ID: 1179225081

View in Genome Browser
Species Human (GRCh38)
Location 21:39445808-39445830
Sequence AAGCGCCGGCCTGCGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225069_1179225081 8 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225063_1179225081 19 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225072_1179225081 -1 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225065_1179225081 10 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225067_1179225081 9 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225073_1179225081 -2 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146
1179225061_1179225081 27 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225081 Original CRISPR AAGCGCCGGCCTGCGGGGGC TGG Intergenic
900462416 1:2808013-2808035 GAGTGCCGGCTTGCGGGGGCAGG + Intergenic
901016634 1:6235696-6235718 AGGTGCAGGCCGGCGGGGGCCGG - Exonic
901040120 1:6358589-6358611 AAGTGCAGGCCTGCGTGAGCTGG - Intronic
903069082 1:20717790-20717812 CAGCGCCGGCCACGGGGGGCGGG + Exonic
903072199 1:20732053-20732075 AGGCGCGGGGCTGCGGCGGCGGG - Intronic
904602220 1:31679909-31679931 AAGCGCGGGGCTGCGTGGGGAGG + Intronic
906640712 1:47439002-47439024 AAGCGAAGGCGTGCGGGTGCGGG - Exonic
910163401 1:84298433-84298455 CAGCGCCGGTCGGCGGGGGTCGG - Exonic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
911090365 1:94012655-94012677 AAGAGCCAGGCTGCAGGGGCTGG - Intronic
914803245 1:150975009-150975031 AACCGCCGACCTGGGGAGGCGGG + Intergenic
917966590 1:180182869-180182891 ATGCTCCTGCCTGCGGGGCCTGG - Intronic
918042453 1:180921585-180921607 AAGGGGTGGCCTGTGGGGGCAGG - Intronic
922025314 1:221743302-221743324 AAGCGCCGGGCTGCCGGTCCTGG - Intergenic
922119040 1:222644244-222644266 AGGAGCCGGCCGGCGAGGGCGGG - Intronic
922811154 1:228416416-228416438 ACGCGGCGGCCGGCGGAGGCGGG + Intronic
924527071 1:244863053-244863075 GAGCGCGGGCCCGCGGGGGAGGG - Intronic
1071794673 10:88991363-88991385 GCGCGCCGCCCCGCGGGGGCGGG + Exonic
1073147816 10:101292066-101292088 AGGCGCTGCCCCGCGGGGGCGGG - Intergenic
1076659730 10:132047685-132047707 CACCGCCAGCCTGCGGGGGGCGG - Intergenic
1076852240 10:133098960-133098982 TAGCGCCGGCCTGGAGGGGGCGG - Intronic
1077103074 11:830689-830711 ACGCGCGGGCCTGCGGCAGCGGG + Exonic
1077496329 11:2888264-2888286 AAGCGCGGGGTTGGGGGGGCGGG + Exonic
1078771794 11:14358710-14358732 GAGCGGCGGCGGGCGGGGGCTGG - Intronic
1081805046 11:45885835-45885857 AAGCGGCGGCCTGGGAGGGGGGG + Exonic
1083572945 11:63769529-63769551 ACCCCCAGGCCTGCGGGGGCAGG - Intergenic
1084888198 11:72224055-72224077 AAGGCCCGGCCTGCGGGTGTGGG + Intronic
1091335353 11:134762268-134762290 AGGCGCCGGCCTGGAGAGGCTGG + Intergenic
1095764750 12:45881971-45881993 AAGCGCCTGCTTCCTGGGGCTGG + Intronic
1096001691 12:48135437-48135459 AAGTGCAGCCCTGAGGGGGCAGG - Intronic
1101504170 12:105330952-105330974 AGGCGGGGGCCGGCGGGGGCGGG + Intronic
1101898600 12:108774246-108774268 AAGGCCTGGCCTGTGGGGGCCGG + Intergenic
1104585124 12:130042331-130042353 AAGCGCAGGGCTGCGGGCACAGG + Intergenic
1108396125 13:49993659-49993681 AGGGGCCGGCATTCGGGGGCGGG + Intergenic
1113985842 13:114314801-114314823 CCGCCCCGGCCTGTGGGGGCGGG - Intronic
1116887108 14:50231930-50231952 GAGCGCCGGGCCGAGGGGGCGGG - Intergenic
1117119698 14:52553601-52553623 GAGGGCCGGCATGCGGGGCCCGG + Intronic
1120167880 14:81220308-81220330 GAGCGCCGGGCGGCGGGCGCGGG - Intronic
1121671594 14:95714364-95714386 AGGCGCGGGCCAGCTGGGGCCGG - Intergenic
1122736583 14:103847200-103847222 TCGCACCGGCCCGCGGGGGCTGG + Intronic
1123002040 14:105300927-105300949 GAGGGGCGACCTGCGGGGGCTGG + Exonic
1202857267 14_GL000225v1_random:59095-59117 ATGCGGAGGCCTCCGGGGGCGGG - Intergenic
1124575439 15:30903866-30903888 AAGCGCCGGCGCGCGGAGCCAGG + Exonic
1126099885 15:45112709-45112731 AACCGGCAGCCTGCGGAGGCAGG + Exonic
1126668445 15:51094786-51094808 AGGCACCGGCCGGCGGGCGCGGG - Intronic
1128300880 15:66565684-66565706 AAGCTCCAGTCTGAGGGGGCAGG + Intronic
1129853939 15:78811185-78811207 AGGCGCGGGGCTGCGGGGACTGG + Exonic
1130335295 15:82952715-82952737 AGGCGCGGGCGGGCGGGGGCTGG + Exonic
1130558733 15:84942760-84942782 AAGCCCAGGACTGCGGGGTCAGG + Intronic
1132055635 15:98648845-98648867 AGGCGGCGGCGGGCGGGGGCCGG + Intergenic
1132128421 15:99251417-99251439 GAGCGCCGGGCGTCGGGGGCGGG - Exonic
1132464784 16:72472-72494 GAGCGCAGGGCTCCGGGGGCGGG - Intronic
1132628174 16:902267-902289 ACGCATCGGCCTGCGGGGGCTGG - Intronic
1132804550 16:1769499-1769521 AAGAGCCTGCCTGCATGGGCAGG - Exonic
1133097560 16:3457942-3457964 CAGCGCCGGCCTCAGGGGGCGGG + Intronic
1133403057 16:5502760-5502782 AAGTTCCAGCCTTCGGGGGCAGG - Intergenic
1134121377 16:11586947-11586969 AAGGGCCGGGCGGCGGGGACGGG + Intronic
1137787757 16:51151892-51151914 GCGCGCCGGCCCGCGGGGGGAGG + Intergenic
1138490255 16:57372415-57372437 ACCCTCCTGCCTGCGGGGGCTGG + Intergenic
1142199596 16:88754750-88754772 CAGCGCTGGCCTGCGGGCCCCGG - Intronic
1142589748 17:997532-997554 GAAAGCCGGCCTGAGGGGGCAGG - Intronic
1142752593 17:1997893-1997915 AAGGGCAGGCCGGCAGGGGCCGG + Intronic
1143541598 17:7572731-7572753 GAGCGCCGGCAGGCGGGGCCGGG + Exonic
1146057552 17:29588996-29589018 AAGCGCCAGCCTGGGGTGGCAGG - Intronic
1147427366 17:40352249-40352271 GAGGGCAGGCCTGTGGGGGCTGG + Intronic
1148848407 17:50542121-50542143 TGGTGCCGGTCTGCGGGGGCGGG - Exonic
1149431315 17:56596881-56596903 AAGCGCCGGGCTGGAGGGACAGG - Intergenic
1149461615 17:56833995-56834017 ACGGACCGGCCTGAGGGGGCGGG - Intronic
1149774915 17:59349636-59349658 AAAGGCCAGCCTGTGGGGGCCGG - Intronic
1151428898 17:74049437-74049459 AAGCTCAGGCCTGAGGGGCCAGG - Intergenic
1152663120 17:81552141-81552163 GAGCGCCGGCCCGCGGGGGCGGG - Intronic
1160739833 19:680645-680667 AGGGCCAGGCCTGCGGGGGCGGG + Intronic
1163124536 19:15237896-15237918 CAGGGCAGGCCTGCGTGGGCTGG - Exonic
1163329586 19:16628016-16628038 ACTCGCCGGCCTCCGGGAGCCGG + Exonic
1164958260 19:32405465-32405487 TAGCTCCGGCCTGAGGTGGCCGG + Intergenic
1168230274 19:55026968-55026990 AAGCCCTGGGCTGCAGGGGCGGG - Intronic
1168230294 19:55027022-55027044 AAGCCCTGGGCTGCAGGGGCGGG - Intronic
1168230314 19:55027076-55027098 AAGCCCTGGGCTGCAGGGGCGGG - Intronic
1168230334 19:55027130-55027152 AAGCCCTGGGCTGCAGGGGCGGG - Intronic
1168230354 19:55027184-55027206 AAGCCCTGGGCTGCAGGGGCGGG - Intronic
1168230374 19:55027238-55027260 AAGCCCTGGGCTGCAGGGGCGGG - Intronic
1168230429 19:55027400-55027422 AAGCCCTGGGCTGCAGGGGCGGG - Intronic
1168230449 19:55027454-55027476 AAGCCCTGGGCTGCAGGGGCGGG - Intronic
1168242889 19:55096098-55096120 GAGCGCCGGCCTGGTGGGGCTGG - Exonic
1168315321 19:55482441-55482463 CAGCCTCAGCCTGCGGGGGCGGG - Exonic
927864586 2:26580439-26580461 AGGCTCCTGCCTGCTGGGGCAGG + Intergenic
928706832 2:33958731-33958753 AAGCCCCAGCCTGCTGGAGCAGG + Intergenic
929501399 2:42494003-42494025 AAGAGCCGGCTCGCGGCGGCGGG + Exonic
932780212 2:74554638-74554660 CAGCGGCTGCCGGCGGGGGCCGG + Exonic
934706666 2:96486047-96486069 AAGCGGAGGCCTGCCCGGGCTGG - Intergenic
934882498 2:97995952-97995974 GAGCGCTGGCCTGCGAGGGGCGG + Intergenic
934966826 2:98731007-98731029 CAGCGGCGGCGCGCGGGGGCGGG - Intronic
937203913 2:120223678-120223700 GAGCGCAGACCTGTGGGGGCCGG + Intergenic
948046697 2:234951478-234951500 AGGCGCGAGGCTGCGGGGGCCGG - Intergenic
948692420 2:239715118-239715140 AAGTGTCGGCCCGCAGGGGCAGG + Intergenic
1171972600 20:31573360-31573382 AAGCACCGCCCGGCGGGGACTGG + Intronic
1172015426 20:31870255-31870277 CAGCGCCGGGCCGCGGCGGCCGG + Intronic
1172095225 20:32457153-32457175 CACCGCCAGCCTGCGGGCGCGGG + Intronic
1175161816 20:57013878-57013900 TAGCCCCGGACTGCGCGGGCCGG - Intergenic
1176047992 20:63102621-63102643 AAGCCCCGCCCTGGGGAGGCCGG - Intergenic
1179225081 21:39445808-39445830 AAGCGCCGGCCTGCGGGGGCTGG + Intergenic
1183368391 22:37419030-37419052 GAGCCCCTGCCTGCGGGGGAGGG - Intronic
1184756258 22:46517505-46517527 AAGAGCCGGCCTGGGGCGCCGGG - Intronic
1185101264 22:48842106-48842128 CAGAGCTGCCCTGCGGGGGCTGG + Intronic
949993789 3:9600874-9600896 AAGCGCCGGGCTGCGGCAGAAGG + Intergenic
950759214 3:15206102-15206124 AGGAGCCGGGCCGCGGGGGCGGG - Intergenic
952942315 3:38454132-38454154 AAGGGCCGGTCGGCGGGGCCGGG - Exonic
953319837 3:41961925-41961947 GCGCGCAGGCCTGCCGGGGCGGG - Intronic
954275617 3:49539918-49539940 AAGCGCTAGCCTCCGGAGGCCGG + Intergenic
960896911 3:122514936-122514958 GTGCGCCTGCGTGCGGGGGCCGG + Intronic
961653067 3:128426806-128426828 AAGAGCCGGCCTGGGGGGCAGGG + Intergenic
963967601 3:151390086-151390108 AAAAGCCGGGCTGCTGGGGCTGG - Exonic
969159898 4:5247579-5247601 AAGCGCCGGACAGTGGGTGCAGG - Intronic
969239202 4:5888195-5888217 CAGCGCGGGGCGGCGGGGGCGGG + Intronic
969566746 4:7983239-7983261 AAGCGGGGGACTGCCGGGGCAGG - Intronic
971457798 4:26860763-26860785 CAGCGCGGGCCGGAGGGGGCGGG + Intronic
976629156 4:87219927-87219949 GAGCCGCGGCCTGCGGGGGCGGG - Intronic
981286117 4:143020676-143020698 CAGCTCTGGCCTGAGGGGGCAGG + Intergenic
982198495 4:152937639-152937661 AAGCCGCGGCCTGCGGGGCGGGG - Intronic
982310915 4:153984082-153984104 AAGTGCCGGACAGTGGGGGCAGG - Intergenic
989209770 5:38846870-38846892 AAGCCCTGGCCTGCGAGAGCCGG - Intronic
992690390 5:79236027-79236049 AGGCGCCGGCGCGCGCGGGCGGG + Intronic
999748714 5:154610650-154610672 AAGGTCCGGCCCGCGGCGGCGGG - Intergenic
1004114140 6:12749883-12749905 GAGCGCCCGACTGCGGGGGGCGG - Intronic
1005755808 6:28924009-28924031 AAGAGGCGGCTCGCGGGGGCGGG + Intergenic
1007301970 6:40874511-40874533 AAGAGCTGGCCTGTGGAGGCTGG - Intergenic
1010083104 6:71886726-71886748 CAGCCTCGGCCGGCGGGGGCGGG - Intronic
1010388735 6:75312355-75312377 AAGCGCAGGCCTGCAGAGGGAGG - Intronic
1019491236 7:1314543-1314565 AGACCCCAGCCTGCGGGGGCAGG + Intergenic
1022095633 7:27139488-27139510 AGGCGGCGGCCTTCGGGGCCGGG - Intronic
1022843965 7:34191533-34191555 AAGCCCCAGCCTGAGGGGCCTGG - Intergenic
1023435219 7:40134902-40134924 CAGCCCCGCCCGGCGGGGGCGGG + Intergenic
1023832610 7:44048668-44048690 AAGCACAGGCCTGCTGAGGCAGG - Intronic
1027390370 7:77697152-77697174 GTGCGCCGGCCTGGAGGGGCTGG + Intronic
1034872565 7:154696850-154696872 AGGAGCCGGCCTCGGGGGGCCGG + Intronic
1035212092 7:157336480-157336502 AAGCGGCGGCCAGCGAAGGCGGG - Intronic
1035290872 7:157837662-157837684 GAGCCCTGCCCTGCGGGGGCTGG - Intronic
1035422560 7:158741674-158741696 GAGGGCCGGCCTCAGGGGGCTGG + Exonic
1038256742 8:25957447-25957469 AAGAGGTGGCCTGCGGGGGAGGG - Intronic
1045222559 8:100213214-100213236 CCGCGCCGGCCTCCGGGGTCTGG - Exonic
1049299875 8:141863815-141863837 AGGGGCCAGCCTGCGGGGCCAGG - Intergenic
1049664622 8:143837415-143837437 CAGCGGGGGCCTGCGGGGCCGGG + Exonic
1049745103 8:144259991-144260013 ATGCGCCAGCGTGCGGAGGCTGG + Exonic
1050472377 9:6007416-6007438 AAGGGCCGCGCAGCGGGGGCCGG - Exonic
1051079544 9:13279184-13279206 AAGCGCCGGGCCGCGCGGGGTGG + Intronic
1055639872 9:78311224-78311246 AAGTGCTGGCCTCCGGGGGAAGG + Intronic
1060931113 9:127490059-127490081 AGCAGCCGGCCTGCGGGGGGTGG - Intronic
1061421683 9:130476202-130476224 AAGCCACGGCCTGGGGGAGCTGG + Intronic
1062274522 9:135724385-135724407 AAGCACAGGCCAACGGGGGCAGG + Intronic
1062537635 9:137027900-137027922 CAGCGCCGGCAGGCGAGGGCAGG + Exonic
1062583037 9:137236721-137236743 AATGGCGGGCCTGGGGGGGCGGG + Intergenic
1185877666 X:3713475-3713497 AGCCGCCGGCCTCGGGGGGCGGG + Exonic
1196078258 X:111601475-111601497 AAGCGGGGGCCTGTGGGGGGTGG + Intergenic
1200100632 X:153687902-153687924 AAGCGGCGGCCGGCCGGGGACGG + Intronic