ID: 1179225080

View in Genome Browser
Species Human (GRCh38)
Location 21:39445804-39445826
Sequence TGGGAAGCGCCGGCCTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225063_1179225080 15 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225061_1179225080 23 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225065_1179225080 6 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225073_1179225080 -6 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225060_1179225080 29 Left 1179225060 21:39445752-39445774 CCAACGCCGCAGCGCCGGCGCGT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225067_1179225080 5 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225072_1179225080 -5 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
1179225069_1179225080 4 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225080 Original CRISPR TGGGAAGCGCCGGCCTGCGG GGG Intronic
900154193 1:1197571-1197593 TGGGCAGGGGCGGCCAGCGGCGG - Exonic
900208126 1:1440136-1440158 TGGCAAGGGCTGGCCTGGGGCGG + Exonic
900308475 1:2022331-2022353 TGGGAAGGGCCAGAGTGCGGGGG - Intronic
901081513 1:6586586-6586608 TGGGAAGAGTCTGCCTGGGGAGG - Intronic
901238734 1:7680945-7680967 TGCGCAGCCCCGCCCTGCGGAGG + Intronic
903213084 1:21829443-21829465 GGGGAAGAGCGGGCCTGTGGAGG - Exonic
903745208 1:25582023-25582045 TGGGAAGCCCAGGCCTGCGCTGG - Intergenic
903935208 1:26890595-26890617 TTGGAAGAGCCGGCCTTGGGTGG - Exonic
906214368 1:44030470-44030492 TGCGGAGCGCCGGCCGGGGGTGG + Intronic
907516404 1:54995994-54996016 TGGGAGGGGCAGGCCTGGGGAGG + Intergenic
912174679 1:107141221-107141243 TCGGAATCCCCGGGCTGCGGCGG + Intronic
917443921 1:175090907-175090929 TGGGAAGTTCCAGCCTGGGGAGG + Intronic
917517602 1:175721147-175721169 TAGGAAGCACCTGCCTGAGGAGG - Intronic
920335817 1:205244480-205244502 TGGGAAGGGCTGGCTTGAGGAGG + Intronic
922169516 1:223143112-223143134 GGGGACGCGGCTGCCTGCGGAGG - Intronic
922811152 1:228416412-228416434 AGGGACGCGGCGGCCGGCGGAGG + Intronic
923299676 1:232629947-232629969 TGGGCAGCCCCGGGCAGCGGCGG - Intergenic
924527073 1:244863057-244863079 CGGGGAGCGCGGGCCCGCGGGGG - Intronic
1067091965 10:43271704-43271726 TGGGAAGAGCTGGTCTGTGGGGG - Intergenic
1068845158 10:61663220-61663242 TGGGGGGCGCCGGGCTGCAGAGG - Intronic
1074023138 10:109605666-109605688 TGGGAAGCACCCGCCAGCAGGGG + Intergenic
1074867330 10:117552527-117552549 TGGGACGCGCAGGCCGGCTGGGG + Intergenic
1075060264 10:119252274-119252296 TGGGCAGCCCAGGCCTGCGACGG + Intronic
1075662765 10:124209630-124209652 TGGGAAGCACCGACCTGCTCTGG + Intergenic
1077182964 11:1224591-1224613 TGGGGAGGGGCTGCCTGCGGCGG + Intronic
1077332304 11:1989015-1989037 TGGGATGCGTCGGCCTGAGCAGG - Intergenic
1079034671 11:17011862-17011884 TGGGAAGAGCCGGTTTGGGGTGG - Intronic
1083441217 11:62677964-62677986 TGAGATGCGCCGGGCTGCTGAGG - Exonic
1202815285 11_KI270721v1_random:44191-44213 TGGGATGCGTCGGCCTGAGCAGG - Intergenic
1092527736 12:9319460-9319482 TGGGAAGTGCTGGCCTGAGGAGG - Intergenic
1092539522 12:9412293-9412315 TGGGAAGTGCTGGCCTGAGGAGG + Intergenic
1092727298 12:11498722-11498744 TGGGAAGTGCTGGCCTGAGGAGG + Intronic
1094444411 12:30514164-30514186 TGGGAAGCAGCTGCCTGCTGGGG + Intergenic
1094499984 12:31012507-31012529 TGGGAAGTGCTGGCCTGAGCAGG - Intergenic
1103698574 12:122835734-122835756 CGGGAGGCGCCGGCCAGGGGCGG + Intronic
1104748093 12:131222328-131222350 TGGTAAGCCCCGGCCTCCCGTGG + Intergenic
1104835244 12:131786084-131786106 GAGGAAGCGCCAGCCTGAGGTGG + Intronic
1104859210 12:131916031-131916053 TGGGGAGGGCTGGCCTGTGGTGG - Exonic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1108396765 13:49997314-49997336 TGGGGAGGAGCGGCCTGCGGAGG + Intronic
1116849465 14:49893479-49893501 TGGGAGCCGCCGCCCTGCTGAGG - Exonic
1121279087 14:92687032-92687054 TGGGAACAGCAGGCCTGCGCGGG - Intronic
1122093128 14:99353039-99353061 TTGGAAGCGCCTGCCTGGGCCGG - Intergenic
1122130832 14:99603991-99604013 GGGGAAGCGCCGGCCGGGCGAGG - Exonic
1122316152 14:100827200-100827222 TGGGAGGGGGCGGCCTGGGGGGG - Intergenic
1124576039 15:30909402-30909424 TGGGAAGCGCTGCTCTGCAGAGG - Intronic
1124647986 15:31453423-31453445 GTGGAAGAGCCGGCCTTCGGCGG - Intergenic
1124823237 15:33068270-33068292 GGAGAACCGCCGGCCTGGGGCGG - Intronic
1125685154 15:41559405-41559427 CGGGAAGCGGGGGGCTGCGGAGG + Intronic
1130348093 15:83067211-83067233 GAGGCAGCGCCGGCCTCCGGAGG - Exonic
1131054163 15:89365829-89365851 TGGGAAGGGTGGGGCTGCGGAGG - Intergenic
1132209153 15:100007685-100007707 GGGGAGGAGCTGGCCTGCGGTGG + Intronic
1139517239 16:67459310-67459332 TGGACAGGGCCGGCCTGTGGAGG - Intronic
1142174846 16:88640374-88640396 TGGGAAGAGGCAGCCTGCGGGGG - Exonic
1142356953 16:89605806-89605828 TGGGATGCGTGGGCCTCCGGTGG + Intergenic
1142806147 17:2372262-2372284 TGGGGCGCGCCGGGCTGTGGCGG + Intronic
1143036919 17:4004760-4004782 TGGAAAGCGCCGGGACGCGGCGG + Exonic
1145077511 17:19867861-19867883 GGGGAAGCGCGGGGCCGCGGCGG - Exonic
1146057553 17:29589000-29589022 ACGGAAGCGCCAGCCTGGGGTGG - Intronic
1146535492 17:33647145-33647167 TGGAAAGCACCTGCCTGGGGTGG + Intronic
1147325607 17:39668103-39668125 TGGGAGGGGCCGGCCGGCGGGGG + Intronic
1148786863 17:50149820-50149842 TGGGGAGCCCGGGCCCGCGGTGG + Exonic
1151674089 17:75589096-75589118 TGGGAAGCGGCGCCTGGCGGGGG - Intergenic
1151890653 17:76948940-76948962 AAGGAAGCTCCGGCCTGGGGGGG - Exonic
1152093125 17:78257822-78257844 TGGGAAGGGCTGGGCTGCAGGGG - Intergenic
1153006230 18:500656-500678 CGGGGAGCGCGGGCCGGCGGCGG - Exonic
1157314426 18:46576019-46576041 TGGGAAAGGCCTGCCTGCAGAGG - Intronic
1160013682 18:75125319-75125341 TGGGAACTGCCAGCCTGCAGTGG - Intergenic
1160164321 18:76496232-76496254 CGGGGAGCTGCGGCCTGCGGAGG + Intronic
1160221285 18:76979784-76979806 TGGGCAGCCACGGCCTGGGGAGG + Intronic
1161016699 19:1986995-1987017 TGGGAGGCTCAGGCCTGGGGAGG + Intronic
1161380837 19:3964205-3964227 TGGGCAGCCCCGGCCTGGGGAGG - Intronic
1162021860 19:7871736-7871758 GGGGAAGGACTGGCCTGCGGAGG + Exonic
1165330668 19:35139775-35139797 TGGGAATCGGGGGCCTGCTGCGG + Intronic
1166113025 19:40634664-40634686 TGGGCTGCGCCGGCGCGCGGTGG - Intergenic
1166949416 19:46416586-46416608 TGGAGACCGCCGGACTGCGGAGG - Intergenic
925293576 2:2763830-2763852 TGGGAGGCGGCTCCCTGCGGGGG - Intergenic
926712388 2:15891669-15891691 TGGGACCCGCAGGCCTGGGGTGG + Intergenic
927471918 2:23384027-23384049 TGGGAGGAGCTGGCCTGGGGAGG - Intergenic
927519703 2:23691306-23691328 TGGGATGCGTCGGCCTGCTTTGG + Intronic
932435071 2:71698512-71698534 TGGGGAGCTCCTGCATGCGGTGG - Intergenic
932702735 2:74002500-74002522 TGGGATGCCCCAGCCTGCCGGGG + Intronic
936068114 2:109347586-109347608 TGAGAAGCCCCGGCCTGCCCCGG + Intronic
944383697 2:199141277-199141299 TGGGAGGCTCTGGCCTGCAGTGG - Intergenic
948814650 2:240503622-240503644 TGGGATGCACAGGCCTGAGGTGG - Intronic
1169120600 20:3093335-3093357 TGGGGCGCGCGGGCCGGCGGAGG + Intergenic
1172015425 20:31870251-31870273 TGGTCAGCGCCGGGCCGCGGCGG + Intronic
1176047993 20:63102625-63102647 TCGGAAGCCCCGCCCTGGGGAGG - Intergenic
1176059465 20:63166060-63166082 TGGGCAGCCCCGGCCTCTGGTGG - Intergenic
1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG + Intronic
1183512453 22:38244051-38244073 TGGGAAGCACCTGCCTGATGTGG + Intronic
1183649813 22:39147463-39147485 TGGGCAGTGCCGGCCTGGGTGGG - Intronic
1184332299 22:43834474-43834496 TGGGAAGCTCAGGGCCGCGGTGG - Intronic
1184686033 22:46096760-46096782 TGGGAAGCCTGGGCCTGGGGAGG + Intronic
951526313 3:23656330-23656352 TGGAAAGCACTGGCCTGCCGTGG + Intergenic
961508085 3:127384842-127384864 TGGGCAGGGCAGCCCTGCGGAGG - Intergenic
961663265 3:128481533-128481555 TGGGCAGTGCTGGCATGCGGTGG - Intronic
965535825 3:169822781-169822803 TGGGAAACACCGGCCTGCACAGG + Exonic
967070098 3:185955515-185955537 AGGGAAAAGCTGGCCTGCGGTGG + Intergenic
969594822 4:8143002-8143024 TGGGAAGAGGGGGCCTGCAGAGG - Intronic
970195634 4:13547766-13547788 GGGGAAGCCCCGGCCCTCGGGGG + Intergenic
975572900 4:75836218-75836240 ATGGAGGCGCCGGGCTGCGGTGG + Intergenic
976518163 4:85995440-85995462 TGGGAAAGGTCGTCCTGCGGGGG - Exonic
982310916 4:153984086-153984108 TGGGAAGTGCCGGACAGTGGGGG - Intergenic
985073540 4:186191421-186191443 TGGGGCGCGCCGGGCTGCCGCGG + Intergenic
994932402 5:106206152-106206174 GGGGAGGCTCCGGCCTGCGCAGG + Intergenic
997206853 5:132055236-132055258 GGGGAAGGGCCGGCCTGGGTGGG - Intergenic
998041617 5:138954148-138954170 TGGGAAGAGCCTGCCTGAGGGGG - Intronic
999748716 5:154610654-154610676 TGCGAAGGTCCGGCCCGCGGCGG - Intergenic
1003308902 6:4951880-4951902 TGGGAAGGGCCGGCATTAGGGGG + Intronic
1009240527 6:61180670-61180692 GGGGAAGCGCCAGTCTGTGGAGG - Intergenic
1018028991 6:159827213-159827235 TGGCACGCCCCGGCCAGCGGTGG + Intergenic
1018912706 6:168112132-168112154 TGGGAATCGCCGGGCCTCGGGGG + Intergenic
1019427702 7:985157-985179 CGGGAAGGGCCGGCCTGCGAGGG - Exonic
1026024053 7:66731252-66731274 TGGGAAGGGCTGGGCTGAGGTGG + Intronic
1027142463 7:75668613-75668635 TGGGAAGTCCCGGCCAGGGGTGG - Intronic
1029308399 7:99638990-99639012 TGGGAGCCGCCGTCCTGCTGAGG + Intergenic
1032344447 7:131106196-131106218 TGGGAGGCGCCCGGCTCCGGCGG + Intergenic
1032525705 7:132577093-132577115 GGGGAGGCGCGGGGCTGCGGCGG + Exonic
1033145736 7:138868900-138868922 GGGGCAGGGCCGGCCTGCGACGG + Intronic
1034441106 7:151086520-151086542 TGGGAAGCGCTCGGCAGCGGCGG + Intronic
1035293818 7:157856463-157856485 TCGGAGGCACCGGCCTGTGGTGG - Intronic
1035582311 8:747810-747832 TGGGATGGGCGGGCCTGCGGTGG + Intergenic
1035582327 8:747850-747872 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582334 8:747870-747892 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582341 8:747890-747912 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582356 8:747930-747952 TGGGATGGGCGGGCCTGCGGTGG + Intergenic
1035582372 8:747970-747992 TGGGATGGGCGGGCCTGCGGTGG + Intergenic
1035582388 8:748010-748032 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582395 8:748030-748052 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582402 8:748050-748072 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582417 8:748090-748112 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582430 8:748130-748152 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582437 8:748150-748172 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582444 8:748170-748192 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1035582457 8:748210-748232 TGGGATGAGCGGGTCTGCGGTGG + Intergenic
1035582464 8:748230-748252 TGGGATGGGCGGGTCTGCGGTGG + Intergenic
1036739556 8:11348046-11348068 TGGGAAGCCATCGCCTGCGGAGG + Intergenic
1040413705 8:47179828-47179850 AGGGAAGCTCCGGCCTTGGGAGG - Intergenic
1044625864 8:94234730-94234752 CTGGAAGCGCCGGGTTGCGGGGG - Intergenic
1045062615 8:98422676-98422698 AGGGCAGGGCCTGCCTGCGGTGG - Intronic
1048173277 8:132129112-132129134 TGGGAAGCCCCTGCCTGGGTGGG + Exonic
1049665500 8:143840974-143840996 TGGGAGGCGCGGGCGCGCGGCGG + Exonic
1056533037 9:87504106-87504128 TGGGAACCGCAGGCCACCGGTGG + Intronic
1061293924 9:129666905-129666927 GGGGATGGGCCGGCCTGCTGGGG + Intronic
1061306644 9:129736371-129736393 TGGGGAGCGGCTGCCTGGGGAGG - Intergenic
1062076757 9:134593943-134593965 TGGGAAGCGCTGGCCTGGGCAGG + Intergenic
1062501415 9:136853587-136853609 TGGCGAGCGCAGGGCTGCGGTGG - Exonic
1193655020 X:84188085-84188107 TGGGAATCACCGGGCGGCGGCGG - Intergenic