ID: 1179225076

View in Genome Browser
Species Human (GRCh38)
Location 21:39445801-39445823
Sequence TCCTGGGAAGCGCCGGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 172}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225065_1179225076 3 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225063_1179225076 12 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225067_1179225076 2 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225060_1179225076 26 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225061_1179225076 20 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225069_1179225076 1 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225072_1179225076 -8 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1179225073_1179225076 -9 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG 0: 1
1: 0
2: 2
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225076 Original CRISPR TCCTGGGAAGCGCCGGCCTG CGG Intronic
900145219 1:1156300-1156322 TCCTGGGAACCAGCGGGCTGGGG - Intergenic
900205531 1:1430601-1430623 TCCTGGGAAGCTCTTGGCTGAGG + Intergenic
900215945 1:1481781-1481803 CCATGGGCAGGGCCGGCCTGTGG + Intronic
900223083 1:1519835-1519857 CCATGGGCAGGGCCGGCCTGTGG + Intronic
901081514 1:6586589-6586611 TGCTGGGAAGAGTCTGCCTGGGG - Intronic
901880542 1:12191390-12191412 TGCTGGGAAGAGCGGGACTGCGG + Intronic
903283330 1:22262671-22262693 TCCTGGGTAGCGCCTGCCTGCGG + Intergenic
903935209 1:26890598-26890620 TGCTTGGAAGAGCCGGCCTTGGG - Exonic
904413233 1:30337633-30337655 GGCTGGGAAGGGCTGGCCTGGGG - Intergenic
904928006 1:34063588-34063610 TCTTGGGCAGCTCCGGCCTGTGG + Intronic
905169199 1:36099416-36099438 CCCTGGGAAGCCCGGGCCTCGGG - Exonic
907697664 1:56749853-56749875 TCCTGGTTACTGCCGGCCTGTGG + Intronic
912715032 1:111977361-111977383 TCCTGGAAGGGGCCTGCCTGAGG - Intronic
912799156 1:112710537-112710559 TCCTGGGAACAGATGGCCTGTGG - Exonic
914490295 1:148147156-148147178 CCCTGGGAACCCCTGGCCTGAGG + Intronic
915357113 1:155261967-155261989 TCCTGGGAAGAGCCGCCACGTGG - Intronic
921390245 1:214608057-214608079 CCCTGGGAACCCCTGGCCTGAGG - Intronic
922471076 1:225877672-225877694 CCCTGGGAAACGCCTGCCTTTGG - Intronic
922537423 1:226391388-226391410 TCCTGGGAATATCAGGCCTGGGG - Intronic
922811150 1:228416409-228416431 TCCAGGGACGCGGCGGCCGGCGG + Intronic
1067091969 10:43271707-43271729 TCCTGGGAAGAGCTGGTCTGTGG - Intergenic
1067523979 10:47027458-47027480 TCCTGGGAAGCTGTGCCCTGGGG + Intergenic
1070623717 10:78033797-78033819 CCCCGGGAAGAGCCGGCGTGGGG - Exonic
1071526672 10:86363402-86363424 TGCAGAGAAGCGCCGGGCTGAGG + Intronic
1074981009 10:118619997-118620019 TCCTGGGAGCTGCTGGCCTGGGG - Intergenic
1075063303 10:119271986-119272008 TGCTGGGAAGAGCCTTCCTGCGG + Intronic
1075438333 10:122461179-122461201 TCCTGCAAATCGCCGGACTGGGG - Intergenic
1076479112 10:130772727-130772749 CACTGGGAAGAGCCAGCCTGGGG - Intergenic
1077078263 11:710919-710941 TCCTGGGAACTCGCGGCCTGGGG + Intronic
1077103071 11:830682-830704 ACCTGGAACGCGCGGGCCTGCGG + Exonic
1078210432 11:9265467-9265489 TCCCGGGAAGCTGCGGCCGGCGG - Intergenic
1078411182 11:11120113-11120135 TCATAGGAAGCACCAGCCTGAGG - Intergenic
1080551530 11:33376787-33376809 TCGTGGGACGCGCCGGCCCCGGG - Intergenic
1080615408 11:33941082-33941104 TCCCGGGGAGCTCAGGCCTGGGG + Intergenic
1083631715 11:64098764-64098786 CCCTGGGAAGAGCTGCCCTGTGG - Intronic
1083709811 11:64541053-64541075 TCCTGGGCATGGCCAGCCTGGGG + Intergenic
1084385211 11:68839426-68839448 GCCTGGGACGCGCCAGCCTGGGG - Intronic
1084571764 11:69964009-69964031 TCAAGGGAACCGACGGCCTGGGG - Intergenic
1084615586 11:70233801-70233823 TCCTGCGAAGCTCCAGCCTTGGG + Intergenic
1085927199 11:81036467-81036489 TTCTAGGAAGCGCAGCCCTGGGG - Intergenic
1086336984 11:85810523-85810545 TGTTGGGAAGGGCCGGCCAGGGG - Intronic
1090699453 11:129280290-129280312 CCCTGGGAACCCCCTGCCTGTGG + Intergenic
1091746849 12:2998349-2998371 CCTGGGGAAGCGCCGGGCTGTGG + Intronic
1092462534 12:8698519-8698541 TGCCGGGAGGCGCCGGCCCGTGG + Intronic
1092527737 12:9319463-9319485 TCATGGGAAGTGCTGGCCTGAGG - Intergenic
1092539521 12:9412290-9412312 TCATGGGAAGTGCTGGCCTGAGG + Intergenic
1092727297 12:11498719-11498741 TCATGGGAAGTGCTGGCCTGAGG + Intronic
1096500280 12:52060516-52060538 TCCTGGGAAGTGGCTGGCTGAGG + Intergenic
1098275126 12:68805162-68805184 TCCTGGGCAGCGCCAACCCGAGG - Intergenic
1101838553 12:108311812-108311834 TCATGGGAAGCCCCAGGCTGGGG + Intronic
1103322814 12:120101767-120101789 GCTTGGGAAGGGGCGGCCTGTGG - Intronic
1103409149 12:120698503-120698525 TCCTGGGGACCACCTGCCTGGGG + Exonic
1103698571 12:122835731-122835753 GCCCGGGAGGCGCCGGCCAGGGG + Intronic
1104439358 12:128782204-128782226 TCCAGGGAAGCCCAGGCTTGAGG + Intergenic
1104843414 12:131835105-131835127 TCCTGGGAGGGGCCGTCTTGGGG - Intronic
1107047233 13:36006570-36006592 TCCTGGGAAGCACTGGCCTCTGG - Intronic
1107958519 13:45540026-45540048 TCCTGGGAGGAGCTGGCATGTGG + Intronic
1113646299 13:111998910-111998932 GCCTGAGAAGTGCCAGCCTGAGG + Intergenic
1113794441 13:113049021-113049043 TCCTGGGTAGCAGGGGCCTGGGG - Intronic
1113900876 13:113797225-113797247 CCCTGGGAGGCCCCGGCCAGGGG - Intronic
1122076604 14:99238877-99238899 TCCTGGAATGGGCAGGCCTGAGG + Intronic
1122229292 14:100297564-100297586 TCCTGGGCTGCTCTGGCCTGGGG + Intronic
1123141973 14:106088615-106088637 ACCTGGGAATCCCGGGCCTGGGG + Intergenic
1124649673 15:31465472-31465494 TCCTGGGCAGTCCCTGCCTGGGG + Intergenic
1125676127 15:41503412-41503434 TCCTCAGAAGAGCTGGCCTGAGG - Exonic
1129219158 15:74121458-74121480 TCCTGGGAGGCGCTGCACTGAGG + Intronic
1129300466 15:74622603-74622625 TCCTGGGAAGAGCTGGCCTGAGG + Intronic
1129332885 15:74836808-74836830 TCCCGGGAAGGGCAGGCCAGGGG + Exonic
1131063136 15:89416705-89416727 GCCTGGGAAGCGCGGGGCTGAGG + Intergenic
1132997202 16:2829572-2829594 ACCTCGGAAGGACCGGCCTGGGG + Intergenic
1132997411 16:2830417-2830439 CCCTGGGATGCACCGGCCAGAGG + Exonic
1133247830 16:4461119-4461141 TCCTGGAAGGAGCCGGCCTTGGG - Intergenic
1134063550 16:11212926-11212948 TCCTGGCAAGCGCCTCCCAGGGG + Intergenic
1135941349 16:26824760-26824782 TCCTGGGGAGGGCCTGCCGGGGG + Intergenic
1137062129 16:35800397-35800419 TTCTGGGAAGCACAGCCCTGAGG - Intergenic
1139576828 16:67847161-67847183 TCCTGTGAGGCGGCGGCCGGGGG + Intronic
1142243227 16:88956530-88956552 TGCTGGGAAGCCCCGACCTGTGG - Intronic
1143036917 17:4004757-4004779 TCCTGGAAAGCGCCGGGACGCGG + Exonic
1143490797 17:7284236-7284258 TCCTGGGCACTGCCAGCCTGTGG + Exonic
1143562542 17:7704421-7704443 TCCTGCGCAGCGCCGGTTTGGGG + Intergenic
1145190887 17:20841759-20841781 CCCTGGGAACCCCTGGCCTGAGG + Intronic
1151014970 17:70543512-70543534 TCATGGGAAGCCCTGGCCTAGGG + Intergenic
1151675793 17:75596747-75596769 TCCTGGGAACAGCCGGCATTTGG - Intergenic
1151889564 17:76944097-76944119 GCCTGGGAACTGCTGGCCTGCGG - Intronic
1152032564 17:77853372-77853394 TCCTGGAAAGGGCCAGCCAGAGG - Intergenic
1152629354 17:81403150-81403172 TCCGAGGCAGCCCCGGCCTGGGG + Intronic
1152956890 18:47993-48015 GCCTGGGAAGCGCAGGCATGTGG + Exonic
1155392070 18:25349507-25349529 TCCTGGGAAGGGACGGGGTGGGG - Intronic
1157243889 18:46036768-46036790 TCCAGGGAAGAGCAGGGCTGGGG + Intronic
1160722471 19:603500-603522 CCCGGGGAGGCACCGGCCTGAGG + Intronic
1160995317 19:1879664-1879686 CCCTGGGAACCCCTGGCCTGAGG - Intronic
1161114316 19:2488361-2488383 GCCTGGGAACCGCCGGCGTCCGG - Intergenic
1161984593 19:7646629-7646651 TCCTGGGAAGGCCAGGGCTGGGG - Intronic
1162020137 19:7864557-7864579 CGCTGGGAAGCTCCTGCCTGGGG - Intronic
1165775007 19:38399192-38399214 TGCTGGGAAGTGGCGGCCAGGGG - Intergenic
1166853302 19:45770506-45770528 TCCTGGGCGGCGCCAGACTGCGG + Exonic
1167518535 19:49938126-49938148 TGCAGGGAGGCTCCGGCCTGGGG + Intronic
1168327143 19:55544241-55544263 TCCTGAGAAGCACCTTCCTGAGG - Exonic
926712386 2:15891666-15891688 CCCTGGGACCCGCAGGCCTGGGG + Intergenic
926977833 2:18532721-18532743 TCCTTGGAAGCACTGGCCTGAGG + Intergenic
930247966 2:49004102-49004124 TCCTTGGCAGGGCCTGCCTGGGG - Intronic
932391181 2:71391961-71391983 TTCTAGGAAGCGCAGCCCTGTGG - Intronic
935206800 2:100903221-100903243 TCCTTGGAAGCACAGGCTTGGGG + Intronic
936556901 2:113503891-113503913 AGCTGGGCTGCGCCGGCCTGGGG + Intergenic
947500751 2:230669057-230669079 TCCTGGGATGGGTGGGCCTGGGG - Intergenic
948727339 2:239943093-239943115 TCCAGGGATGCGTTGGCCTGTGG - Intronic
948865145 2:240771405-240771427 TGCTGGGGAGGGCAGGCCTGGGG - Intronic
1174629574 20:51944720-51944742 TCCTGAGAAGAGTAGGCCTGGGG + Intergenic
1176286631 21:5022281-5022303 CCCTGGGAAGCGCAGGGGTGGGG - Intergenic
1179225076 21:39445801-39445823 TCCTGGGAAGCGCCGGCCTGCGG + Intronic
1179870550 21:44241194-44241216 CCCTGGGAAGCGCAGGGGTGGGG + Intergenic
1180147395 21:45928981-45929003 TCCTGGGAAAGCCAGGCCTGAGG + Intronic
1181121392 22:20670204-20670226 CCCTGGGAACCCCTGGCCTGAGG - Intergenic
1182446887 22:30394956-30394978 ACCTGGGAAGGGCAGGCCTGGGG + Intronic
1183538432 22:38416288-38416310 GCCTGGGAAGCTCCAGCCTCAGG + Intergenic
1184219322 22:43089241-43089263 GCCCGGGAGGCGGCGGCCTGGGG + Intronic
1185271029 22:49929408-49929430 TCCTTGGAACCGCGGGGCTGGGG + Intergenic
954576320 3:51678295-51678317 TCCTGGCCAGCTCTGGCCTGTGG + Intronic
954708003 3:52491304-52491326 GGCTGGGGAGCGCCGGCCTGTGG + Intronic
959611573 3:108300714-108300736 TCCTGGGTAGAGCTGGCCAGAGG + Intronic
961349733 3:126292188-126292210 TCCAGGGAAGCACAGGGCTGGGG + Intergenic
961653063 3:128426799-128426821 GTCTGCGAAGAGCCGGCCTGGGG + Intergenic
961657978 3:128453755-128453777 TGCTGGGCAGCGCGGGGCTGGGG - Intergenic
963068618 3:141283430-141283452 TCCTGGGAAGCACCAGCATGTGG + Intronic
967184097 3:186930687-186930709 TCCTGGGCAGGGCCGGGCTGGGG + Exonic
968728104 4:2257535-2257557 GCCTGGGAAGCTCCAGCCTAGGG - Intronic
969442138 4:7223731-7223753 TCCTGGGAAGGGCTGGGCTTGGG + Intronic
969682341 4:8650172-8650194 TCCCGGGATGCGCGGGCCGGTGG - Intergenic
970823498 4:20247845-20247867 TCCTGGGAAGGGCTGGGCTGAGG - Intergenic
971015340 4:22483256-22483278 TCCTGGGAAGCACATGCCAGAGG - Intronic
973759567 4:54103813-54103835 GCCTGGGAAGCTCAGGCCTCTGG + Intronic
976277220 4:83289966-83289988 TCTTGGGCAGCCCCAGCCTGTGG - Intergenic
978803388 4:112776031-112776053 TTCTGAGAAGCGCCAGCCTAGGG + Intergenic
985013140 4:185604944-185604966 TGCTGGGATGAGCCGGCCTAGGG + Intronic
997717780 5:136054887-136054909 TCCTGGGAAGCTCCTTACTGTGG + Intronic
1001597004 5:172904920-172904942 TGCTGGGCAGGGACGGCCTGAGG - Intronic
1002164899 5:177338069-177338091 TCCTGGGTAGGGCTGTCCTGTGG - Intronic
1002633250 5:180594644-180594666 TCCTGGGAAGGCCCAGCCTCTGG - Intergenic
1005186127 6:23164739-23164761 TTCTAGGAAGCGCAGCCCTGGGG - Intergenic
1007395972 6:41578023-41578045 CCCTGGGGAGCTCAGGCCTGAGG - Exonic
1007902534 6:45423828-45423850 TGCTGGGAGGCGCGGGCCAGGGG + Intronic
1008050901 6:46899408-46899430 TCCTGGGAATACCCAGCCTGCGG + Intronic
1009985713 6:70779088-70779110 ACCTGAGAACCGCCTGCCTGGGG - Intronic
1011700646 6:89951289-89951311 CCCTGGCAAGCCCCGGCTTGAGG + Exonic
1018961759 6:168454511-168454533 TCCTGGGTAGGGCCAGACTGCGG + Intronic
1018996129 6:168711912-168711934 GCCAGGCAAGCGCCGGCCTCAGG - Intergenic
1019216927 6:170450003-170450025 TCGTGGTCAGGGCCGGCCTGCGG + Intergenic
1019216939 6:170450042-170450064 TCGTGGTCAGGGCCGGCCTGCGG + Intergenic
1019216951 6:170450081-170450103 TCGTGGTCAGGGCCGGCCTGCGG + Intergenic
1019217770 6:170454677-170454699 TTCTGGGAAGGGCAGGCCTTTGG + Intergenic
1019321067 7:415477-415499 TCCAGGGAAGCGGGGCCCTGTGG + Intergenic
1019492372 7:1321427-1321449 CCCTGGGGGGAGCCGGCCTGGGG + Intergenic
1019493134 7:1324354-1324376 CCCCGGGAAGCGCCTCCCTGGGG + Intergenic
1019664932 7:2247151-2247173 TCCTGAGCAGCACGGGCCTGGGG - Intronic
1023059278 7:36313102-36313124 GCCTTGGAAGAGCTGGCCTGTGG - Intergenic
1023841441 7:44100768-44100790 GCCTGAGAAGCACCGGACTGTGG + Intergenic
1025639532 7:63353758-63353780 TCCCAGCAAGCGCCGGGCTGCGG - Intergenic
1025643167 7:63394334-63394356 TCCCAGCAAGCGCCGGGCTGCGG + Intergenic
1029205928 7:98869511-98869533 TCCAGGGCAGGGCCAGCCTGGGG + Intronic
1029611171 7:101627400-101627422 CCCTGGGGAGCTCAGGCCTGTGG - Intronic
1031956463 7:127947568-127947590 TCTTGGGAAGCGCCACCTTGAGG - Intronic
1034161725 7:148998818-148998840 TCTTGGGAAGCCCAGGCTTGAGG - Intergenic
1034387051 7:150748748-150748770 TGCTGGGAAACGCAGGCATGTGG - Intronic
1034488866 7:151382269-151382291 GCTTGGGAAGCCCCTGCCTGGGG + Intronic
1035172125 7:157022585-157022607 TGCTGGGAATGGCCAGCCTGCGG - Intergenic
1035293820 7:157856466-157856488 GCCTCGGAGGCACCGGCCTGTGG - Intronic
1035489008 7:159255677-159255699 TCCTGGGAAGCAGCGGTCTTTGG + Intergenic
1035781046 8:2228776-2228798 TCCTGGGAAGCACGTGGCTGAGG - Intergenic
1044358735 8:91257033-91257055 TCATGGGAAGGGGCAGCCTGAGG - Intronic
1044754104 8:95444070-95444092 CCCTGGGGACCGCAGGCCTGCGG + Intergenic
1047175815 8:122539451-122539473 TGCTGGGCTGCGCCTGCCTGAGG - Intergenic
1049446921 8:142635454-142635476 CCCTGGGAGGAGCCAGCCTGGGG - Intergenic
1049729553 8:144168877-144168899 TCCTGGGCAGCCCCTCCCTGAGG - Intronic
1049788771 8:144463450-144463472 TCCTGTGTACCTCCGGCCTGTGG - Intronic
1049896099 9:113410-113432 AGCTGGGCTGCGCCGGCCTGGGG - Intergenic
1051268128 9:15328374-15328396 TCTTGGGCAGCTCCGCCCTGTGG + Intergenic
1055509930 9:76986150-76986172 TCCTTGGAAGTTCAGGCCTGGGG - Intergenic
1056963349 9:91145722-91145744 TCCTGAGAAAGGCAGGCCTGGGG + Intergenic
1057129482 9:92643043-92643065 TCCTGTGAAGGGCTGGCCTGGGG - Intronic
1057334758 9:94147112-94147134 TCCTGGGCATCGCCAGTCTGTGG - Intergenic
1057361082 9:94374492-94374514 TCCTGCCCGGCGCCGGCCTGTGG + Intergenic
1060052316 9:120386218-120386240 CCCAGGTGAGCGCCGGCCTGAGG + Intergenic
1061235628 9:129341259-129341281 TTCTGGGAGGTGCCGGCCTGAGG - Intergenic
1061306645 9:129736374-129736396 TGCTGGGGAGCGGCTGCCTGGGG - Intergenic
1061418036 9:130458597-130458619 ACCTGGGAAGGGCCGGGCAGAGG + Intronic
1061954208 9:133953217-133953239 TGCTGGAAGGCGCTGGCCTGTGG + Intronic
1062266895 9:135690653-135690675 TCCTTGGAAGAGGAGGCCTGAGG - Intergenic
1062468781 9:136692989-136693011 TCCTGGGAAGGAGCGGCCTTCGG + Intergenic
1062584483 9:137242928-137242950 GCCTGGGAAGCGCAGGCAGGTGG - Exonic
1062741273 9:138176639-138176661 GCCTGGGAAGCGCAGGCACGTGG - Intergenic
1190390679 X:49928559-49928581 TCCTTGGAAGCCCTGTCCTGTGG + Intronic
1196078252 X:111601468-111601490 TCCAAGGAAGCGGGGGCCTGTGG + Intergenic
1199972908 X:152873702-152873724 ACCTGGGGTGCGCTGGCCTGGGG - Intergenic