ID: 1179225082

View in Genome Browser
Species Human (GRCh38)
Location 21:39445809-39445831
Sequence AGCGCCGGCCTGCGGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225065_1179225082 11 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225063_1179225082 20 Left 1179225063 21:39445766-39445788 CCGGCGCGTCCCCATGGAAACCC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225067_1179225082 10 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225069_1179225082 9 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225061_1179225082 28 Left 1179225061 21:39445758-39445780 CCGCAGCGCCGGCGCGTCCCCAT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225072_1179225082 0 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1179225073_1179225082 -1 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225082 Original CRISPR AGCGCCGGCCTGCGGGGGCT GGG Intergenic
900154221 1:1197644-1197666 GGCGCAGGCCTGCGGGCGCCCGG - Exonic
900186735 1:1336436-1336458 AGCGTCGGGCGGCGGGAGCTGGG - Exonic
900559238 1:3295474-3295496 AGCACCAGCGTGTGGGGGCTGGG + Intronic
900636574 1:3669083-3669105 ACCGCCCGCCTGCGGGAGCCAGG + Intronic
901040119 1:6358588-6358610 AGTGCAGGCCTGCGTGAGCTGGG - Intronic
901183555 1:7357837-7357859 AGTGCCGGGCTGCTGGAGCTTGG + Intronic
902250889 1:15153721-15153743 AGCGCCGGCGTGCGGGAGGGAGG - Intronic
903049301 1:20589067-20589089 AGCTCCGGCCAGCCTGGGCTGGG - Exonic
903069083 1:20717791-20717813 AGCGCCGGCCACGGGGGGCGGGG + Exonic
903809110 1:26024691-26024713 AGCGCTGAGCTGCAGGGGCTTGG - Intronic
903853526 1:26322045-26322067 AGCCCCGGCCTCCTGGGGGTGGG + Exonic
906309017 1:44739750-44739772 AGCGGCGCCCTGCGGAGCCTTGG - Intergenic
910200144 1:84690552-84690574 GGCGCCGGCGCGCGGGGGCGGGG - Intronic
911090364 1:94012654-94012676 AGAGCCAGGCTGCAGGGGCTGGG - Intronic
913139628 1:115928044-115928066 AGCGCCATCCTGCTGGGGCTTGG + Intergenic
913209448 1:116570854-116570876 CGCGCCGGCCGGCGGGTACTGGG - Intronic
915310836 1:155005114-155005136 TGCGGCGGGCAGCGGGGGCTGGG + Intronic
915367330 1:155323527-155323549 GGCGCCGGGCTGCGGCTGCTGGG + Intronic
915598066 1:156906530-156906552 AGGGTGGGCCTGTGGGGGCTGGG + Intronic
915977568 1:160400873-160400895 AGTGCCGGGCCGCGGGGGCGCGG + Intronic
917291598 1:173477223-173477245 GGGGCCGGGCCGCGGGGGCTGGG - Intergenic
922210353 1:223481485-223481507 AGCGCTGGCCTGGGGGAGCACGG - Intergenic
923475005 1:234323855-234323877 AGAGCAGGCCAGCCGGGGCTTGG - Exonic
924436811 1:244049268-244049290 TGCACCGGCCCGCGGGGGCGCGG - Intronic
924527070 1:244863052-244863074 AGCGCGGGCCCGCGGGGGAGGGG - Intronic
1063664199 10:8051839-8051861 AGAGCCGGGCTGCGGGGGTCCGG - Intergenic
1068774472 10:60855643-60855665 AGCCCCTGCCTGCGGGGTATTGG + Intergenic
1069172821 10:65254669-65254691 ATCACAGGCCTGTGGGGGCTGGG - Intergenic
1069569185 10:69484264-69484286 AGCCCCGGCTGGCAGGGGCTGGG - Intronic
1070329015 10:75404935-75404957 CGCGCCGGCCTTCGGGGGTTTGG - Intergenic
1070597237 10:77841169-77841191 AGCTGAGCCCTGCGGGGGCTTGG - Intronic
1071794674 10:88991364-88991386 CGCGCCGCCCCGCGGGGGCGGGG + Exonic
1073012628 10:100373308-100373330 AGGGCCGGCCTGCCCGGGCCTGG + Intergenic
1073349100 10:102806758-102806780 ACTGCCAGCCTGCCGGGGCTGGG + Intronic
1075654759 10:124153435-124153457 ACCGAGGGCCTGCGGGCGCTGGG + Intergenic
1076659729 10:132047684-132047706 ACCGCCAGCCTGCGGGGGGCGGG - Intergenic
1076685410 10:132196413-132196435 AGCACCTGCCTGCAGGGCCTTGG - Intronic
1077162102 11:1118381-1118403 AAGGCAGGCCTGCTGGGGCTGGG + Intergenic
1077375262 11:2202632-2202654 GGCGCCGGCCGACGGGAGCTTGG + Intergenic
1078084565 11:8225903-8225925 AGCGCCTGCCTTCTGGTGCTAGG + Intronic
1078246030 11:9573879-9573901 AGCGGAGGCCTGCGGGGTCCAGG - Exonic
1081670960 11:44942544-44942566 AGTGCCCACCTGCTGGGGCTGGG + Intronic
1083673650 11:64313905-64313927 AGTGGCGGCCTCCCGGGGCTGGG - Intronic
1089324021 11:117644952-117644974 TGAGGCGGCCTGCGGGGTCTGGG - Intronic
1091250731 11:134141727-134141749 AGGGGAGGCCTGCTGGGGCTTGG + Intronic
1091335354 11:134762269-134762291 GGCGCCGGCCTGGAGAGGCTGGG + Intergenic
1095764751 12:45881972-45881994 AGCGCCTGCTTCCTGGGGCTGGG + Intronic
1105702623 13:22944440-22944462 AGCGCTGGCTGGAGGGGGCTTGG - Intergenic
1111232590 13:85363225-85363247 AGTGCCGGCCCGCGGGGCCGCGG - Intergenic
1113546270 13:111153612-111153634 CGCGCGGGCCGGCGGGGGCGCGG + Intronic
1114062907 14:19037127-19037149 AGCTCAGGCCGGCGGGAGCTGGG + Intergenic
1114099352 14:19362870-19362892 AGCTCAGGCCGGCGGGAGCTGGG - Intergenic
1116973951 14:51095334-51095356 GGGGCCGGCGTGCGGAGGCTAGG + Exonic
1117119699 14:52553602-52553624 AGGGCCGGCATGCGGGGCCCGGG + Intronic
1117882700 14:60327903-60327925 GGCGCTGGGCTGCGGGGCCTGGG + Intergenic
1120167879 14:81220307-81220329 AGCGCCGGGCGGCGGGCGCGGGG - Intronic
1121183579 14:91947707-91947729 CGCGCAGGGGTGCGGGGGCTGGG + Exonic
1121781487 14:96625018-96625040 CTTGCGGGCCTGCGGGGGCTGGG - Intergenic
1122578116 14:102754745-102754767 AGAGCCGGCCTGAGGAGACTTGG + Intergenic
1122736584 14:103847201-103847223 CGCACCGGCCCGCGGGGGCTGGG + Intronic
1122904483 14:104795548-104795570 AGCGCCGGCCCGCGGGGATGCGG - Intronic
1123002041 14:105300928-105300950 AGGGGCGACCTGCGGGGGCTGGG + Exonic
1129668849 15:77595764-77595786 AGCCTCGGCCTGGGGAGGCTGGG + Intergenic
1129853940 15:78811186-78811208 GGCGCGGGGCTGCGGGGACTGGG + Exonic
1130335296 15:82952716-82952738 GGCGCGGGCGGGCGGGGGCTGGG + Exonic
1132128420 15:99251416-99251438 AGCGCCGGGCGTCGGGGGCGGGG - Exonic
1132839531 16:1972320-1972342 TGCGCCGGCCCGCGGGGTCGCGG + Intronic
1132854231 16:2037718-2037740 AGAGGCTGCCTGCTGGGGCTGGG - Intronic
1132885108 16:2179060-2179082 GGCGGCGGCTCGCGGGGGCTTGG + Exonic
1132896596 16:2232248-2232270 AGCCCCCGCCAGCAGGGGCTGGG + Exonic
1133097561 16:3457943-3457965 AGCGCCGGCCTCAGGGGGCGGGG + Intronic
1133230594 16:4364738-4364760 GGCGAGGGACTGCGGGGGCTGGG - Intronic
1136251673 16:29009484-29009506 AACGCGGGTGTGCGGGGGCTGGG + Intergenic
1136518634 16:30782664-30782686 GGCGACAGCCTGCTGGGGCTCGG - Exonic
1137787758 16:51151893-51151915 CGCGCCGGCCCGCGGGGGGAGGG + Intergenic
1142195505 16:88737558-88737580 AGCTCCGTCCTGCGGCGGCCTGG - Exonic
1142209868 16:88803919-88803941 AGTGCGGGCCTGGCGGGGCTGGG - Exonic
1142810665 17:2394170-2394192 AGCGCCGGTCAGCGGTGCCTGGG + Intronic
1143001491 17:3797964-3797986 AGTGCCGGCCTGGGGGAGCTTGG - Intronic
1143478834 17:7217433-7217455 AGCCCCGGAGTTCGGGGGCTGGG + Intronic
1143541599 17:7572732-7572754 AGCGCCGGCAGGCGGGGCCGGGG + Exonic
1145916647 17:28577826-28577848 AGCGGCTGCCTCCTGGGGCTGGG - Intronic
1147636454 17:41967183-41967205 AGCGCGGGCCTGCGTGGGGTCGG - Intronic
1147970768 17:44218478-44218500 GGAGCCGGGCTGCAGGGGCTGGG - Intronic
1148848406 17:50542120-50542142 GGTGCCGGTCTGCGGGGGCGGGG - Exonic
1149772319 17:59331738-59331760 AGCGCGGCCCGGCTGGGGCTCGG - Exonic
1150130658 17:62667019-62667041 AGCGCCGCCCTACATGGGCTAGG - Intronic
1151490926 17:74432030-74432052 CGCGCCCGCATGCGGGGGCGTGG + Exonic
1152628023 17:81397094-81397116 CGCGCCGGGCTTCGGGGGCCTGG - Intronic
1153006229 18:500651-500673 AGCGCGGGCCGGCGGCGGCGAGG - Exonic
1154169225 18:12038664-12038686 TGCTCCGGGCTGCGGGGACTGGG - Intergenic
1160502078 18:79406730-79406752 AGCGCAGGCCTGCGGCTCCTGGG - Intronic
1160784487 19:893060-893082 AGTGCGGGGCTGCGGGGGCCCGG - Intronic
1161703024 19:5805231-5805253 ATCCCGGGCCGGCGGGGGCTGGG - Intergenic
1163633204 19:18427337-18427359 AGCGCCAACCTGTGGGGGCGAGG - Exonic
1164483311 19:28632911-28632933 AGCACAGGCCTGTGGGGACTGGG - Intergenic
1167648603 19:50718475-50718497 GGAGCCGGCCCGGGGGGGCTGGG - Intronic
1168242888 19:55096097-55096119 AGCGCCGGCCTGGTGGGGCTGGG - Exonic
925159762 2:1675901-1675923 AGCGCAGGAGTGCTGGGGCTGGG + Intronic
928313806 2:30231385-30231407 AGCTCCGGCGGGCGGCGGCTCGG - Intergenic
932364924 2:71144731-71144753 AGCCCCTGCCAGCTGGGGCTGGG + Intronic
932567188 2:72917533-72917555 AGCGCTGGGCGGCCGGGGCTGGG + Exonic
932780213 2:74554639-74554661 AGCGGCTGCCGGCGGGGGCCGGG + Exonic
933719996 2:85391624-85391646 AGCCCCAGCTTGTGGGGGCTAGG - Exonic
934882499 2:97995953-97995975 AGCGCTGGCCTGCGAGGGGCGGG + Intergenic
935580514 2:104752352-104752374 AGCGCTGGGCTGTTGGGGCTTGG - Intergenic
942046329 2:172101409-172101431 AGCGCGGGCCTGAGATGGCTGGG - Intronic
942454744 2:176130071-176130093 GGCGGCGGCGCGCGGGGGCTGGG + Exonic
946235678 2:218323231-218323253 CGCGCCGGCCGGGCGGGGCTCGG - Intronic
946362764 2:219229141-219229163 AGCCCCGGCCGGCTGGGCCTGGG + Exonic
947188224 2:227472945-227472967 GGCGCCGGGCTGTGGGGGGTGGG + Intronic
1172015427 20:31870256-31870278 AGCGCCGGGCCGCGGCGGCCGGG + Intronic
1172095226 20:32457154-32457176 ACCGCCAGCCTGCGGGCGCGGGG + Intronic
1172284702 20:33732297-33732319 AGCGCCAGCCTGGGCGGCCTTGG + Intronic
1173453794 20:43188628-43188650 CACGCCGGCCTGAGGTGGCTGGG - Intronic
1173586420 20:44186651-44186673 AGGGGCGTACTGCGGGGGCTGGG - Exonic
1176178580 20:63739635-63739657 AGCGCTGGCCGGCGGGAGCGCGG + Intronic
1179225082 21:39445809-39445831 AGCGCCGGCCTGCGGGGGCTGGG + Intergenic
1180481401 22:15759754-15759776 AGCTCAGGCCGGCGGGAGCTGGG + Intergenic
1180920296 22:19518252-19518274 AGTGCCCACCTGCGTGGGCTGGG + Intronic
1184652115 22:45924200-45924222 AGCCCAGCCCTGCCGGGGCTTGG + Intronic
1185079207 22:48700420-48700442 AGAGCAGGCCGGCAGGGGCTGGG + Intronic
1185272092 22:49934479-49934501 ACCCCAGGCCTGCGGGGTCTGGG - Intergenic
954416267 3:50394924-50394946 AGCGCAGTGCTGTGGGGGCTCGG + Intronic
954647134 3:52138393-52138415 AGCACAGGCCTGATGGGGCTGGG + Intronic
963200201 3:142578649-142578671 ATCCCCGCCCTGCGGGAGCTGGG - Exonic
963882603 3:150545893-150545915 ACCGCCAGACTGTGGGGGCTCGG - Intronic
968579842 4:1384806-1384828 TGCACCGGCCTGAGTGGGCTCGG + Intronic
968913516 4:3487282-3487304 AAGTCCAGCCTGCGGGGGCTGGG - Intronic
969239203 4:5888196-5888218 AGCGCGGGGCGGCGGGGGCGGGG + Intronic
969330817 4:6472604-6472626 CGAGCCGGGCTGCGCGGGCTGGG + Intronic
971457799 4:26860764-26860786 AGCGCGGGCCGGAGGGGGCGGGG + Intronic
976629155 4:87219926-87219948 AGCCGCGGCCTGCGGGGGCGGGG - Intronic
981286118 4:143020677-143020699 AGCTCTGGCCTGAGGGGGCAGGG + Intergenic
982280994 4:153683926-153683948 AGAGGCGGCCTGCGTGGGATTGG - Intergenic
985073641 4:186191765-186191787 AGTGCGGGCCCGCGGGGGCGTGG - Exonic
985967062 5:3345471-3345493 AGCTCGGGCCTGAGGGGCCTCGG - Intergenic
986315358 5:6583202-6583224 AACGCGGGGCCGCGGGGGCTGGG + Intergenic
999478667 5:151925036-151925058 TGGGCCGGCCTGAGGGGGTTAGG + Intergenic
1002055794 5:176597330-176597352 AGCGCCGTCCTGCGGAGACATGG + Exonic
1002580880 5:180208962-180208984 GGCGCGGGCTCGCGGGGGCTGGG - Intronic
1007390425 6:41547108-41547130 AGCTCCGGCCCGCTGGGGCCCGG - Intronic
1010703456 6:79078343-79078365 AGCGCCGGGGGGCGGGGGCGCGG - Intergenic
1011434529 6:87322666-87322688 GGCGCCGGCCTGGAGGGGCCAGG + Intronic
1015251848 6:131135598-131135620 AGCGACAGGCTGCGGGGGCCCGG - Intergenic
1015785920 6:136921817-136921839 AGCGCCGGGGCGAGGGGGCTGGG + Intergenic
1017737947 6:157381021-157381043 GGCGCCCGCCCGAGGGGGCTGGG + Intergenic
1018952780 6:168389971-168389993 AGCGCAGGACTCAGGGGGCTAGG + Intergenic
1019670765 7:2277024-2277046 AGTGCCGTCCGGCCGGGGCTGGG + Intronic
1023287071 7:38631257-38631279 AGCGGCGGGCGGCCGGGGCTGGG - Intronic
1023418193 7:39951012-39951034 ACCGCCGTCCTGCTGCGGCTGGG - Exonic
1023435220 7:40134903-40134925 AGCCCCGCCCGGCGGGGGCGGGG + Intergenic
1023968781 7:44977151-44977173 AGCGCTGGCCTACTGGGGCCAGG - Intronic
1027390371 7:77697153-77697175 TGCGCCGGCCTGGAGGGGCTGGG + Intronic
1030884539 7:114922145-114922167 AGAGCCGGCCTGGGCTGGCTCGG - Exonic
1035028482 7:155842639-155842661 AGTGACGTCCTGCGGGGGCTAGG + Intergenic
1035422561 7:158741675-158741697 AGGGCCGGCCTCAGGGGGCTGGG + Exonic
1035719819 8:1783603-1783625 CTCGCCGCGCTGCGGGGGCTGGG + Exonic
1043388275 8:79768387-79768409 AGGGCGCGCCGGCGGGGGCTGGG + Intergenic
1045571243 8:103371327-103371349 AGAGCCCGCCTGCAGGGTCTGGG - Intergenic
1049615186 8:143572825-143572847 AGCGTGAGCTTGCGGGGGCTGGG + Exonic
1049664623 8:143837416-143837438 AGCGGGGGCCTGCGGGGCCGGGG + Exonic
1049673065 8:143878250-143878272 CGCGGCGGCCAGCGGGGTCTTGG - Intronic
1051079545 9:13279185-13279207 AGCGCCGGGCCGCGCGGGGTGGG + Intronic
1053416102 9:37947739-37947761 AGAGCCGGCCTGCAGGGACACGG - Intronic
1060931112 9:127490058-127490080 GCAGCCGGCCTGCGGGGGGTGGG - Intronic
1061280830 9:129597043-129597065 AGCTCCTCCCTGCGGGGGATGGG - Intergenic
1061421684 9:130476203-130476225 AGCCACGGCCTGGGGGAGCTGGG + Intronic
1062242548 9:135548089-135548111 TGCGCCGGCCTTCGTGTGCTAGG + Intronic
1062537636 9:137027901-137027923 AGCGCCGGCAGGCGAGGGCAGGG + Exonic
1062600457 9:137316681-137316703 TGCTCCGGGCTGCAGGGGCTGGG + Intronic
1185463985 X:344637-344659 AGCGCCGGCCCGTGTGGCCTGGG - Intronic
1192260609 X:69504256-69504278 GGCTGCGGCCGGCGGGGGCTGGG + Intergenic
1196078259 X:111601476-111601498 AGCGGGGGCCTGTGGGGGGTGGG + Intergenic
1200076634 X:153554504-153554526 AGGGCCAGGCTGCGGAGGCTGGG + Intronic