ID: 1179225079

View in Genome Browser
Species Human (GRCh38)
Location 21:39445803-39445825
Sequence CTGGGAAGCGCCGGCCTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225065_1179225079 5 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225072_1179225079 -6 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225069_1179225079 3 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225073_1179225079 -7 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225067_1179225079 4 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225061_1179225079 22 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225063_1179225079 14 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225060_1179225079 28 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225079 Original CRISPR CTGGGAAGCGCCGGCCTGCG GGG Intronic