ID: 1179225078

View in Genome Browser
Species Human (GRCh38)
Location 21:39445802-39445824
Sequence CCTGGGAAGCGCCGGCCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 191}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225065_1179225078 4 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225072_1179225078 -7 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225061_1179225078 21 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225060_1179225078 27 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225069_1179225078 2 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225063_1179225078 13 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225073_1179225078 -8 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191
1179225067_1179225078 3 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225078 Original CRISPR CCTGGGAAGCGCCGGCCTGC GGG Intronic
900327960 1:2119679-2119701 CCATGTAAGCGCCGTCCTGCAGG - Intronic
901036986 1:6342168-6342190 CCTGGTAAGGGCCGGCTTCCTGG + Intronic
901306984 1:8239860-8239882 CCTGGGGAGCGACAGCCTGAAGG + Intergenic
901464785 1:9414028-9414050 TCTGGGAAGCGCTGGGCGGCTGG - Intergenic
901880543 1:12191391-12191413 GCTGGGAAGAGCGGGACTGCGGG + Intronic
903205912 1:21782647-21782669 CCTGGGAAACGCAGGCTTCCCGG - Intronic
904051130 1:27639545-27639567 CCTGGAAAACCCAGGCCTGCAGG + Intergenic
904413232 1:30337632-30337654 GCTGGGAAGGGCTGGCCTGGGGG - Intergenic
905169197 1:36099415-36099437 CCTGGGAAGCCCGGGCCTCGGGG - Exonic
910430164 1:87152164-87152186 CCTGGGAAGCAAAGGCCTGTCGG + Intronic
914915557 1:151817009-151817031 CCTGAGTAGCGCCTTCCTGCAGG - Intronic
914928518 1:151909382-151909404 CCCGGCAGGCGCCGGCCTACTGG + Exonic
915285643 1:154850354-154850376 CTTGGGCAGCCCAGGCCTGCTGG - Intronic
915511901 1:156391170-156391192 GCTGGCAAGCGCTGGGCTGCCGG + Intergenic
915682505 1:157595323-157595345 CCTGGGAAGCACCTGGATGCAGG + Intronic
917487116 1:175465557-175465579 CCTGGAAAGAGCCTGACTGCAGG - Intronic
920655206 1:207869179-207869201 CGTGGGAAGCGCGGGCGCGCGGG - Intergenic
921360637 1:214328483-214328505 CCTGGGAAGGGCTGGCCTGATGG + Intronic
923569128 1:235098692-235098714 CCAGGGAAGCGCCCACCTGCAGG + Intergenic
924786711 1:247206141-247206163 CCTGGGGAGCACCCCCCTGCAGG - Intergenic
1067091967 10:43271706-43271728 CCTGGGAAGAGCTGGTCTGTGGG - Intergenic
1067572838 10:47384387-47384409 CCAGGGAAGCTCCAGCCTTCGGG + Intergenic
1070623715 10:78033796-78033818 CCCGGGAAGAGCCGGCGTGGGGG - Exonic
1072810306 10:98456354-98456376 CCTAGGGACCGCCCGCCTGCTGG + Intergenic
1073135470 10:101217856-101217878 CCTGGGAACCGGTGGGCTGCAGG - Intergenic
1073623364 10:105072078-105072100 CCTGGGAAGTGCTGGCTGGCTGG + Intronic
1074184862 10:111092377-111092399 CCAGGGAAGAGCCTGCCTCCTGG + Intergenic
1074867328 10:117552525-117552547 TCTGGGACGCGCAGGCCGGCTGG + Intergenic
1075063304 10:119271987-119272009 GCTGGGAAGAGCCTTCCTGCGGG + Intronic
1075102993 10:119519119-119519141 CCTGGGCAGCGTCAGCCGGCTGG - Intronic
1075129539 10:119726225-119726247 CCAGGGAGGCGGCGGCCCGCGGG - Exonic
1076239001 10:128888131-128888153 CCTGGGAAGCCACAGCCTGAAGG + Intergenic
1077183834 11:1227806-1227828 CCTGGGCAGGGACGGCCTCCAGG + Intronic
1077257893 11:1597079-1597101 GCTGGGAAACGCCTGCCAGCAGG - Intergenic
1077319883 11:1936402-1936424 ACTGGGAAGCCCCCGGCTGCAGG - Intronic
1078060007 11:8037148-8037170 CCTGGCAGGTGCCGGCATGCAGG + Intronic
1078210430 11:9265466-9265488 CCCGGGAAGCTGCGGCCGGCGGG - Intergenic
1078987642 11:16610845-16610867 CCTGGTGCGCACCGGCCTGCGGG + Intronic
1079897711 11:26143095-26143117 CCAGGGAAGCTCCAGACTGCTGG - Intergenic
1084385209 11:68839425-68839447 CCTGGGACGCGCCAGCCTGGGGG - Intronic
1084804094 11:71566815-71566837 GCTGGGAAACGCCTGCCAGCAGG + Intronic
1089002082 11:115060301-115060323 TCTGAGAAGCCCCGTCCTGCTGG - Intergenic
1089005534 11:115087724-115087746 CCCGAGAAGCCCCAGCCTGCTGG - Intergenic
1092195723 12:6548600-6548622 ACTGGGGAGCTCCGGCCTCCTGG + Intronic
1102240647 12:111322558-111322580 CCTGGGAGGCACCAGGCTGCTGG - Exonic
1102597090 12:114001172-114001194 CCTGGGCAGGGCAGCCCTGCAGG - Intergenic
1103322813 12:120101766-120101788 CTTGGGAAGGGGCGGCCTGTGGG - Intronic
1103812128 12:123623546-123623568 CCTGGGAGGCGGAGGTCTGCAGG - Intronic
1104053028 12:125209125-125209147 CCTGGGAAGCGGGAGCCAGCAGG + Intronic
1104434832 12:128747608-128747630 GCTGGGAAGCCCAGGGCTGCAGG - Intergenic
1104585123 12:130042325-130042347 CTGGGGAAGCGCAGGGCTGCGGG + Intergenic
1106237965 13:27881424-27881446 CATGGGAAGGGCAGGCTTGCTGG - Intergenic
1107372848 13:39771420-39771442 CCTGGGGAGCGCTGGGCAGCGGG - Intronic
1113910913 13:113840846-113840868 CCTGGGTAGGGCCCCCCTGCTGG + Intronic
1122113238 14:99515746-99515768 CCTGGGCAGCCCCAGCCTGGTGG + Intronic
1122316948 14:100831346-100831368 CCTGGGAGGCTCCAGGCTGCCGG - Intergenic
1122737021 14:103848617-103848639 CCTGGGAAGCGCCGGCCCAGTGG + Intergenic
1123071176 14:105643171-105643193 CCTGGGGAGCGGGGGCTTGCCGG + Intergenic
1123090836 14:105741441-105741463 CCTGGGGAGCGGGGGCTTGCCGG + Intergenic
1123105391 14:105839062-105839084 CCTGGGGATGGCCGGCCAGCTGG + Intergenic
1202859578 14_GL000225v1_random:72839-72861 CCAGGGAAGAGCTGGCCAGCTGG - Intergenic
1123921462 15:25072735-25072757 CATGGGAGGCGCAGGCCTGCTGG + Intergenic
1129158275 15:73732414-73732436 ACTGGGAACCGCCGGCCGGCCGG - Intergenic
1131063138 15:89416706-89416728 CCTGGGAAGCGCGGGGCTGAGGG + Intergenic
1131277571 15:90994675-90994697 CCTGGGAAGCGCCGGAGTGGCGG + Intronic
1132827457 16:1912292-1912314 CCCGGGAAGCCCAGGCCTCCAGG + Intronic
1132832952 16:1938374-1938396 CTTGGGAAGGGCCTCCCTGCAGG + Exonic
1132997204 16:2829573-2829595 CCTCGGAAGGACCGGCCTGGGGG + Intergenic
1136776566 16:32874898-32874920 CCAGGAAAGCGCAAGCCTGCAGG - Intergenic
1136894049 16:33986615-33986637 CCAGGAAAGCGCAAGCCTGCAGG + Intergenic
1138229204 16:55325115-55325137 CCTGGGAAGCGCCGCGGTACGGG - Exonic
1139349408 16:66325893-66325915 CCTGGGCAGGGCTTGCCTGCTGG - Intergenic
1140330752 16:74054528-74054550 CTTGGCAAGCGCAGGCCTGTTGG + Intergenic
1141641614 16:85344783-85344805 CCTGGGAAGCTGCATCCTGCTGG - Intergenic
1141852165 16:86653868-86653890 CCTGGGAAGCTTGGCCCTGCTGG + Intergenic
1142008395 16:87701198-87701220 ATCGGGAAGCGCTGGCCTGCAGG - Intronic
1142307287 16:89292893-89292915 CCTGGGGAGGGCCGGCCCCCGGG - Intronic
1203078981 16_KI270728v1_random:1137007-1137029 CCAGGAAAGCGCAAGCCTGCAGG - Intergenic
1142589736 17:997458-997480 CCTGGGAGGCGAGGGACTGCGGG + Intronic
1142858910 17:2749419-2749441 CCTGGGAGTCACCGGCCGGCGGG + Intergenic
1142880408 17:2878973-2878995 ACTGGCCAGCGCCGGCCTCCGGG - Intronic
1144337029 17:14280819-14280841 CCTGAGAATCACTGGCCTGCGGG - Intergenic
1144695849 17:17303494-17303516 CCTGGGCCGCGCCGTGCTGCCGG - Exonic
1145257562 17:21335198-21335220 CCTGGGAAGCACCGCCCTCTAGG + Intergenic
1146184612 17:30716865-30716887 GCTGGGAAGCCCCCGCCTCCGGG - Intergenic
1151674091 17:75589098-75589120 CCTGGGAAGCGGCGCCTGGCGGG - Intergenic
1151889562 17:76944096-76944118 CCTGGGAACTGCTGGCCTGCGGG - Intronic
1152521676 17:80860123-80860145 CCTGGGGAGCGCCGGGCAGCAGG - Intronic
1152695358 17:81741285-81741307 CCTGGGCAGCGCCGGCGGGGAGG - Intergenic
1152755571 17:82085664-82085686 CCTGGGCAGCGCCGACCTCCTGG - Exonic
1153581960 18:6582478-6582500 CCTGGGAGGGGCCGGCAGGCAGG - Intronic
1153717854 18:7869047-7869069 CCTGGGATGCTCCAGCTTGCTGG - Intronic
1157493183 18:48137933-48137955 CCTGGGAGGCTCTGGCCAGCTGG + Intronic
1157699641 18:49753006-49753028 CCTGGAGACCTCCGGCCTGCAGG - Intergenic
1160890345 19:1374448-1374470 CCTGGGAAACGCCGTGCGGCGGG - Intronic
1160908869 19:1465716-1465738 CCTGGGCAGCCCCTTCCTGCAGG + Exonic
1161114314 19:2488360-2488382 CCTGGGAACCGCCGGCGTCCGGG - Intergenic
1161816319 19:6502024-6502046 CCTGGGGCGCGCTGGCCTCCTGG + Intronic
1162020136 19:7864556-7864578 GCTGGGAAGCTCCTGCCTGGGGG - Intronic
1163095409 19:15053759-15053781 CCCGGGAATCGATGGCCTGCTGG - Exonic
1165089146 19:33373666-33373688 CAATGGGAGCGCCGGCCTGCCGG - Exonic
1166529366 19:43533500-43533522 CCGGGGAGGGGCCGTCCTGCAGG + Exonic
1166705504 19:44905902-44905924 CCTGGGAACCCCTGGCCTCCAGG + Intronic
1166706164 19:44909103-44909125 CCTGGAAGGCCTCGGCCTGCAGG - Exonic
1167504289 19:49863016-49863038 CCTGGGAGGCGCCGGCACGCCGG - Intronic
1167711665 19:51115487-51115509 CCTGGTAAGCCCCGGGCAGCAGG - Intergenic
926217080 2:10912295-10912317 CCTGGCCGGCGCCCGCCTGCGGG - Exonic
927652468 2:24920551-24920573 CCCGGGACGCGCCCGCCCGCAGG + Intergenic
927894170 2:26770943-26770965 CCTGAGATGCTCAGGCCTGCAGG - Intronic
928518253 2:32063878-32063900 CCTGGGAGGCACCGGGTTGCTGG - Exonic
930318588 2:49827288-49827310 ACTGGGCAGGGCCTGCCTGCAGG - Intergenic
932368789 2:71170685-71170707 CCTGGGGAGGGCCCACCTGCTGG + Intergenic
932702733 2:74002498-74002520 CCTGGGATGCCCCAGCCTGCCGG + Intronic
932856667 2:75241313-75241335 CCTGGGAAGGGCTGGCAGGCAGG - Intergenic
935065155 2:99641056-99641078 CCTGGGCAGGGCCAGGCTGCAGG - Intronic
938296234 2:130181403-130181425 CCTGGGCAGAGCCGGCTGGCCGG + Intronic
939652809 2:144785567-144785589 CCTGGGATGCTCAGGCTTGCTGG + Intergenic
940361927 2:152805008-152805030 CCTCAGCAGTGCCGGCCTGCTGG - Intergenic
946065314 2:216982555-216982577 CCTGGGATGCTCCAGCTTGCTGG - Intergenic
946399685 2:219461760-219461782 TCAGGGCAGGGCCGGCCTGCGGG + Intronic
947700561 2:232230803-232230825 CCTGAGAAGAGCTGCCCTGCTGG - Intronic
948139136 2:235660037-235660059 CCTGGGAAAAGCCAGCCTGGTGG - Intronic
948385561 2:237578530-237578552 CCTGGGCACCCCCGGCCTACCGG + Intronic
948770107 2:240247525-240247547 CCTGGGAAGCACTGGGCTCCTGG + Intergenic
948892014 2:240911902-240911924 CCTGGGTAGCTTCTGCCTGCCGG + Intergenic
949030426 2:241794322-241794344 CCTGGGAACTGCTGTCCTGCAGG + Intronic
1174548695 20:51345472-51345494 CCTCGGAGGCTCCTGCCTGCTGG + Intergenic
1176010464 20:62890941-62890963 CCAGGTAAGCGCCGGCTTTCTGG - Exonic
1176156787 20:63626350-63626372 CCTGGGAATCGCGTCCCTGCGGG + Intronic
1176177589 20:63735990-63736012 CCGAGGAGGGGCCGGCCTGCTGG + Exonic
1176286629 21:5022280-5022302 CCTGGGAAGCGCAGGGGTGGGGG - Intergenic
1176382759 21:6121306-6121328 CCGGGGACGCGCCGGTCTGCAGG - Exonic
1178707377 21:34886992-34887014 CCAGGGCAGCGCCGGCGTCCGGG + Exonic
1179225078 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG + Intronic
1179428855 21:41304615-41304637 CCTGGCTTGCCCCGGCCTGCAGG + Intronic
1179630308 21:42673840-42673862 CCTGCGACTCGCTGGCCTGCAGG + Intronic
1179740710 21:43416933-43416955 CCGGGGACGCGCCGGTCTGCAGG + Exonic
1179870552 21:44241195-44241217 CCTGGGAAGCGCAGGGGTGGGGG + Intergenic
1180049158 21:45323569-45323591 CATGGGAGGCTCCTGCCTGCAGG + Intergenic
1181315983 22:21971120-21971142 CCAGGGAGGAGCCGCCCTGCAGG + Intronic
1182569949 22:31229512-31229534 CCTGAGTAGTGCAGGCCTGCTGG + Intronic
1183984482 22:41562013-41562035 CCTGGGAAGAGCCTGCAGGCTGG - Intronic
1184219324 22:43089242-43089264 CCCGGGAGGCGGCGGCCTGGGGG + Intronic
1184660720 22:45964409-45964431 CCTGGGGGGGGCTGGCCTGCAGG - Intronic
1184922945 22:47618485-47618507 CCTGGGAGGCTCCTGTCTGCCGG + Intergenic
1185146452 22:49139690-49139712 TCTGGGGAGCACAGGCCTGCAGG + Intergenic
949540194 3:5026616-5026638 CCCGGGGACCGCCTGCCTGCAGG - Intergenic
950487723 3:13282820-13282842 CCGGGAGAACGCCGGCCTGCTGG - Intergenic
950653283 3:14421125-14421147 CCTGGGGAGCTCCTGCCTTCGGG + Intronic
950740585 3:15048027-15048049 CCTGGGAAGCAGGGGCCTGCTGG + Exonic
953746035 3:45574735-45574757 CCTGGGAATGGCCAGCCTGCAGG + Intronic
954642362 3:52108730-52108752 CCTGGGAATCGTGGGGCTGCTGG - Intronic
957917855 3:86709089-86709111 CCTGGGAAGCTGCAGCCTGGCGG - Intergenic
961333676 3:126157595-126157617 CCTGGGAAGAGAGGGCCTCCTGG - Intronic
961556139 3:127697830-127697852 CCAGGGCACCGCCAGCCTGCTGG - Intronic
961653064 3:128426800-128426822 TCTGCGAAGAGCCGGCCTGGGGG + Intergenic
963810401 3:149771238-149771260 CCTGGGAAACACCAGCCTGAAGG - Intronic
968697513 4:2040480-2040502 CCGGGGACGCGCCGGGCCGCAGG - Intronic
969554886 4:7900503-7900525 CCTGGGAAGCACCATCCTCCTGG - Intronic
970823496 4:20247844-20247866 CCTGGGAAGGGCTGGGCTGAGGG - Intergenic
977847569 4:101783491-101783513 CCTGGGAAGAGCAGGCTTACTGG + Intronic
985897856 5:2759895-2759917 CCTGGAGAGCCCCGGCCTGGCGG - Intergenic
986291344 5:6401581-6401603 CCTGGGAGACGCCTTCCTGCTGG + Intergenic
988923278 5:35963694-35963716 ACTGGGAGGCGCTGGCCAGCTGG + Intronic
991642978 5:68772935-68772957 CCTGGGGAGCACAGGCCTGGAGG + Intergenic
992769608 5:80035236-80035258 CCTGGGAAGAGCTGGGCAGCTGG - Intronic
1001576913 5:172770709-172770731 CGTGGTAGGCGCCGGCCAGCAGG + Exonic
1002067242 5:176657986-176658008 CCTGGGAAGGGCGGCCTTGCTGG + Exonic
1002093611 5:176818250-176818272 CATCGGAAGCCCCGGCCTGCAGG - Intronic
1002925178 6:1601793-1601815 CCGGGGAAGCCCAGTCCTGCCGG - Intergenic
1005533833 6:26734973-26734995 CTTGGGAGGCAGCGGCCTGCAGG - Intergenic
1005534689 6:26743724-26743746 CTTGGGAGGCAGCGGCCTGCAGG + Intergenic
1005536962 6:26766681-26766703 CTTGGGAGGCAGCGGCCTGCAGG + Intergenic
1007923769 6:45634528-45634550 CCTGGGAAGCAGCAGCGTGCTGG + Intronic
1009007853 6:57809092-57809114 CTTGGGAGGCAGCGGCCTGCAGG + Intergenic
1014230374 6:118895267-118895289 CCCGGGATGCGCCGGGATGCTGG + Intronic
1015122020 6:129710238-129710260 CGTGTGAATCGCCAGCCTGCGGG - Intergenic
1015750092 6:136550462-136550484 CCTGGGAGGCGGGGGCCGGCGGG - Intronic
1017194072 6:151681712-151681734 CCTTGGAAGCGGCGGCCTGGAGG - Intronic
1018622394 6:165743014-165743036 CCTGGGAAGAGCCAGCCACCAGG - Intronic
1018996127 6:168711911-168711933 CCAGGCAAGCGCCGGCCTCAGGG - Intergenic
1019318281 7:401600-401622 CGTGGGAAGGGCAGGCCTGCAGG + Intergenic
1019552263 7:1608911-1608933 ACTGGGAAACGCAGGCCTTCAGG + Intergenic
1025639530 7:63353757-63353779 CCCAGCAAGCGCCGGGCTGCGGG - Intergenic
1025643169 7:63394335-63394357 CCCAGCAAGCGCCGGGCTGCGGG + Intergenic
1029477282 7:100792495-100792517 CCAGGGCAGCGCCCGCCTCCTGG - Intronic
1034445710 7:151113247-151113269 CCTGGGAAGGGCCCCTCTGCTGG + Intronic
1034536275 7:151727762-151727784 CCTGGGAGGCGCAGGGCAGCCGG + Intronic
1035221087 7:157406968-157406990 CCTGGGGAGGGCCAGGCTGCGGG - Intronic
1035382029 7:158446452-158446474 CCTGGGTGGGGCCTGCCTGCCGG - Intronic
1038002653 8:23404296-23404318 CCTGGGAAGGGCTGCCCCGCAGG - Intronic
1038462676 8:27729992-27730014 CCTGGGAAGCTCTGGCAGGCTGG + Intergenic
1039840530 8:41289957-41289979 CCTGGGAAGCCCAGGCCAGCTGG + Intronic
1039936784 8:42052199-42052221 GCAGGGAAGAGCCGGCCGGCGGG + Intergenic
1040047806 8:42980981-42981003 TCTGGTAAGAGCCTGCCTGCTGG - Intronic
1040055943 8:43056698-43056720 CCTGGGAAGCGGCGACGTCCCGG - Intronic
1043532429 8:81165944-81165966 CCTGGGATGCTCCAGCTTGCTGG + Intergenic
1049474622 8:142790921-142790943 CCTGCGAAGCGCTGGCATTCAGG + Intergenic
1049603953 8:143520496-143520518 GCTGGGAAGCACCGGGGTGCAGG + Intronic
1049814725 8:144592859-144592881 CCTGTGCAGAGCCAGCCTGCGGG - Intronic
1050074820 9:1852631-1852653 CCTGGGAAGCAACTGCATGCTGG + Intergenic
1057129480 9:92643042-92643064 CCTGTGAAGGGCTGGCCTGGGGG - Intronic
1060439727 9:123627257-123627279 CCAGGGAAGCAACAGCCTGCAGG + Intronic
1060944247 9:127560541-127560563 CCTGGGGTGGGCCAGCCTGCTGG - Intronic
1061195233 9:129103654-129103676 CCTGGGAAGGGCCGGGGTTCAGG - Intronic
1061235627 9:129341258-129341280 TCTGGGAGGTGCCGGCCTGAGGG - Intergenic
1061237419 9:129351107-129351129 CCTAGGAAGCCCTGGCCTGGAGG - Intergenic
1061293922 9:129666903-129666925 CTGGGGATGGGCCGGCCTGCTGG + Intronic
1061418038 9:130458598-130458620 CCTGGGAAGGGCCGGGCAGAGGG + Intronic
1062468783 9:136692990-136693012 CCTGGGAAGGAGCGGCCTTCGGG + Intergenic
1062541315 9:137042926-137042948 CCCAGGATGCGCCGGCCTCCAGG - Exonic
1062634075 9:137480778-137480800 ACTGGGCAGCGCTGACCTGCTGG - Intronic
1199972906 X:152873701-152873723 CCTGGGGTGCGCTGGCCTGGGGG - Intergenic
1200114642 X:153764803-153764825 CCTCTGAAGCACCGTCCTGCTGG - Intronic