ID: 1179225086

View in Genome Browser
Species Human (GRCh38)
Location 21:39445829-39445851
Sequence GGGCGCGCGCATGCGCACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179225069_1179225086 29 Left 1179225069 21:39445777-39445799 CCATGGAAACCCGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225067_1179225086 30 Left 1179225067 21:39445776-39445798 CCCATGGAAACCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225075_1179225086 7 Left 1179225075 21:39445799-39445821 CCTCCTGGGAAGCGCCGGCCTGC 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225072_1179225086 20 Left 1179225072 21:39445786-39445808 CCCGCGCGCGGGGCCTCCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225073_1179225086 19 Left 1179225073 21:39445787-39445809 CCGCGCGCGGGGCCTCCTGGGAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225077_1179225086 4 Left 1179225077 21:39445802-39445824 CCTGGGAAGCGCCGGCCTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1179225083_1179225086 -7 Left 1179225083 21:39445813-39445835 CCGGCCTGCGGGGGCTGGGCGCG 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG 0: 1
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179225086 Original CRISPR GGGCGCGCGCATGCGCACTC GGG Intergenic
900600431 1:3500442-3500464 AGGCACGCACATGCGCACTGCGG - Intronic
903247344 1:22025682-22025704 GGCCGCGAGCAAGCGTACTCGGG - Intergenic
903657302 1:24957217-24957239 TGGCGCGAGCCTGAGCACTCCGG - Intronic
904847475 1:33430948-33430970 GGGCGGGCGCGTGCGCGCTGGGG - Intronic
914393449 1:147242614-147242636 GGGCGCGCGACTGCGCGCTGGGG - Intronic
918199422 1:182253399-182253421 GGGCTCAAGCATGCACACTCAGG + Intergenic
922674406 1:227542025-227542047 CGGCTCCCGCATGCGCGCTCTGG - Intergenic
1062990386 10:1809264-1809286 GGACACGCGCATGCGCACACAGG - Intergenic
1066963527 10:42241990-42242012 GGGTGCTGGCCTGCGCACTCCGG - Intergenic
1069044065 10:63723982-63724004 GGGCGCTCCCATGCACCCTCGGG + Intergenic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1077010385 11:376805-376827 GGGCGCCCGCAGCTGCACTCTGG - Exonic
1083562128 11:63681441-63681463 GCGAGCGCGCATGCGCACAAAGG - Intronic
1084049953 11:66593086-66593108 GCGGCCGCGCAGGCGCACTCGGG - Exonic
1084193312 11:67508736-67508758 GGGCGGGCGCATGCGCAGATCGG - Intergenic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1092899371 12:13044373-13044395 GGGCGCGCGCACGCGCACCGGGG + Exonic
1099020099 12:77392654-77392676 GCGTGTGCGCATGCGCACACAGG - Intergenic
1101354716 12:103966119-103966141 TGGCGCGCGCGCGCGCACGCAGG + Intronic
1101354729 12:103966175-103966197 GGGGCCGCGCGTGCGCACTGTGG + Intronic
1103373561 12:120437887-120437909 GGGCACACGCATGCGCACGAAGG + Intergenic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1106389020 13:29317398-29317420 GCGCGCGCACAAGCGAACTCAGG - Intronic
1109284564 13:60396433-60396455 GGCGGCGCGCATGCCCACTCAGG + Intergenic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1121044239 14:90776347-90776369 GGGCTCAAGCATGCGCACTAAGG + Intronic
1127415135 15:58749925-58749947 GGGCGCGCGCATGCGCGCGGGGG + Exonic
1129051229 15:72783546-72783568 GGGCCCGCGCCTGCGCCCCCGGG - Exonic
1139365010 16:66427562-66427584 GGGCGGGCGGATGCGCGGTCCGG + Intronic
1140613808 16:76634972-76634994 GCCCGCGCGCAGGCGCACTCCGG - Intronic
1146922389 17:36722424-36722446 CGGCGAGCGCATGCGCGCTGGGG - Intergenic
1147738941 17:42659548-42659570 CGGCGCTCGCTTGCTCACTCTGG - Exonic
1151543324 17:74776478-74776500 GGGCCGGCGCATGCGCGCTGCGG + Exonic
1159003366 18:62992229-62992251 GGGCGCGCCCAGGCGCCCTGGGG + Intergenic
1160990164 19:1857155-1857177 AGGCGCGCACATGCGCACGTGGG + Intronic
1161572001 19:5035887-5035909 GCGCGCGCGCCTGCGCGCACAGG + Intronic
1162584513 19:11550912-11550934 GCGCGCGCGCATTGGCTCTCTGG - Intergenic
1166064414 19:40348667-40348689 AGCCGCGCGCAGGCGCACTACGG - Exonic
1168013641 19:53554488-53554510 GCCAGCGCGCATGCGCACCCCGG - Intronic
1168629713 19:57947364-57947386 GGCCGCGAGCAAGCGCCCTCGGG + Intronic
924958369 2:11141-11163 GCGCCCGCGCAGGCGCACACAGG + Intergenic
924958374 2:11170-11192 GCGCCCGCGCAGGCGCACACAGG + Intergenic
924958379 2:11199-11221 GCGCCCGCGCAGGCGCACACAGG + Intergenic
924958384 2:11228-11250 GCGCCCGCGCAGGCGCACACAGG + Intergenic
924958389 2:11257-11279 GCGCCCGCGCAGGCGCACACAGG + Intergenic
926630213 2:15129018-15129040 GGGCCCGCCCATGGGCACTCAGG - Intergenic
929697698 2:44133213-44133235 GGGCTCAAGCATGCGCACTGAGG + Intergenic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
932856359 2:75237595-75237617 GGGTGCACTCATGCACACTCAGG - Intergenic
942034728 2:171999843-171999865 GGGAGCGCGCGTGCGCGCGCGGG - Exonic
944675548 2:202032656-202032678 GGGCGCTCGCGCGCGCTCTCTGG - Intergenic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
1168851132 20:977922-977944 GGGCACCCGCCTGCCCACTCAGG + Intronic
1176097103 20:63349238-63349260 GGGCAGGCACAGGCGCACTCTGG + Intronic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1177609158 21:23423382-23423404 GGGCTCAAGCATGCGCACTAAGG + Intergenic
1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG + Intergenic
1180093049 21:45542409-45542431 GGCCCCGCGCACGCGGACTCCGG + Exonic
1180215959 21:46324034-46324056 GGTCTCGCGCACGCGCGCTCTGG - Intergenic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1181638740 22:24186116-24186138 GGGCCCGCGCCTGCACCCTCAGG - Exonic
1183369846 22:37426327-37426349 GCGCGTGTGCATGCACACTCGGG - Intronic
1183702386 22:39457683-39457705 GGGCGGGCGCGGGCGCACTGGGG + Intronic
1183939624 22:41286020-41286042 GAGCGCGCGCCTCCGCCCTCTGG + Intronic
1184023005 22:41833421-41833443 GGGTGGGCGCACGCGCACCCGGG - Intronic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
963236670 3:142963356-142963378 GGGCGCGCGCAGGCGACCTCTGG + Exonic
967171788 3:186827557-186827579 GCGCTCGCGCAGGCGCACTAGGG - Intergenic
968630710 4:1649559-1649581 GGGCCCGCTCATGCCCACTGGGG + Intronic
970394832 4:15655370-15655392 GGGCGGGCGCATGCGCAAGGGGG - Exonic
974700862 4:65443941-65443963 GCACGCGCACATGCGCACTGGGG + Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
978645785 4:110929711-110929733 GCGCGCGCGCGTGTACACTCAGG + Intergenic
981604016 4:146522819-146522841 GGGCGCGCGGGTGCCCGCTCTGG + Intergenic
986317660 5:6601423-6601445 GGCCGAGCGCATGAGCACCCTGG - Intronic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
989578134 5:43007738-43007760 AAGAGCGCGCATGCGCACTGGGG + Intergenic
992286114 5:75237003-75237025 GCGCGCGCGCAGGCCTACTCTGG + Intergenic
997485382 5:134226396-134226418 GGCCGCGCGCAGGCGCAGACCGG + Intergenic
998897408 5:146814589-146814611 GGGCTCAAGCATGCGCACTAAGG + Intronic
999768087 5:154755748-154755770 GGGCGCGCAGATGGCCACTCAGG + Intronic
1004720445 6:18264216-18264238 GGGCGGGCGCGCGCGCACGCGGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1017913944 6:158818370-158818392 GGGCGCGCGCCCCCGCTCTCGGG - Intronic
1019395426 7:815830-815852 GGGCGTGCGCAGGCGCTCGCAGG - Intergenic
1020125230 7:5529743-5529765 GGGCGCGCGCCGGCGCCCCCTGG - Intronic
1033186409 7:139231208-139231230 GAGCGGGCGCATGCGCACAGAGG - Intronic
1034824823 7:154252232-154252254 GTGTGCGCGCATGCGCACGGTGG + Intronic
1042611839 8:70608405-70608427 GGGGGCGAGCATGCGCACCAGGG + Intergenic
1044719692 8:95133760-95133782 GGGCGCGCCCGTGCGCGCGCAGG + Intergenic
1046644089 8:116766311-116766333 GGGGGCGCACATGCGCAGTCTGG - Intronic
1049772984 8:144392316-144392338 GGGCGCACGCAGCCGCACTGGGG + Exonic
1057868175 9:98697883-98697905 GGGGACCCGCATGCCCACTCTGG - Intronic
1061875079 9:133539591-133539613 GCGCGCTCCCATGCGCTCTCAGG - Intronic
1188315284 X:28665939-28665961 TGGAGCACGCACGCGCACTCTGG + Intronic
1198177804 X:134172878-134172900 GGTGGCGCGCATGCGCGCGCCGG - Intergenic
1201065724 Y:10092624-10092646 GAACGCGCGCCTGCGCCCTCGGG + Intergenic