ID: 1179225083

View in Genome Browser
Species Human (GRCh38)
Location 21:39445813-39445835
Sequence CGCGCCCAGCCCCCGCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 269}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225083_1179225090 12 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225090 21:39445848-39445870 CGGGCAGCAGGAGCCGCGGCGGG 0: 1
1: 1
2: 5
3: 56
4: 420
1179225083_1179225096 26 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225096 21:39445862-39445884 CGCGGCGGGGAGGGGCGTCTTGG 0: 1
1: 0
2: 2
3: 30
4: 286
1179225083_1179225094 18 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225094 21:39445854-39445876 GCAGGAGCCGCGGCGGGGAGGGG 0: 1
1: 0
2: 8
3: 64
4: 744
1179225083_1179225087 0 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225087 21:39445836-39445858 CGCATGCGCACTCGGGCAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 55
1179225083_1179225085 -8 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225083_1179225093 17 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225093 21:39445853-39445875 AGCAGGAGCCGCGGCGGGGAGGG 0: 1
1: 0
2: 4
3: 50
4: 519
1179225083_1179225089 11 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225089 21:39445847-39445869 TCGGGCAGCAGGAGCCGCGGCGG 0: 1
1: 0
2: 1
3: 29
4: 238
1179225083_1179225091 13 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225091 21:39445849-39445871 GGGCAGCAGGAGCCGCGGCGGGG 0: 1
1: 0
2: 8
3: 71
4: 556
1179225083_1179225097 27 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225097 21:39445863-39445885 GCGGCGGGGAGGGGCGTCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1179225083_1179225086 -7 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225083_1179225092 16 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225092 21:39445852-39445874 CAGCAGGAGCCGCGGCGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 449
1179225083_1179225088 8 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225088 21:39445844-39445866 CACTCGGGCAGCAGGAGCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225083 Original CRISPR CGCGCCCAGCCCCCGCAGGC CGG (reversed) Intergenic
900314545 1:2050421-2050443 CGCCCCCCGCCCCCGCCGGACGG + Intergenic
900548656 1:3242535-3242557 CACGCCTCGGCCCCGCAGGCAGG + Intronic
900596347 1:3481867-3481889 TGCTCCCAGCCCCCGCCTGCTGG + Intergenic
900973291 1:6003183-6003205 AGCGCACAGCCCCAGCAGCCTGG + Intronic
901035344 1:6333039-6333061 CTGGCCCGGCCCCCGCAGCCTGG + Intronic
901637232 1:10676041-10676063 GGCGCCCAACCCCAGCAGCCAGG + Intronic
901704021 1:11060065-11060087 CGGGCTCCGCCCCCGCCGGCAGG - Intergenic
902286122 1:15409813-15409835 CGCGCCCCGCCCCCGCCCCCGGG - Intergenic
902401907 1:16162545-16162567 CGCATCCAGGCCCCGCGGGCAGG - Intergenic
902463973 1:16603208-16603230 GGCGCCCATCCTCTGCAGGCTGG - Intronic
902779291 1:18693967-18693989 CGGGCCCCGCCCCCTCAGGATGG - Intronic
903125589 1:21245219-21245241 CCCACCAAGCCCCCGCAGGCTGG - Intronic
903597110 1:24503092-24503114 CACGCCCCGCCGCCGCAGGACGG - Exonic
903919863 1:26792180-26792202 CTCGCCCTGTCCCCCCAGGCTGG + Intronic
903975210 1:27145289-27145311 TCCGCCCAGCCCTGGCAGGCTGG + Intronic
904463146 1:30692425-30692447 CTGGTCCAGCCCCCGCAGCCAGG + Intergenic
905972914 1:42154742-42154764 GGCACCCAGCCCCCGCCTGCAGG + Exonic
906507980 1:46394222-46394244 CCCGCCCCTCCCGCGCAGGCGGG + Intergenic
906650394 1:47508617-47508639 CGCTCCCCGCCCCCGCCGGGGGG + Intergenic
906876156 1:49541517-49541539 CGAGCACAGCACCGGCAGGCCGG - Intronic
910478813 1:87636404-87636426 CGAGCACAGCGCCAGCAGGCCGG + Intergenic
911090361 1:94012650-94012672 CTCCCCCAGCCCCTGCAGCCTGG + Intronic
912717034 1:111990049-111990071 CGGGCCCAGCGGCCCCAGGCCGG + Intergenic
913091417 1:115479098-115479120 CCCGCCCAGTCCCGGCAGCCTGG - Intergenic
913995882 1:143651752-143651774 CAGCCGCAGCCCCCGCAGGCTGG - Intergenic
914492430 1:148160690-148160712 CAGCCGCAGCCCCCGCAGGCTGG - Intergenic
914789908 1:150868608-150868630 CGCGCCCGGCCTGCCCAGGCTGG - Intronic
915367333 1:155323531-155323553 CGCCCCCAGCAGCCGCAGCCCGG - Intronic
915831712 1:159137363-159137385 CACGCCCAGCCCCAGCACGTAGG - Intronic
916107205 1:161440969-161440991 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
916108792 1:161448387-161448409 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
916110380 1:161455768-161455790 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
916111965 1:161463178-161463200 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
916113552 1:161470559-161470581 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
917291597 1:173477219-173477241 CCAGCCCAGCCCCCGCGGCCCGG + Intergenic
918173429 1:182021362-182021384 CTCGCTCTGCCCCCCCAGGCTGG + Intergenic
919748650 1:201023560-201023582 CGGGCCCAGCCCCGGGGGGCCGG - Exonic
921672643 1:217943590-217943612 CCCACCTAGCCCCCACAGGCTGG - Intergenic
922792233 1:228316906-228316928 AGCGCCCAGCCCCACCACGCCGG + Exonic
922985892 1:229865639-229865661 CGAGCGCAGCGCCGGCAGGCTGG - Intergenic
924199063 1:241640533-241640555 CTCGCCCCGCCCCCACTGGCTGG + Intronic
924436810 1:244049264-244049286 CGCGCCGCGCCCCCGCGGGCCGG + Intronic
924853997 1:247857675-247857697 CGCCCGCAGCCCCCGCCGGGGGG - Intronic
1063128910 10:3160788-3160810 CTCGCCCCGTCCCCCCAGGCTGG + Intronic
1064143671 10:12810599-12810621 CGCCCCCATCTCCCTCAGGCAGG - Intronic
1064151444 10:12869001-12869023 CGCGCCCAGCCCCCACTGTCAGG + Intergenic
1067796741 10:49326613-49326635 CGCGCCCACCTTCCTCAGGCAGG + Exonic
1070172738 10:73944786-73944808 CGAGCACAGCACCCGCGGGCCGG - Intergenic
1070768013 10:79067516-79067538 CGCTCCCCTCCCCGGCAGGCGGG - Intergenic
1070828762 10:79406103-79406125 CGTGGCCAGCCCCAGCACGCAGG - Intronic
1070954274 10:80454252-80454274 CGCGCCCCGCCCCCGCCGCTCGG + Exonic
1072784047 10:98268369-98268391 GGCGCCCAGCCGCAGCCGGCGGG + Intergenic
1073325760 10:102643468-102643490 CTGGCCCCGCCGCCGCAGGCTGG + Intergenic
1073349104 10:102806762-102806784 GCCCCCCAGCCCCGGCAGGCTGG - Intronic
1074168179 10:110905270-110905292 CGCGCCCAGCCCCCACACCAGGG - Intronic
1074505514 10:114067077-114067099 TGCGCTCAGGCCCCGGAGGCTGG + Intergenic
1074814515 10:117134356-117134378 CGCGCCCAGGGCCGGCAAGCTGG + Exonic
1075627526 10:123973307-123973329 CGCGTGCAGACTCCGCAGGCGGG + Intergenic
1076417185 10:130300521-130300543 AGCGGGCAGCCCCGGCAGGCAGG - Intergenic
1076417263 10:130300794-130300816 AGCGGGCAGCCCCGGCAGGCGGG - Intergenic
1076417310 10:130300956-130300978 AGCGGGCAGCCCCGGCAGGCCGG - Intergenic
1076417418 10:130301346-130301368 AGCGGGCAGCCCCGGCAGGCGGG - Intergenic
1076417560 10:130301860-130301882 AGCGGGCAGCCCCGGCAGGCCGG - Intergenic
1076710653 10:132332022-132332044 CACACCCCGCCCCCGCACGCAGG + Intergenic
1076792776 10:132785799-132785821 CGCGCCCAGGCCCCCCAGCGCGG + Exonic
1077015553 11:397592-397614 CGCTCCCAGCACCTGCAGGTTGG - Exonic
1077081379 11:726080-726102 CGCCCCCCGCCCCCGCAGGCCGG + Exonic
1077143918 11:1036444-1036466 CGTGACCAGCCCCCGCTGCCAGG - Intronic
1077232075 11:1462262-1462284 TGTGCCCAGCCCTCCCAGGCGGG + Intronic
1077371342 11:2182933-2182955 CCTGCCCACTCCCCGCAGGCCGG + Intergenic
1078023560 11:7673871-7673893 CGCGGGCGGACCCCGCAGGCTGG + Exonic
1078631796 11:13010042-13010064 CGCGCCGGGGCCCCGCGGGCCGG - Intergenic
1079210385 11:18455799-18455821 CCCGCCCCGCCCCCGCGTGCGGG - Intergenic
1080388510 11:31824290-31824312 CGTGCCTAGCACCTGCAGGCTGG - Intronic
1081773133 11:45661934-45661956 CTCACCCTGCCCCAGCAGGCAGG + Intronic
1081890937 11:46542120-46542142 AACGCCCAGCTCCAGCAGGCTGG - Exonic
1082002419 11:47400362-47400384 GGGGCCCAGCCCCCCCAGGTGGG + Intergenic
1083334895 11:61916823-61916845 CCCGCCCCGGCCCCGCAGCCTGG - Intronic
1083596492 11:63920371-63920393 CGCTCCCTCCTCCCGCAGGCGGG + Intergenic
1083669731 11:64292965-64292987 CCCGCCCGGCCCCTCCAGGCGGG + Exonic
1083714025 11:64565475-64565497 CGCAGACAGCCCCAGCAGGCAGG + Intronic
1083768348 11:64853043-64853065 CGCGCCCGGGCCCTGGAGGCTGG + Exonic
1084083427 11:66843636-66843658 CGCGCGCAGCCCCCGCACCTGGG - Exonic
1084265619 11:68003874-68003896 CCCGCCCCGCCCCCGCCGGGGGG + Intronic
1084459132 11:69286521-69286543 CGCGCCCAGCCTGCGGCGGCTGG + Intergenic
1084956380 11:72693750-72693772 CGTGCCCAGCCCGTGCAGGATGG + Exonic
1089346571 11:117795398-117795420 CTCCCTCCGCCCCCGCAGGCTGG - Intronic
1090884158 11:130861593-130861615 CCCGCCCAGCTTCCCCAGGCTGG + Intergenic
1091223210 11:133943035-133943057 CTGGCCCAGCCCCCCCAGGCAGG + Intronic
1091335357 11:134762273-134762295 CGCCCCCAGCCTCTCCAGGCCGG - Intergenic
1091546805 12:1506598-1506620 CTCCCCCAGACCCTGCAGGCAGG - Intergenic
1094115597 12:26909067-26909089 TGCGCCCAGCCCCCACAGGGTGG - Intronic
1096116296 12:49057424-49057446 CGAGCTCAGCCCTCTCAGGCTGG + Intronic
1096214457 12:49791755-49791777 CATGCCCAGCCCCCGGAGACGGG - Exonic
1096239707 12:49953319-49953341 AGTGCCCAGCCCCAGAAGGCAGG + Intronic
1096372768 12:51083092-51083114 CGCGAGCTGCCCCCGCAGTCCGG + Intronic
1097281959 12:57850490-57850512 CTGGCCCAGGCCCCGTAGGCAGG - Intergenic
1097990324 12:65825848-65825870 CGCGAGCAGCCCCGGGAGGCGGG - Intronic
1101119311 12:101562865-101562887 CTCGCTCTGCCCCCCCAGGCTGG + Intergenic
1102002008 12:109563271-109563293 CTTGCCCAGCCCCCACAGCCAGG - Intronic
1117119701 14:52553606-52553628 CCCGCCCGGGCCCCGCATGCCGG - Intronic
1117378601 14:55138110-55138132 AGCCCCCTGCCCCAGCAGGCTGG - Exonic
1117819170 14:59630574-59630596 CGAGCCCAGCCGCAGCAGCCGGG - Intronic
1122736585 14:103847205-103847227 GGCTCCCAGCCCCCGCGGGCCGG - Intronic
1122779202 14:104136517-104136539 CGCCCCCATCTCCAGCAGGCTGG - Intergenic
1123036760 14:105474781-105474803 CGCGCCCAGCCCCGCCTGCCCGG - Intronic
1123399912 15:19973922-19973944 CCCGCCCCGCCCCTGCAGGGAGG + Intergenic
1126023803 15:44427167-44427189 CGCGCCCTTGCCCCGGAGGCGGG - Intergenic
1126668443 15:51094781-51094803 CGCTCCCCGCGCCCGCCGGCCGG + Intronic
1127606569 15:60592682-60592704 CCCGCCCCGCCCCCGCGGGCAGG + Intronic
1129612264 15:77070615-77070637 CGCGCTCGGCCCACGCGGGCTGG - Intronic
1129743069 15:77999572-77999594 GGCTGCCAGCCCCAGCAGGCGGG + Intronic
1129752863 15:78077815-78077837 CCCCCTCAGCCCCCGGAGGCAGG + Intronic
1130115742 15:81002686-81002708 GGCGCCCAGCCCGCGCAGCCGGG + Exonic
1132591493 16:728157-728179 CGCGCCCAGCACCGCCAGCCCGG - Exonic
1132697787 16:1209649-1209671 AGAGCCCAGCCCCCGTATGCAGG - Intronic
1132896723 16:2232711-2232733 CCCGGGCAGCCCCAGCAGGCTGG - Intronic
1132971509 16:2691533-2691555 CGCGCCGAGTCCACGCAGCCTGG + Intronic
1133136814 16:3717780-3717802 CGCCCCCGGCCCACGCTGGCCGG + Intergenic
1134640727 16:15827511-15827533 CACTCCCAGCCCCACCAGGCTGG - Intronic
1138370112 16:56519962-56519984 CGGCCCCAGCCGCCTCAGGCCGG + Exonic
1138490259 16:57372420-57372442 CGCCTCCAGCCCCCGCAGGCAGG - Intergenic
1139366602 16:66437530-66437552 CACCCACAGCCCCTGCAGGCTGG - Intronic
1139504938 16:67394042-67394064 CTCGCCCAGCCCCAGGATGCTGG + Intergenic
1139570235 16:67806996-67807018 CGAGCCTAGCGCCCGCGGGCTGG - Intronic
1139583115 16:67884832-67884854 TCCGCCCAGCCCCCGGAGGGAGG - Exonic
1139826691 16:69762570-69762592 CGCGCCCACCCCACTCGGGCGGG - Intronic
1139954192 16:70685571-70685593 GGCGCCCAGCAGACGCAGGCAGG + Intronic
1140926785 16:79590793-79590815 CTCTCCCAGCCTCTGCAGGCAGG + Intronic
1141781331 16:86163640-86163662 GTCGCCCAGGCCCCCCAGGCTGG + Intergenic
1142393244 16:89816320-89816342 CGCCCCCAGCCGCCGCCCGCGGG - Intronic
1143092551 17:4457640-4457662 GGCCCCCAGCCCCAGCTGGCTGG - Intronic
1143166639 17:4900286-4900308 CGGGCCCAGCCCCAGACGGCAGG + Exonic
1144756003 17:17681248-17681270 CGCGCCCCCCGCCCGCTGGCCGG - Intergenic
1145041288 17:19579914-19579936 CGCTCCCAGCCTCCGCATGGAGG + Intergenic
1146062743 17:29615630-29615652 CGGGCCCAGCCCAAGAAGGCGGG + Exonic
1146720430 17:35119816-35119838 CGCGCCCAGAGCCCGCCCGCCGG + Intronic
1147970765 17:44218474-44218496 CTCCCCCAGCCCCTGCAGCCCGG + Intronic
1148504271 17:48114956-48114978 TGCGCCCAGCCTGGGCAGGCTGG + Intronic
1148684778 17:49495307-49495329 CGCGGCCAGCTCCGGCGGGCAGG + Exonic
1148848404 17:50542116-50542138 CGGCCCCCGCCCCCGCAGACCGG + Exonic
1149293392 17:55238550-55238572 CGCGCCCAGCCCCGTCACGTTGG - Intergenic
1149660664 17:58332601-58332623 CGCGCCCCGCCCCCGCCCGCAGG + Intergenic
1150060597 17:62065399-62065421 CGCGAGCAGCCCCCGCCGCCCGG + Intergenic
1150293316 17:63993844-63993866 CCCTCCCAGCCCCCGGAGTCAGG - Intergenic
1150821280 17:68436282-68436304 CGCCTCCAGCCCCCGACGGCAGG + Intronic
1151558878 17:74860521-74860543 CCCGCCCTGCCCGCGTAGGCAGG + Intronic
1151697410 17:75724554-75724576 GGCGCCCAGCCGCCAGAGGCAGG - Intronic
1152640273 17:81446437-81446459 CACCCCCAGCCCCGGCAGCCAGG + Intronic
1152708938 17:81860592-81860614 CGCGGCCAGCGCGCGCGGGCGGG - Exonic
1153688351 18:7567770-7567792 CGCGCCCACCCACCGCCGCCGGG + Exonic
1154169222 18:12038660-12038682 CGCCCCCAGTCCCCGCAGCCCGG + Intergenic
1154355279 18:13619816-13619838 GGCCCCCTGCCCCCGCAGGCAGG - Intronic
1160242196 18:77132283-77132305 CGCGCCCAGCCCCCGCGCAATGG + Intronic
1160856635 19:1220788-1220810 CACGCCCTGCGCCCACAGGCCGG - Intronic
1161068852 19:2250699-2250721 CGCGCCAGGCCCCCGCAGGGCGG - Exonic
1161428540 19:4217568-4217590 CGCCTCCAGCTCCCGCAGGCGGG - Exonic
1161704842 19:5814850-5814872 CGCTCCCAGCCCCTCCAGGAAGG + Intergenic
1162100399 19:8335358-8335380 CGCGCCCAGCCCCGGCCGCGGGG - Exonic
1162799488 19:13102950-13102972 CGCCCCCAGCCGGCGCTGGCAGG + Intronic
1162808574 19:13151390-13151412 CCCGCCCTTCCCCCGCACGCTGG - Intronic
1162959679 19:14118280-14118302 CGCGCCCCTCCCCCGCTGGCAGG - Intergenic
1163154514 19:15432578-15432600 CCCGCCCAGCCCCCCGAGCCCGG - Intronic
1163288545 19:16364310-16364332 AGTGCCCAGCCCACGCGGGCAGG + Intronic
1163462659 19:17448325-17448347 GGCGCGCAGCCCCCGCAGCTCGG + Exonic
1163613129 19:18311153-18311175 GGCGCCCAGCTCTCCCAGGCAGG + Intronic
1165345978 19:35249063-35249085 CCCACCCGGCCGCCGCAGGCCGG + Exonic
1165495823 19:36151602-36151624 CGCGCCGAGCCGGGGCAGGCGGG - Intronic
1166687872 19:44807015-44807037 AGCGCCCAGCCTCAGCTGGCTGG + Intergenic
1166808039 19:45498623-45498645 CGCGCCCAGCGGCCGCACGGGGG + Exonic
1167880249 19:52451523-52451545 CGGGCCCAGCCCGCGGAGGAGGG + Intronic
1168145965 19:54420385-54420407 CGGCCCCAGCCCCCGCAGCCTGG + Intronic
1168269595 19:55242275-55242297 CTGCCCCTGCCCCCGCAGGCAGG - Exonic
1168345473 19:55648475-55648497 CGCGCCCAGCCCCCACCACCGGG + Exonic
1202679631 1_KI270711v1_random:40648-40670 GGCGCCCATCCTCTGCAGGCTGG - Intergenic
925836419 2:7951198-7951220 CGGGCCCAGCCCCCGCCGTGTGG + Intergenic
927633281 2:24793030-24793052 CGCACCCACTCCCCGCAGCCAGG + Intronic
930872529 2:56183832-56183854 CGCCCCCAGCCCTCCCGGGCAGG + Intergenic
932364927 2:71144735-71144757 CATGCCCAGCCCCAGCTGGCAGG - Intronic
932562709 2:72887318-72887340 CCCGCCCCGCCCCGGCAGGGCGG + Intergenic
935396947 2:102619500-102619522 CCCGCCCCGCCCCCGCCCGCGGG + Intergenic
936412793 2:112275507-112275529 CGCGCTCGGCCCCGGCGGGCTGG + Intergenic
937283508 2:120736139-120736161 CCCGCCCCGCCCCGGCTGGCTGG + Intronic
938119927 2:128626150-128626172 CGAGCTAAGCCCCTGCAGGCTGG + Intergenic
938315074 2:130319321-130319343 CCCGCCCATCCCCTCCAGGCTGG - Intergenic
938382876 2:130846503-130846525 GGGTCACAGCCCCCGCAGGCAGG - Intronic
942360737 2:175168639-175168661 CGAGCCCAGCCCCAGGAGCCGGG + Intergenic
944242545 2:197500017-197500039 CGCGCTCAGCCCTCTCCGGCCGG + Exonic
945080878 2:206085528-206085550 CGCGCCCTGCCCCCGCACCCCGG - Intronic
948242172 2:236446894-236446916 CACGCCCAGCAGCCGCAGTCAGG - Intronic
948702607 2:239769712-239769734 AGAGCCCAGCCCCAGCTGGCAGG - Intronic
948727971 2:239946283-239946305 CGGCCCCAGCCCCAGCAGACGGG + Intronic
949048162 2:241881753-241881775 CCCGTCCAGCCCCCGCACACAGG - Intergenic
1168811988 20:710318-710340 CGCCCCCAGCCCCCGGCCGCTGG - Intergenic
1171012139 20:21514601-21514623 CGCGCCCACCCCCGGCAAGCCGG + Intergenic
1171421497 20:25020732-25020754 CACACCCAGCCCCCAAAGGCAGG + Intronic
1172661749 20:36573481-36573503 TGCGCCCACCCCCCGCGGGGCGG - Exonic
1176418955 21:6499095-6499117 CGCGCCCAACCCCCGGCGGGGGG + Intergenic
1179225083 21:39445813-39445835 CGCGCCCAGCCCCCGCAGGCCGG - Intergenic
1179574107 21:42296262-42296284 CACGTCCAGCTCCCGCAGGATGG - Exonic
1179643246 21:42760654-42760676 CCCCCCCAACCCCCACAGGCAGG + Intronic
1179694448 21:43107417-43107439 CGCGCCCAACCCCCGGCGGGGGG + Intronic
1179911986 21:44455489-44455511 CGCCCCTCGCCCGCGCAGGCCGG + Exonic
1180622596 22:17171832-17171854 GGCGCCCAGACCCCGCCCGCGGG - Intergenic
1180959170 22:19754967-19754989 TGCGCCCTGCCCTGGCAGGCAGG + Intergenic
1181457940 22:23070310-23070332 CGCGCCGCGCCGCCGCCGGCAGG - Intronic
1183293801 22:37018631-37018653 CGCGTCCAGCACCCGCAGGCCGG + Exonic
1183301888 22:37062697-37062719 CCCGCCCCGCCCCTGGAGGCAGG - Exonic
1183546110 22:38455500-38455522 CCCTCCCCGCCCCCGCCGGCCGG + Intergenic
1184620288 22:45671782-45671804 CGCGCCCCCTCCCCTCAGGCGGG + Exonic
1184950708 22:47840706-47840728 GGCTCCCTGCCCCTGCAGGCTGG + Intergenic
1185037820 22:48489110-48489132 CGCCCCCATCCACCGCAGCCAGG - Intergenic
1185223585 22:49640971-49640993 CACCCCCAGCCTCCACAGGCTGG + Intronic
950472076 3:13192660-13192682 CTCTCACTGCCCCCGCAGGCTGG - Intergenic
951521107 3:23611528-23611550 CCCGCCCAGGCCCTGGAGGCTGG - Intergenic
951543698 3:23806258-23806280 CCTGCCCATCCCCCGCGGGCGGG - Intronic
953598286 3:44338294-44338316 CGCGCCGAGACCCCTCAGGGCGG + Intronic
953778203 3:45841717-45841739 TGGCTCCAGCCCCCGCAGGCAGG + Intronic
961182349 3:124886950-124886972 CGCGCAGAGCCCCAGGAGGCAGG + Exonic
961774273 3:129272749-129272771 GGAGCCCATCCCCTGCAGGCTGG + Intronic
962240302 3:133746334-133746356 TGCGCCCAGCCCGCCCAGGCCGG + Exonic
963200198 3:142578645-142578667 CCTGCCCAGCTCCCGCAGGGCGG + Exonic
964452653 3:156826561-156826583 CGCGCCTGGGCCCCGCGGGCTGG - Exonic
968092852 3:195909233-195909255 CGCCCCCAGCCCGCGCCGTCCGG + Intronic
968621534 4:1605441-1605463 CACGCCCAGCCCCTGGAAGCTGG - Intergenic
968649725 4:1755745-1755767 CACGCCCAGGCCCCGGGGGCAGG + Intergenic
968913515 4:3487278-3487300 TGGGCCCAGCCCCCGCAGGCTGG + Intronic
968965209 4:3766132-3766154 CGCGCCGAGCCCTAGCCGGCCGG + Intergenic
969032818 4:4227441-4227463 CGCGCACACCCCCCTCGGGCTGG - Intergenic
969227493 4:5808262-5808284 CACGCCCAGCAGCAGCAGGCAGG + Exonic
969330819 4:6472608-6472630 CGGCCCCAGCCCGCGCAGCCCGG - Intronic
976186011 4:82443435-82443457 CGCGCCCAGCCCCCATTGGTGGG - Intronic
978384471 4:108166944-108166966 CCCGCACCGCCCCCGCAGCCCGG + Intronic
982468684 4:155760149-155760171 CGCTCCCAGGCTCAGCAGGCCGG + Intronic
985960738 5:3301508-3301530 GGCCCCCTGCCCCCGTAGGCCGG + Intergenic
992967395 5:82016979-82017001 TGCGCCCAGCCCCAGCAGTTTGG + Intronic
994353803 5:98773727-98773749 CCCGCCGAGCCCACGCTGGCTGG + Intronic
997120067 5:131164820-131164842 CGCGCCCAGGCCCCGCGGTGCGG + Intronic
997581486 5:135020001-135020023 CTCACCCAGCCCCTCCAGGCAGG - Intergenic
997986109 5:138502732-138502754 TGTGCCCAGCCTCCCCAGGCTGG - Intergenic
998129534 5:139644360-139644382 TGTGCCCTGCCCCAGCAGGCAGG + Intergenic
999478670 5:151925040-151925062 CGCCCCTAACCCCCTCAGGCCGG - Intergenic
1001530051 5:172455035-172455057 CGGGCGCAGCACCGGCAGGCAGG - Intergenic
1002616463 5:180459354-180459376 CGAGCACAGCACCAGCAGGCCGG - Intergenic
1002691338 5:181052887-181052909 CTCGCCCCGCGTCCGCAGGCGGG - Intronic
1006986706 6:38180292-38180314 CACGCCCAGCCCCAGCAGCGTGG - Intronic
1007698138 6:43746885-43746907 CGCTCCCAGCCCCCCAAGGGAGG - Intergenic
1010221356 6:73451740-73451762 CGTGCCCAGCCCCGGCCTGCCGG - Exonic
1010413082 6:75582832-75582854 CTCGCTCTGCCCCCCCAGGCTGG + Intergenic
1012450727 6:99350048-99350070 CGCTCCCAGCCCCCGCCTGGTGG - Intronic
1013196409 6:107848464-107848486 GGCGCTCAGCCCCCGGAGTCCGG - Intergenic
1017793922 6:157823937-157823959 GGCCGCGAGCCCCCGCAGGCCGG - Intronic
1018686441 6:166307853-166307875 TGCGCCCCGCCCCGGCCGGCAGG - Exonic
1019343413 7:518874-518896 GGCGCACACCCCCCGCCGGCTGG - Intronic
1019713641 7:2528758-2528780 GGAGCCCAGCCCCTGCAGGAGGG + Intronic
1020282357 7:6656061-6656083 CGCCCCCAGCCCTGGCAGCCTGG - Exonic
1021162954 7:17298768-17298790 CGCGCCCGAGCTCCGCAGGCGGG + Exonic
1022114378 7:27249478-27249500 CGCTCCCAGGCCCTGCCGGCTGG - Intergenic
1023172098 7:37399490-37399512 CGAGCCCAGCACACGCAGGGTGG + Intronic
1023984828 7:45088493-45088515 GCGGCCCAGCCCCAGCAGGCTGG + Intronic
1025869065 7:65413950-65413972 TGCGCCCAGCCCAACCAGGCTGG + Intergenic
1032151819 7:129435165-129435187 CTCGCTCAGCCCTCACAGGCAGG - Intronic
1034219266 7:149431680-149431702 GGCGCCCCGCCCCCGCCCGCTGG + Exonic
1034219302 7:149431750-149431772 CGCGCCCCGCCGCCGCCGCCCGG - Exonic
1035126049 7:156608212-156608234 CAGGCCCAGCCCCTGCAGCCCGG + Intergenic
1035717403 8:1764265-1764287 CACGCCCAACCCGCGCAGGCAGG - Intronic
1035751122 8:1997131-1997153 CTCGCCCACCCCCCGCCGGAGGG - Intronic
1036739398 8:11347526-11347548 CGCGCACGCCCCCCGCAGGGAGG - Intergenic
1037763495 8:21757326-21757348 AGCCCCCACCCCCAGCAGGCAGG + Intronic
1037926209 8:22845953-22845975 CGGGCCCAACCCCAGCAAGCAGG - Intronic
1038335417 8:26641754-26641776 CGCCCCCACCCCCAGCAGGAGGG - Intronic
1040672815 8:49712949-49712971 CACTCCCAACCCCCGCAGGCAGG - Intergenic
1041021668 8:53644150-53644172 CGCGCACAGCTCTCCCAGGCAGG - Intergenic
1045222558 8:100213209-100213231 CGGGGCCAGACCCCGGAGGCCGG + Exonic
1045571241 8:103371323-103371345 CCCGCCCAGACCCTGCAGGCGGG + Intergenic
1049419285 8:142509934-142509956 CAAGCCAAGCCCCAGCAGGCAGG + Intronic
1049641867 8:143719488-143719510 GGTGCCCAGCCCCAGCAGCCTGG - Intronic
1049643965 8:143727858-143727880 CGCGCCCGGACCCCGCGGCCTGG - Exonic
1049693688 8:143973578-143973600 CCCGCCCCGCCCCCGCACCCAGG + Intronic
1049795043 8:144493365-144493387 CCTGCCCAGCCCCCTCAGCCTGG + Intronic
1052576587 9:30299450-30299472 CGAGTGCAGCCCCAGCAGGCCGG - Intergenic
1052740221 9:32385090-32385112 CTCGCCCAGGCCCGGCTGGCTGG + Intronic
1057291641 9:93810721-93810743 AGTGCCCAGCCCCAGCAGGGGGG + Intergenic
1057573212 9:96219420-96219442 CAGGCACGGCCCCCGCAGGCCGG - Intergenic
1060917940 9:127402539-127402561 TCCACCCACCCCCCGCAGGCTGG + Exonic
1060931108 9:127490054-127490076 ACCCCCCACCCCCCGCAGGCCGG + Intronic
1061280828 9:129597039-129597061 CCCTCCCATCCCCCGCAGGGAGG + Intergenic
1061293501 9:129665532-129665554 CGCCCCCAGCGCCAGCAGCCGGG + Intergenic
1061680929 9:132242127-132242149 CGCTCCCCGCACCCGGAGGCCGG + Exonic
1062234259 9:135500552-135500574 CGTGCCCCGCCCCCGCAGGGAGG + Exonic
1062342558 9:136100261-136100283 CGCTCTCGGCCCCCTCAGGCTGG - Intergenic
1203791627 EBV:154707-154729 CGCTCACATCCCCTGCAGGCGGG - Intergenic
1185504221 X:619739-619761 CCAGGCCAGCCCCCGGAGGCAGG + Intergenic
1187533511 X:20116822-20116844 CCCGCGCAGTCCCCTCAGGCCGG + Exonic
1189251194 X:39601707-39601729 GGCCCCCAGCCCCCGCCTGCTGG + Intergenic
1199264863 X:145818126-145818148 GGCGCCCAGCCTCCCCACGCTGG - Intronic