ID: 1179225085

View in Genome Browser
Species Human (GRCh38)
Location 21:39445828-39445850
Sequence TGGGCGCGCGCATGCGCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 69}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225065_1179225085 30 Left 1179225065 21:39445775-39445797 CCCCATGGAAACCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225067_1179225085 29 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225077_1179225085 3 Left 1179225077 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225072_1179225085 19 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225083_1179225085 -8 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225073_1179225085 18 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225069_1179225085 28 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69
1179225075_1179225085 6 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225085 Original CRISPR TGGGCGCGCGCATGCGCACT CGG Intergenic
903247345 1:22025683-22025705 TGGCCGCGAGCAAGCGTACTCGG - Intergenic
904847476 1:33430949-33430971 CGGGCGGGCGCGTGCGCGCTGGG - Intronic
914393450 1:147242615-147242637 GGGGCGCGCGACTGCGCGCTGGG - Intronic
915646165 1:157274148-157274170 TGTGCGCGCGCGCGCGCGCTTGG + Intergenic
921185464 1:212665953-212665975 TGGGTCCGCGCGCGCGCACTTGG + Intergenic
924139538 1:241007882-241007904 TGTGCGGGCACATGCGCACAGGG + Intronic
1069044064 10:63723981-63724003 TGGGCGCTCCCATGCACCCTCGG + Intergenic
1069688672 10:70335380-70335402 TGGGCGCGGGCGGGCGGACTGGG - Intronic
1069913596 10:71774031-71774053 TGCGCGCGCGCATGCACTCAGGG - Intronic
1072994195 10:100228973-100228995 TGCGCGCGCGCGCGCGCGCTTGG - Intronic
1074810205 10:117096995-117097017 TGTGCGCGCGCGTGCGCGCTTGG - Intronic
1077062563 11:624322-624344 TGGGCCAGCGCCTGCCCACTTGG - Intronic
1089977443 11:122744896-122744918 TGTGCGCGCGCGCGCGCACTTGG + Intronic
1092899370 12:13044372-13044394 CGGGCGCGCGCACGCGCACCGGG + Exonic
1094846009 12:34361722-34361744 TGGCCCCACGCATGCGCTCTGGG + Intergenic
1095180862 12:39145229-39145251 TGGGCGCGCGCTTTCGCGCCGGG - Intergenic
1096482448 12:51951679-51951701 GGGGCGCGCGCGCGCGCGCTGGG + Exonic
1108292514 13:48975868-48975890 GGGGCCCGCGCAGCCGCACTCGG + Intergenic
1109515416 13:63437583-63437605 TGGGCTCACACATGCACACTAGG - Intergenic
1109897172 13:68708562-68708584 TGAGGACCCGCATGCGCACTGGG + Intergenic
1125903677 15:43371065-43371087 TGCCCTCGCGCATGCGCCCTCGG - Intronic
1127415134 15:58749924-58749946 GGGGCGCGCGCATGCGCGCGGGG + Exonic
1128594318 15:68930382-68930404 GCGGAGCGAGCATGCGCACTAGG + Intronic
1134491450 16:14698797-14698819 TGGGCGTGTGCCTCCGCACTGGG - Intergenic
1134496831 16:14737915-14737937 TGGGCGTGTGCCTCCGCACTGGG - Intronic
1137855753 16:51792932-51792954 TGCGCGCGCGCGCGCGCCCTAGG - Intergenic
1139678085 16:68539275-68539297 TGGAAGTGCGCCTGCGCACTCGG - Exonic
1142421374 16:89972583-89972605 CGGGCGCGCGCATGCGCAATGGG - Intergenic
1146922390 17:36722425-36722447 GCGGCGAGCGCATGCGCGCTGGG - Intergenic
1149297898 17:55277272-55277294 TGTGCGCGCGCATGTGTACGTGG + Intronic
1152246523 17:79187521-79187543 TGGGCTTGGGCATGAGCACTGGG + Intronic
1159003365 18:62992228-62992250 TGGGCGCGCCCAGGCGCCCTGGG + Intergenic
1160429131 18:78799602-78799624 TGCGCGCGCGCGTGTGCAGTGGG - Intergenic
1160990163 19:1857154-1857176 GAGGCGCGCACATGCGCACGTGG + Intronic
1161925327 19:7294882-7294904 TGGGGGCGCCCACGCGCTCTGGG - Intergenic
929466791 2:42152355-42152377 TGCGCGCGCGCGCGCGCACTAGG - Intergenic
941200002 2:162496384-162496406 TAAGGGCCCGCATGCGCACTGGG + Intronic
1171376025 20:24694560-24694582 TGGCCCCGAGCATGCACACTGGG + Intergenic
1174374004 20:50113191-50113213 TGCGCGCGCGCCTGCGCATCAGG - Intronic
1177077012 21:16588645-16588667 TGTGCGCGCGCGTGCTCGCTCGG + Intergenic
1179012105 21:37564011-37564033 TGGGCCCACGCCTGCGCGCTCGG - Intergenic
1179225085 21:39445828-39445850 TGGGCGCGCGCATGCGCACTCGG + Intergenic
1180338624 22:11600401-11600423 TGGACCCGCGCATGCGCAGTAGG + Intergenic
1181574891 22:23787364-23787386 CGGGCGCGCGCGCGCGCGCTCGG + Intronic
1182549259 22:31092207-31092229 TGGGTGGGCGCAGGGGCACTGGG - Intronic
1183702385 22:39457682-39457704 GGGGCGGGCGCGGGCGCACTGGG + Intronic
1183802494 22:40178772-40178794 TGCGCGCGCTCATTTGCACTGGG + Intronic
953598396 3:44338714-44338736 TTCGGACGCGCATGCGCACTGGG - Exonic
956552467 3:70477034-70477056 TGGGCTCAAGCATGTGCACTAGG + Intergenic
967171789 3:186827558-186827580 CGCGCTCGCGCAGGCGCACTAGG - Intergenic
967994176 3:195154301-195154323 TGGGCTCAAGCATGTGCACTAGG + Intronic
968630709 4:1649558-1649580 GGGGCCCGCTCATGCCCACTGGG + Intronic
968724877 4:2242138-2242160 TGGACGCGCGCAAGCGCACAAGG + Intronic
970394833 4:15655371-15655393 GGGGCGGGCGCATGCGCAAGGGG - Exonic
974700861 4:65443940-65443962 TGCACGCGCACATGCGCACTGGG + Intronic
985445326 4:190018557-190018579 CGGGCGCGCGCACACGCACACGG - Intergenic
989578133 5:43007737-43007759 TAAGAGCGCGCATGCGCACTGGG + Intergenic
996836854 5:127803336-127803358 TGGGTGCCCACATGTGCACTGGG - Intergenic
1003561841 6:7186901-7186923 TGGGCAGGGGCATGCCCACTGGG + Intronic
1004174579 6:13328569-13328591 CGGGCGGGCGCATGCGCAGAGGG + Intronic
1006169706 6:32085903-32085925 CGGGCACCCGCATGCGCAGTTGG + Intronic
1007897554 6:45378039-45378061 AGTGCGGGCGCATGCGCGCTTGG + Intronic
1009723064 6:67500722-67500744 TGTGTGTGTGCATGCGCACTTGG - Intergenic
1013528606 6:110998364-110998386 TGGGCTCAAGCATGCACACTAGG - Intronic
1015403712 6:132814503-132814525 TGGGAGTGCACATGCGCACAGGG + Exonic
1015580117 6:134715048-134715070 TGGGCTCATGCATGCGCACTAGG - Intergenic
1017913945 6:158818371-158818393 TGGGCGCGCGCCCCCGCTCTCGG - Intronic
1026097407 7:67357392-67357414 TGAGGGCCCGCATGCACACTAGG - Intergenic
1034446255 7:151115616-151115638 TGGGCGCGCGCAGGAGCTCCGGG - Intronic
1034940701 7:155228422-155228444 TGGTCGCCCGCATGTGCTCTAGG - Intergenic
1037878412 8:22560872-22560894 TGCGCGCGCGCACGCGCCGTGGG + Intronic
1040564254 8:48551861-48551883 TGGGCGCTGGGAAGCGCACTGGG - Intergenic
1042064871 8:64863625-64863647 TGTGTGTGTGCATGCGCACTTGG - Intergenic
1042551114 8:69994832-69994854 GAGGCTTGCGCATGCGCACTGGG + Intergenic
1042611838 8:70608404-70608426 CGGGGGCGAGCATGCGCACCAGG + Intergenic
1049772983 8:144392315-144392337 AGGGCGCACGCAGCCGCACTGGG + Exonic
1049815966 8:144600435-144600457 TGGAGGCGTGCATGTGCACTTGG + Intronic
1049815983 8:144600607-144600629 TGGAGGCGTGCGTGCGCACTTGG + Intronic
1062467630 9:136688008-136688030 TGGGGGCGCGCAGGCCAACTGGG + Intergenic
1062587305 9:137255179-137255201 CGGGTGGGCGCATGCGCGCTGGG + Exonic
1187265001 X:17723768-17723790 TGTGCGCGCGCGTGCGCGCATGG + Intronic
1190267195 X:48834365-48834387 TGGGCGCCAGCAAGGGCACTTGG - Intronic