGGG + Intergenic
945995108 2:216430010-216430032 GAAGGCAGGGGCTGCCCAGGGGG - Intronic
947122951 2:226836196-226836218 GGAGGTCGGCGCCTCCCGGGGGG + Intronic
949088903 2:242182493-242182515 GCACGCCGGCGCCTCCCCGGAGG - Intergenic
1168855004 20:1002179-1002201 CCGGGCTGGCGCTCCCCAGGCGG + Exonic
1168924382 20:1567184-1567206 GCAGGCCGGCAGTTCTCAGATGG + Intronic
1173248774 20:41353682-41353704 ACAGGCTGGCACTGCCCAGGAGG - Intronic
1174303689 20:49600393-49600415 GCAGACAGGCCCTTTCCAGGCGG + Intergenic
1174548693 20:51345469-51345491 GCAGGCAGGAGCCTCCGAGGAGG - Intergenic
1175643296 20:60649465-60649487 GCGGGCCGGGATTTCCCAGGCGG - Intergenic
1176382761 21:6121309-6121331 GCAGACCGGCGCGTCCCCGGTGG + Exonic
1177894835 21:26845756-26845778 GCTGGGCTGCGGTTCCCAGGAGG + Intergenic
1179067528 21:38040042-38040064 ACAGGCCTGTGATTCCCAGGAGG - Intronic
1179225075 21:39445799-39445821 GCAGGCCGGCGCTTCCCAGGAGG - Intronic
1179428853 21:41304612-41304634 GCAGGCCGGGGCAAGCCAGGAGG - Intronic
1179740708 21:43416930-43416952 GCAGACCGGCGCGTCCCCGGTGG - Exonic
1180014842 21:45075060-45075082 GCAGCGCGGCGCATCCCACGCGG - Intronic
1180264127 21:46698775-46698797 GCACGCCGGCGCCTCCCCGGAGG - Intergenic
1181315979 22:21971117-21971139 GCAGGGCGGCTCCTCCCTGGGGG - Intronic
1184200218 22:42963411-42963433 GCAGGGCAGCACTTCCCAGGGGG + Intronic
1185028618 22:48429853-48429875 CCTGGCCGGCCCTTCCCAGCTGG - Intergenic
1185385975 22:50531493-50531515 TCAGGTCGGGGGTTCCCAGGTGG + Intronic
1185430365 22:50807156-50807178 GCACGCCGGCACCTCCCCGGAGG - Intergenic
950004019 3:9679871-9679893 GCAGGCAGGCGCCTCCCAAGAGG + Intronic
950509784 3:13419484-13419506 GCAGGCCGGCGCTTCCCCTCAGG - Intronic
950868739 3:16211040-16211062 GGGGGCTGGGGCTTCCCAGGTGG - Intronic
954760486 3:52870392-52870414 TCTGGCCTGCGCTTCCCACGTGG + Intronic
960538084 3:118834930-118834952 GCAGGTAAGCTCTTCCCAGGAGG + Intergenic
961313413 3:126017925-126017947 GCAGGCCGCTGTTTCCCAGAGGG - Intronic
961659904 3:128463194-128463216 GCAGGCCAGCGCTTCCCCGGAGG - Exonic
964319558 3:155481086-155481108 GAAGGCCGGGGCATCCCAGAGGG - Exonic
967297653 3:187980866-187980888 CCAAGCCAGAGCTTCCCAGGAGG + Intergenic
968697515 4:2040483-2040505 GCGGCCCGGCGCGTCCCCGGAGG + Intronic
968728106 4:2257537-2257559 CTAGGCTGGAGCTTCCCAGGCGG + Intronic
977847567 4:101783488-101783510 GTAAGCCTGCTCTTCCCAGGAGG - Intronic
985073538 4:186191416-186191438 GCAGCCCGGCGCGCCCCAGCGGG - Intergenic
985466732 4:190203700-190203722 GCACGCCGGCGCCTCCCCGGAGG - Intergenic
985467693 5:12975-12997 GCACGCCGGCGCGTCCCCGGCGG + Intergenic
985688711 5:1295225-1295247 CCAGGACCGCGCTTCCCACGTGG - Intergenic
985897859 5:2759898-2759920 CCAGGCCGGGGCTCTCCAGGTGG + Intergenic
985923530 5:2998070-2998092 GCAGGTCAGCACTTCCCTGGTGG + Intergenic
999282493 5:150374701-150374723 GCAGGCCCTGTCTTCCCAGGGGG - Exonic
1003533596 6:6957128-6957150 GTGGGCAGGTGCTTCCCAGGTGG - Intergenic
1011700643 6:89951287-89951309 TCAAGCCGGGGCTTGCCAGGGGG - Exonic
1012908893 6:105097454-105097476 GCAGGTCAGCCCTTCCCAGCGGG - Exonic
1015122024 6:129710241-129710263 GCAGGCTGGCGATTCACACGGGG + Intergenic
1018934552 6:168265231-168265253 TCAGTCCAGCGCCTCCCAGGAGG - Intergenic
1019473855 7:1234921-1234943 GCAGTCCTGCCCTCCCCAGGAGG - Intronic
1019576223 7:1738979-1739001 ACAGGAGGGAGCTTCCCAGGCGG + Intronic
1021859424 7:24891491-24891513 TCAGGCCAGCACTTCCCATGAGG + Intronic
1023873637 7:44275753-44275775 GCATGCCTGCCCCTCCCAGGGGG - Intronic
1024233988 7:47384231-47384253 GCAGACAGGCCCGTCCCAGGGGG + Intronic
1026807361 7:73436567-73436589 GCAGGCTGGGGCTGCCCTGGTGG - Intergenic
1027432877 7:78132558-78132580 GCAGGCTTGCGCCTGCCAGGGGG + Intronic
1027795696 7:82691086-82691108 GCCGGCCGGCGGTTCCCAGCTGG - Intergenic
1032020372 7:128404432-128404454 GCAGGCCTGCACTTCCCTTGCGG - Intronic
1032384174 7:131510004-131510026 GCAGGCCACCGCTCCACAGGAGG - Intronic
1032683732 7:134210143-134210165 GCTGGCTGGTGGTTCCCAGGTGG - Intronic
1033243745 7:139701948-139701970 GCAGGCTGGGGCTACCCAGTAGG + Intronic
1034286322 7:149885432-149885454 GCGAGCTGGTGCTTCCCAGGAGG + Intergenic
1035172126 7:157022587-157022609 GCAGGCTGGCCATTCCCAGCAGG + Intergenic
1037403011 8:18512449-18512471 GCAGACTGGCGGTTGCCAGGGGG + Intergenic
1039469432 8:37804068-37804090 GCAGGCTGGCCCCTCCCTGGGGG - Intronic
1039482588 8:37885733-37885755 GCAGGCACGGGCTTCCCAGTGGG - Intronic
1039817874 8:41110854-41110876 GCAGGACTGGGCTTCCCAGGGGG - Intergenic
1040065602 8:43141308-43141330 CCAGCCCGGCCCCTCCCAGGCGG - Intronic
1040499974 8:47997392-47997414 CCAGGTAGGCTCTTCCCAGGGGG + Intergenic
1043532427 8:81165941-81165963 GCAAGCTGGAGCATCCCAGGTGG - Intergenic
1048445785 8:134492173-134492195 GCAGGGCAGCTCTTCCTAGGAGG - Intronic
1049603952 8:143520493-143520515 GCACCCCGGTGCTTCCCAGCCGG - Intronic
1049620355 8:143595589-143595611 ACAGGCTGGCGTTTCCCAGTGGG - Intronic
1049665659 8:143841412-143841434 GCAGGGCGGGGCCTCCGAGGGGG - Intergenic
1054808047 9:69412091-69412113 GCAGCCCCCCGCTCCCCAGGAGG - Intergenic
1055811442 9:80153523-80153545 GGAGGTCGGCACTTCTCAGGAGG - Intergenic
1057143048 9:92738999-92739021 CCAGGCCCGCCGTTCCCAGGAGG - Intronic
1057786873 9:98094475-98094497 GCAGGAAAGGGCTTCCCAGGTGG + Intronic
1061396048 9:130343763-130343785 GGAGGCCGGGGCAGCCCAGGCGG - Intronic
1061517524 9:131098250-131098272 GGAGGCCGGAGCTTACCTGGAGG - Intronic
1061574299 9:131496580-131496602 GCACCCCATCGCTTCCCAGGCGG - Exonic
1061726122 9:132582850-132582872 GCAGCCCCGCCCTTCCCAAGGGG + Exonic
1062689694 9:137834875-137834897 TCAGGCCAGCGCGGCCCAGGAGG + Exonic
1185754439 X:2642308-2642330 GCAGGGCTGCGCTACCCTGGAGG + Intergenic
1200777400 Y:7181634-7181656 GCAAGCTGTCTCTTCCCAGGTGG - Intergenic