ID: 1179225079

View in Genome Browser
Species Human (GRCh38)
Location 21:39445803-39445825
Sequence CTGGGAAGCGCCGGCCTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225073_1179225079 -7 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225069_1179225079 3 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225061_1179225079 22 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225072_1179225079 -6 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225060_1179225079 28 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225067_1179225079 4 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225063_1179225079 14 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1179225065_1179225079 5 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225079 Original CRISPR CTGGGAAGCGCCGGCCTGCG GGG Intronic
901880544 1:12191392-12191414 CTGGGAAGAGCGGGACTGCGGGG + Intronic
903043943 1:20552427-20552449 CCGGGCAGCGCGAGCCTGCGTGG + Exonic
905512142 1:38530109-38530131 TTGGTCAGCGCCGGCCTGCCTGG + Intergenic
905562999 1:38941884-38941906 CTGGGCTGGGCCGGCCTGCTTGG + Intergenic
915359447 1:155277449-155277471 CTCGGAATCGCCGGCGCGCGGGG - Intronic
915471562 1:156128857-156128879 CTGGGAAGCCCCAGCCAGCCTGG + Intronic
922803585 1:228374807-228374829 CTGGGAAGCCTCATCCTGCGTGG + Intronic
922882459 1:228991045-228991067 CTGGGCAGCCCTGGCCTGGGAGG - Intergenic
923678593 1:236100982-236101004 GTGGGAAGCGCGGGGCCGCGCGG - Intergenic
1067091966 10:43271705-43271727 CTGGGAAGAGCTGGTCTGTGGGG - Intergenic
1067572839 10:47384388-47384410 CAGGGAAGCTCCAGCCTTCGGGG + Intergenic
1069062735 10:63911207-63911229 CTGGGAAGTGCATGCCTGCAAGG + Intergenic
1072732081 10:97852985-97853007 CTGGGAAGTGCCTGGCTGGGAGG + Intronic
1073686965 10:105765364-105765386 CTGGGAAGTGCTGGACTGGGAGG + Intergenic
1074867329 10:117552526-117552548 CTGGGACGCGCAGGCCGGCTGGG + Intergenic
1075072627 10:119328779-119328801 CCGGGAAGCACCGCCCTGCCAGG - Intronic
1077097484 11:805159-805181 CAGGTACGCGCCGGCCTGGGCGG - Exonic
1078210428 11:9265465-9265487 CCGGGAAGCTGCGGCCGGCGGGG - Intergenic
1080606803 11:33870418-33870440 CTGGGATGCCCCGGACAGCGCGG + Intronic
1083741347 11:64713104-64713126 CTGGGCAGCCAGGGCCTGCGCGG - Exonic
1085456640 11:76669214-76669236 CTGGGATGCTCAGCCCTGCGAGG - Intronic
1089002081 11:115060300-115060322 CTGAGAAGCCCCGTCCTGCTGGG - Intergenic
1089526714 11:119101749-119101771 GTGGGAAGAGCCTGCCTGTGGGG - Exonic
1090029451 11:123194947-123194969 CGGGGAAGCGCCCGCGTCCGGGG - Exonic
1091974614 12:4814362-4814384 CTGGGAAGAGCCTGCCTCTGCGG - Intronic
1092195724 12:6548601-6548623 CTGGGGAGCTCCGGCCTCCTGGG + Intronic
1103932552 12:124458277-124458299 CTGGGCACCTCCGCCCTGCGAGG - Intronic
1104728503 12:131092561-131092583 CTGGGAAGTGGCCGCCTGGGAGG - Intronic
1107141068 13:36999192-36999214 GCGGTAAGCCCCGGCCTGCGCGG + Intronic
1111006632 13:82258046-82258068 CTGGGAGGGGCCGGCCGGCGCGG + Intergenic
1112442524 13:99434600-99434622 CTGGGAAGTGCAGGCCTGAAAGG - Intergenic
1112508828 13:99991124-99991146 CTGGGGAGTGCCGCCCTGGGTGG - Intergenic
1113505074 13:110811104-110811126 CTGGGAAGCGCTGGGCTGGCTGG + Intergenic
1119191262 14:72683693-72683715 CTGGGAAGCCCTAGCCTGTGAGG - Intronic
1119524462 14:75311069-75311091 CTGGGAGAAGCCGGCCTGAGAGG + Intergenic
1121279088 14:92687033-92687055 TTGGGAACAGCAGGCCTGCGCGG - Intronic
1122920703 14:104878794-104878816 CTGGGAGGAGCCGGGCTGCATGG + Intronic
1122986872 14:105216528-105216550 CTGAGAAGCACCAGCCTGCCAGG + Intronic
1123120355 14:105913537-105913559 CTGGGAAGGGCTGGGCTGTGGGG + Intergenic
1123403081 15:20005114-20005136 CTGGGAAGGGCTGGGCTGTGGGG + Intergenic
1123512420 15:21011768-21011790 CTGGGAAGGGCTGGGCTGTGGGG + Intergenic
1130645822 15:85725859-85725881 CTGGAAGGCGCCTGCCTGTGTGG + Intronic
1132365044 15:101251286-101251308 CTGGGAAGCCGCCGCCTGCCCGG + Exonic
1132804552 16:1769504-1769526 CTGGCAAGAGCCTGCCTGCATGG - Exonic
1132997205 16:2829574-2829596 CTCGGAAGGACCGGCCTGGGGGG + Intergenic
1133150468 16:3824737-3824759 ACGGGAAGCACCGGCCTGCTTGG - Intronic
1133239750 16:4407471-4407493 CTGGGAAGGGCAGGCCAGGGTGG + Intronic
1136399764 16:30010951-30010973 CTGGGCGGCGGCGGCCGGCGAGG + Exonic
1140268925 16:73445555-73445577 CTGGGTAGAGCAGGCCTGGGAGG - Intergenic
1142174847 16:88640375-88640397 TTGGGAAGAGGCAGCCTGCGGGG - Exonic
1142266673 16:89067093-89067115 CGGGGAAGCCCCGGCCTGTCTGG - Intergenic
1142858911 17:2749420-2749442 CTGGGAGTCACCGGCCGGCGGGG + Intergenic
1147186686 17:38716885-38716907 CTGGTCAGCTCCGGCCTGGGAGG + Exonic
1147325606 17:39668102-39668124 ATGGGAGGGGCCGGCCGGCGGGG + Intronic
1148081104 17:44968098-44968120 CTGGGGAGCGCCGGGCCGCCCGG + Intergenic
1148081700 17:44970456-44970478 CTTGGATGCCCCGGCCGGCGCGG - Intergenic
1149451692 17:56754675-56754697 CTTGGCAGCCCCGGCCTGAGTGG - Intergenic
1150675718 17:67244972-67244994 CTGGGAAGCGCGGCTCTTCGAGG - Intronic
1151674090 17:75589097-75589119 CTGGGAAGCGGCGCCTGGCGGGG - Intergenic
1152583251 17:81178331-81178353 CTGGGCACCGCAGGCCTGTGAGG - Intergenic
1152756289 17:82088438-82088460 CTGGGACGTGCCGGCCGCCGAGG - Exonic
1157897262 18:51480990-51481012 CTGGGAAGAGCCTGCCTGGGAGG + Intergenic
1160735236 19:659347-659369 CGGGGAAGAGCCGGCGTGGGCGG - Intronic
1160751443 19:736282-736304 CGGGGAAGCGTGGGCCGGCGTGG - Intronic
1160890344 19:1374447-1374469 CTGGGAAACGCCGTGCGGCGGGG - Intronic
1161594922 19:5146251-5146273 CTGGGCGGGGCCGGCCTGCACGG - Intronic
1162377771 19:10315449-10315471 CTGGGATCCGCTGGCCTGAGCGG + Exonic
1163323348 19:16587366-16587388 CTGGAAAGCGCAGCCCTGAGGGG + Intronic
1164936580 19:32219594-32219616 CTGGGATGCGCTGTCCTGGGAGG - Intergenic
926217079 2:10912294-10912316 CTGGCCGGCGCCCGCCTGCGGGG - Exonic
929604521 2:43226030-43226052 CCGGGAAGCCCCGGGCAGCGTGG + Intronic
929789579 2:45013278-45013300 CTGGGATGCTCCGGCCTGGATGG + Intergenic
932702734 2:74002499-74002521 CTGGGATGCCCCAGCCTGCCGGG + Intronic
936286661 2:111186556-111186578 CTGTGCAGCGCCAGCCTGGGAGG + Intergenic
946339387 2:219058265-219058287 AGGGGAATCGCCGGCCTGCCTGG + Intronic
946399686 2:219461761-219461783 CAGGGCAGGGCCGGCCTGCGGGG + Intronic
948473710 2:238203384-238203406 CTGGGAGGCGGCGGGCGGCGCGG - Intronic
948865143 2:240771403-240771425 CTGGGGAGGGCAGGCCTGGGGGG - Intronic
1171198966 20:23225850-23225872 CTGGGAACCTCCGGCCTGGGAGG - Intergenic
1173614118 20:44391444-44391466 CTGGGAAGGCCAGGCCTGCATGG + Intronic
1176286628 21:5022279-5022301 CTGGGAAGCGCAGGGGTGGGGGG - Intergenic
1177894833 21:26845752-26845774 CTGGGAACCGCAGCCCAGCGCGG - Intergenic
1178707378 21:34886993-34887015 CAGGGCAGCGCCGGCGTCCGGGG + Exonic
1179225079 21:39445803-39445825 CTGGGAAGCGCCGGCCTGCGGGG + Intronic
1179870553 21:44241196-44241218 CTGGGAAGCGCAGGGGTGGGGGG + Intergenic
1180009337 21:45039768-45039790 CTGGGAAGAGGCTGCCTGTGAGG - Intergenic
1180843607 22:18970366-18970388 CTGGGGGGCGCGGGCCTGGGCGG - Intergenic
1181086373 22:20441367-20441389 CTGGGAAGACCCTGCCTGAGAGG - Intronic
1182944970 22:34313372-34313394 CTGGGGAGAGCAGGCCTGCACGG + Intergenic
1183241328 22:36660054-36660076 CTGGGAGGCCCCGGCTTGTGCGG - Intronic
1183649814 22:39147464-39147486 CTGGGCAGTGCCGGCCTGGGTGG - Intronic
1184445583 22:44545084-44545106 CTGGGAAGAGCTGGTCTGAGTGG - Intergenic
1185216372 22:49602059-49602081 CTGGGAAGCCCCACCCAGCGAGG + Intronic
1185385911 22:50531281-50531303 CCGGGAAGTACCTGCCTGCGGGG + Exonic
954661331 3:52228504-52228526 GAGGGGAGTGCCGGCCTGCGAGG - Intergenic
961653065 3:128426801-128426823 CTGCGAAGAGCCGGCCTGGGGGG + Intergenic
964319560 3:155481090-155481112 CTGGGATGCCCCGGCCTTCAAGG + Exonic
966863174 3:184241778-184241800 CTGGGCGGCACCGACCTGCGGGG + Exonic
968044894 3:195618449-195618471 CTGGGAAGCCCAGGCCTGTGTGG - Intergenic
968060678 3:195724501-195724523 CTGGGAAGCCCAGGCCTGTGTGG - Intronic
968803246 4:2756438-2756460 CGGGGAAGGGCGGGGCTGCGCGG - Intergenic
975986750 4:80207380-80207402 ATGGCAAGCGCCGGACCGCGCGG - Intergenic
982310917 4:153984087-153984109 CTGGGAAGTGCCGGACAGTGGGG - Intergenic
985471805 5:51148-51170 CTCGGAGGGGCCGGCCTGGGTGG + Intergenic
986314551 5:6577803-6577825 CTGGGAAACGGAGGCCTGAGCGG + Intergenic
991049920 5:62261853-62261875 CTGGGAAGCACCTGCATCCGTGG - Intergenic
993457724 5:88144437-88144459 CTGAAATGCGCCGGTCTGCGAGG + Intergenic
997206854 5:132055237-132055259 AGGGGAAGGGCCGGCCTGGGTGG - Intergenic
998041618 5:138954149-138954171 GTGGGAAGAGCCTGCCTGAGGGG - Intronic
998835969 5:146203454-146203476 CTGGGTACCGCCTGCCGGCGGGG + Intergenic
999263757 5:150253357-150253379 CTGGGAACCCCCTGCCTGAGTGG - Intronic
1000535138 5:162470127-162470149 CTGGTAAGTGGTGGCCTGCGTGG - Intergenic
1004924006 6:20402110-20402132 CTCGGAAGCGCCGGGCGGGGAGG + Intronic
1005927305 6:30454012-30454034 CTGAGAAGCCCTGGACTGCGCGG + Intergenic
1005930834 6:30482392-30482414 CTGAGAAGCCCTGGACTGCGCGG + Intergenic
1006522401 6:34578695-34578717 CTGGTAAGGACAGGCCTGCGAGG + Intergenic
1011666974 6:89643735-89643757 CTTGGAAGCCCTGGCCTGGGAGG - Exonic
1015122019 6:129710237-129710259 GTGTGAATCGCCAGCCTGCGGGG - Intergenic
1019307224 7:341502-341524 GTGAGAAGCACCGGCCTGTGTGG + Intergenic
1019424796 7:969513-969535 CTGGGAAGCCGGGGCCTGCAAGG - Intronic
1019427703 7:985158-985180 GCGGGAAGGGCCGGCCTGCGAGG - Exonic
1019536936 7:1534130-1534152 CTGGTATGGGCCGGGCTGCGGGG + Intronic
1025639528 7:63353756-63353778 CCAGCAAGCGCCGGGCTGCGGGG - Intergenic
1025643171 7:63394336-63394358 CCAGCAAGCGCCGGGCTGCGGGG + Intergenic
1031966680 7:128032223-128032245 CTGCGCGGCGCCGGCCGGCGCGG - Intronic
1034872648 7:154697358-154697380 CTTGGAAGCCCTGGCCTGAGAGG - Intronic
1035153125 7:156892394-156892416 CCGGGAAGGGCCGGGCTGCGCGG - Intronic
1035165942 7:156989970-156989992 CTGGGAAGCCCAGGCCAGCACGG - Intergenic
1036637747 8:10563653-10563675 CTGGGCAGACCCGGCCTCCGAGG - Intergenic
1039936785 8:42052200-42052222 CAGGGAAGAGCCGGCCGGCGGGG + Intergenic
1040495149 8:47959891-47959913 CAGAGAAGCGCCGGGCTGCCCGG + Intronic
1042100612 8:65271778-65271800 CTGGGGAGCACAGGCCTTCGAGG - Intergenic
1044821041 8:96155983-96156005 CTGGGAATAGCCCGGCTGCGGGG - Intronic
1045425365 8:102060650-102060672 CTGGGAAGCACAGGGCTGCCAGG + Intronic
1047097405 8:121639967-121639989 GAGAGAAGCGCCGGCGTGCGCGG + Intronic
1048173276 8:132129111-132129133 GTGGGAAGCCCCTGCCTGGGTGG + Exonic
1049740819 8:144240066-144240088 TTGGGATGGGCTGGCCTGCGCGG + Intronic
1049814724 8:144592858-144592880 CTGTGCAGAGCCAGCCTGCGGGG - Intronic
1051079541 9:13279179-13279201 CCGCGAAGCGCCGGGCCGCGCGG + Intronic
1061216136 9:129223044-129223066 CTGGGAAACGGCGGCCTCAGAGG - Intergenic
1061235626 9:129341257-129341279 CTGGGAGGTGCCGGCCTGAGGGG - Intergenic
1062148835 9:135007118-135007140 CTGGGAAGGGCCTGGCTGTGGGG - Intergenic
1062321609 9:135993064-135993086 CTGAGATGGGCTGGCCTGCGGGG + Intergenic
1062346336 9:136117010-136117032 GGGGGAGGCGTCGGCCTGCGGGG + Exonic
1062414318 9:136439964-136439986 CTGGGACCTGCCGGACTGCGGGG - Intergenic
1062468784 9:136692991-136693013 CTGGGAAGGAGCGGCCTTCGGGG + Intergenic
1062634074 9:137480777-137480799 CTGGGCAGCGCTGACCTGCTGGG - Intronic
1189391531 X:40580845-40580867 CTGGGAAGCGACAGCCTGATAGG - Intergenic
1190842171 X:54155323-54155345 CTGGGAAGCGGCAGTCAGCGAGG + Intronic
1200153970 X:153965504-153965526 CGGGGAAGCCCTGGCCTGCCAGG - Intronic