ID: 1179229380

View in Genome Browser
Species Human (GRCh38)
Location 21:39487841-39487863
Sequence CCTGGTGACCTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179229380 Original CRISPR CCTGGTGACCTGAAGGAGGA AGG Intronic
900093090 1:928976-928998 CCTGGTGACTGAACGGAGGAGGG + Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900640806 1:3687291-3687313 GCTGGTTCCCTGAATGAGGAAGG + Intronic
901057841 1:6457100-6457122 CCTCGGGACCTGAAGGAGTCAGG - Intronic
901883886 1:12209461-12209483 CCAGGAGACCTGGAGGATGAAGG - Intergenic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902476509 1:16691356-16691378 CCTGGGGACCTGAAGGAGTCAGG + Intergenic
904204677 1:28846203-28846225 CCATGTGAAGTGAAGGAGGAAGG - Intronic
905015357 1:34774524-34774546 CCTGGTGGCAGGAAGGAGGGAGG + Intronic
905046849 1:35010942-35010964 ACTGCTGACCTGGAGGAGGGCGG + Exonic
905986511 1:42288394-42288416 GCTGGTGAGCTGAAGTAGTATGG - Intronic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
906212076 1:44017558-44017580 GATGGTGACCGGCAGGAGGATGG + Intronic
906720084 1:47997734-47997756 CCTGGCGAAGGGAAGGAGGAGGG - Intergenic
907523055 1:55037833-55037855 CCCTCTGCCCTGAAGGAGGAAGG + Intergenic
908107688 1:60862069-60862091 CATGATGACCTGAATGAGGCTGG + Intergenic
909043090 1:70676879-70676901 CCTTGTGACCTGCAGGAAGATGG + Intergenic
910688358 1:89940816-89940838 CCTGGTGACCTCAAGAAACAGGG + Intergenic
910895923 1:92069289-92069311 CATGGTGACATGAAGGGGTAGGG - Intergenic
912498413 1:110106191-110106213 GCTGGTGATCTGCAGGAGGAGGG + Intergenic
912530125 1:110314542-110314564 CCTGGAGCCCAGACGGAGGATGG + Intergenic
912609381 1:111028011-111028033 CCTGGTGACAAGAAGAAGGCAGG - Intergenic
912949478 1:114110872-114110894 CCTGGTTACAGCAAGGAGGATGG - Intronic
913191959 1:116420428-116420450 CCTTGTCATCTGGAGGAGGAAGG - Intergenic
914518096 1:148391191-148391213 CCTGATGACCTGAAGTGGAACGG - Intergenic
918416999 1:184320342-184320364 CCTGCTGAAGTGAAGGAAGAGGG - Intergenic
920067078 1:203276683-203276705 CCTGGAGACCTGAGGGACCAAGG + Intergenic
920299587 1:204980384-204980406 CCTGGTGACGTGAAGGGAGAGGG + Exonic
920342506 1:205284400-205284422 CCTGGGGCCCTGAGGGAGGGTGG + Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
924708240 1:246515115-246515137 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1064558165 10:16568286-16568308 CCTGCTGATCTGACGGAGGGTGG - Intergenic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1069788539 10:71004964-71004986 GCTGGTGACAGGAAGGATGAGGG + Intergenic
1070782953 10:79148030-79148052 TCTGGGGGCCTGGAGGAGGAGGG + Intronic
1072695546 10:97600351-97600373 CCTTGTTGGCTGAAGGAGGATGG + Intronic
1073037127 10:100571906-100571928 TCTGGAGACATGAAGGAGGCAGG + Intergenic
1073544677 10:104338207-104338229 CCTAGTGTGCTGAAGGAAGAAGG - Intronic
1074008147 10:109449174-109449196 GCTGGTGACCTGAAGATGAAGGG - Intergenic
1074438163 10:113452247-113452269 CCTGCTGAGCTGAAGAAGGTGGG - Intergenic
1074455294 10:113590692-113590714 CCTCTTGGCCTGAAGGAGGCCGG + Exonic
1075091101 10:119444558-119444580 GCTGGGGACCATAAGGAGGAGGG - Intronic
1075204266 10:120433299-120433321 GCTGTTCAACTGAAGGAGGAAGG - Intergenic
1075658419 10:124176541-124176563 CCTGGTGAACGGCAGGATGAGGG - Intergenic
1076465720 10:130680344-130680366 TTTGGTGGCCTGATGGAGGAGGG + Intergenic
1076583613 10:131531339-131531361 CATGCTGAGCTGAGGGAGGAGGG + Intergenic
1076685221 10:132195619-132195641 CCTACAGACCTGAAGGAGGCAGG + Intronic
1077046999 11:551117-551139 CCTGGGCACCTGCAGGGGGAGGG - Exonic
1077378524 11:2216646-2216668 CCTGGTGCCCTCCAGGAGAAAGG - Intergenic
1077419046 11:2440994-2441016 CCTGGTGAGCTGAGGGATGTCGG + Intergenic
1080304760 11:30824324-30824346 ACTTGTGCCCTGGAGGAGGAGGG - Intergenic
1081547438 11:44081334-44081356 CCTGGTGACCTGAAAATGGGAGG + Intronic
1081658847 11:44875444-44875466 CCTGGTGACCTGGAGGGAGGTGG - Intronic
1083844274 11:65321804-65321826 CCCAGGGACCTGAAGGAAGAAGG - Exonic
1084837093 11:71810550-71810572 CCTGGTGTCCTGTAGAAGAATGG + Intergenic
1085189039 11:74601799-74601821 CCTGGTGACCTGATGGTGTTGGG + Intronic
1085454333 11:76657176-76657198 GCTGGGGACCCCAAGGAGGAGGG + Intergenic
1085748557 11:79137227-79137249 CCTGTTGACTTAAAGGTGGAAGG - Intronic
1085910723 11:80822280-80822302 GTTGGTGATCTGAAGGAGGACGG + Intergenic
1088712948 11:112524776-112524798 CCTGAGGAACTGAAGAAGGAAGG - Intergenic
1088987835 11:114925699-114925721 CCTGGTACCCTGAGAGAGGAAGG + Intergenic
1089169111 11:116500161-116500183 CCTGCTGGCCTGGAGAAGGACGG - Intergenic
1089299463 11:117489933-117489955 CCTGGGGCACTGGAGGAGGACGG - Intronic
1089762539 11:120738850-120738872 CCTGGTGAGATGGGGGAGGAGGG + Intronic
1090465960 11:126933387-126933409 CGTGATGACTTGAAGGAGGAAGG - Intronic
1092402136 12:8185555-8185577 CCTGGTGTCCTGTAGAAGAATGG - Intronic
1093936589 12:25008240-25008262 ACTGGTGTCCTGAAGGAGAGAGG + Intergenic
1094455561 12:30628878-30628900 CCTGGTGACCTGAAGCAAGGTGG - Intergenic
1096512887 12:52141497-52141519 TCTGAAGACCTGAAGGAGGCGGG - Intergenic
1096574026 12:52541474-52541496 CCTGGTGTCCTGATGGGGGGTGG - Intergenic
1097284003 12:57863870-57863892 CCTGGGGATGTGAAGGAGGAGGG + Intergenic
1098163141 12:67666807-67666829 TGTGGTGTTCTGAAGGAGGAAGG + Intergenic
1098163249 12:67667876-67667898 TGTGGTGTTCTGAAGGAGGAAGG + Intergenic
1099435911 12:82644706-82644728 CCTGGTGATGTGCAGCAGGAAGG - Intergenic
1100209138 12:92383203-92383225 TATGGTGCCCTGAGGGAGGAGGG + Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102588039 12:113936948-113936970 CCTGGTGAGGGAAAGGAGGAGGG - Intronic
1103726351 12:122999202-122999224 GCTGCTGAGCTGGAGGAGGAAGG + Intronic
1104518211 12:129447574-129447596 TCTGGTTACCTCAAGGAGAAAGG - Intronic
1106158817 13:27182820-27182842 TCTGGGGACCTGGAGGAGGAAGG - Intergenic
1106606643 13:31234910-31234932 CCTGGTGGCCTTAGGGAGAATGG + Intronic
1107742316 13:43464420-43464442 CCTGGGGACCTGGGGAAGGAGGG + Intronic
1107814619 13:44233108-44233130 CCTGGAGAGCTAGAGGAGGATGG + Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1111452917 13:88442398-88442420 CCTGATGACTTGAAGTAGAAAGG + Intergenic
1112368475 13:98774846-98774868 CCAGATGCCCTGAATGAGGAGGG - Intergenic
1113710510 13:112461502-112461524 CCAGGTGCCCTTAAGAAGGATGG + Intergenic
1113937592 13:114002524-114002546 CCTGTTGCCCTCAAGGAGGCCGG - Intronic
1117255121 14:53969679-53969701 CCTGGTGTGCTGAAGGAGTTGGG - Intergenic
1117654379 14:57939463-57939485 CCTGGAGACCAGAAGAAGAAAGG + Intronic
1118230017 14:63939043-63939065 CCTGGTGAACTGGAGGTTGATGG + Intronic
1121850580 14:97218570-97218592 CCTGGTTTCCTGGGGGAGGAGGG + Intergenic
1122632009 14:103111531-103111553 CCTGGTGCCCCCATGGAGGAGGG - Intergenic
1125207241 15:37167565-37167587 CCTGGTGATCTGAAGTAGAATGG + Intergenic
1125238971 15:37550738-37550760 CCTGTGGTCTTGAAGGAGGATGG - Intergenic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129901571 15:79155441-79155463 CCTTGTCACCTGGAGAAGGAAGG - Intergenic
1132038706 15:98506684-98506706 CCTGGTGATGTTATGGAGGATGG - Intronic
1132406085 15:101542604-101542626 CCTAGTGTCCGGCAGGAGGAGGG - Intergenic
1133363699 16:5194357-5194379 TCTGGTGACCTTGAAGAGGAGGG - Intergenic
1133404150 16:5509688-5509710 CCAGGAGAGCTGATGGAGGAGGG + Intergenic
1133901224 16:9976963-9976985 ACTGGAGACCTGAAACAGGAGGG + Intronic
1134889136 16:17823257-17823279 CCTGGTGAGCTAATGGAAGAGGG + Intergenic
1134898795 16:17915384-17915406 CCTGGAGACAGGAAGGAGAAAGG - Intergenic
1135239598 16:20792704-20792726 CCTGGTGTAGTGAAGGAGAATGG + Intronic
1135650977 16:24206432-24206454 CCTGGTGTCTTGATGGAGGCTGG + Intronic
1137068895 16:35881228-35881250 CATGGTGGCCAGAAGGAGGTAGG - Intergenic
1138430952 16:56969005-56969027 CCTGGTGTGCTGAAGATGGAGGG - Intronic
1139834067 16:69824241-69824263 CCTGGTAGTCTGAAGGAAGAGGG - Intronic
1139949044 16:70660400-70660422 CCTGGGGACCTGAAGGTGGATGG + Exonic
1142386679 16:89769859-89769881 CCTCCTGACCTGTAGGACGAGGG - Exonic
1143537999 17:7552915-7552937 CCTGCTGACCTTAAAGAGGGTGG + Intronic
1143711511 17:8739192-8739214 ACTGGTGGCCTGGATGAGGAAGG + Intronic
1145760634 17:27423541-27423563 CCTGGAGACTTGGAGGATGAAGG + Intergenic
1145798403 17:27668754-27668776 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1145810045 17:27759138-27759160 CCTGCTGGCCTCAAGGAGGCGGG + Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146160685 17:30557857-30557879 CCTGGAGACTTGGAGGATGAAGG + Exonic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1146843705 17:36170958-36170980 CCTGGAGACTTGGAGGATGAAGG - Intronic
1146856012 17:36258892-36258914 CCTGGAGACTTGGAGGATGAAGG - Intronic
1146864608 17:36329483-36329505 CCTGGAGACTTGGAGGATGAAGG + Intronic
1146871918 17:36382803-36382825 CCTGGAGACTTGGAGGATGAAGG - Intronic
1146879279 17:36433888-36433910 CCTGGAGACTTGGAGGATGAAGG - Intronic
1146883209 17:36455033-36455055 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1147067468 17:37930071-37930093 CCTGGAGACTTGGAGGATGAAGG + Intronic
1147074804 17:37983427-37983449 CCTGGAGACTTGGAGGATGAAGG - Intronic
1147078999 17:38009632-38009654 CCTGGAGACTTGGAGGATGAAGG + Intronic
1147086327 17:38062973-38062995 CCTGGAGACTTGGAGGATGAAGG - Intronic
1147094936 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG + Intergenic
1147102273 17:38186936-38186958 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1147369351 17:39980962-39980984 CCGGGTGCCATGAAGCAGGAGGG + Exonic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1149846861 17:60013443-60013465 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1150085209 17:62270020-62270042 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1151702618 17:75751371-75751393 CCTGGTTACCTGCATGGGGAGGG - Intronic
1151927586 17:77210325-77210347 ACGAGTGACCTGAAGCAGGAGGG + Intronic
1152148916 17:78586811-78586833 CGTGGTGACCTGAAGGGAGTTGG + Intergenic
1152430414 17:80245766-80245788 CCTGTTGTCCTGACTGAGGAGGG - Intronic
1152899113 17:82929852-82929874 CCTGGAGCCCTGAAAGTGGAGGG - Intronic
1155479820 18:26273190-26273212 CCTGGAGACTTGAGGGAGGGAGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155902106 18:31404575-31404597 CTTGGTGACCTTAAAGAGGTGGG - Intronic
1155920521 18:31598688-31598710 CCAGTGGACCTGAAGGACGAGGG + Exonic
1156219640 18:35038540-35038562 CCTGGAGACCTGAAGCTGGGAGG + Intronic
1157277474 18:46321978-46322000 CCTGGGGACTTGAAGGAGAGAGG - Intergenic
1158244096 18:55411219-55411241 CCTAGAGACCTGAAGGACTAAGG + Intronic
1158403074 18:57138806-57138828 TCTGGTGCCCTGAGGAAGGAAGG + Intergenic
1158612673 18:58956601-58956623 CCTGGTTGTCTGAAGGAAGACGG - Intronic
1159810310 18:73011445-73011467 CTTGTTAACCTGAAGAAGGAGGG - Intergenic
1160671351 19:365320-365342 CCTGGTGACCCTAAGGGGGCTGG + Intronic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1161434488 19:4254561-4254583 CTTGGGGACCTGAGGCAGGAAGG - Intronic
1161527114 19:4763162-4763184 CCTGGTTCCCTGGAGGATGAGGG + Intergenic
1161947943 19:7450062-7450084 CCTGGTGAGCTGAGAAAGGAAGG + Intronic
1162917408 19:13881761-13881783 CCTGGAGACCTGATGCAGGAGGG - Intergenic
1163182781 19:15615811-15615833 CCTGGTGAGTGGCAGGAGGATGG + Exonic
1163195491 19:15716772-15716794 CATGGTCACCTCTAGGAGGAAGG + Intergenic
1163598069 19:18231955-18231977 CCTGCTCCCCTGTAGGAGGAAGG - Intronic
1163677120 19:18660706-18660728 CCTGGGGAACTCAAGGAGGGAGG - Intronic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1163768965 19:19179266-19179288 CCAGGGGGCCTGAAGCAGGAGGG - Intronic
1164813861 19:31179219-31179241 CCTTGTGACCTGAAGGGCCAGGG + Intergenic
1165071720 19:33259665-33259687 CCTTGTGACCGGAAGGGAGATGG - Intergenic
1165466592 19:35978527-35978549 CGTGGTGAAGTGAGGGAGGAGGG - Intergenic
1165938401 19:39403202-39403224 CCTGAGGATCTGAGGGAGGAGGG + Intergenic
1166794847 19:45420029-45420051 CCTGGGGATCTGAGGGAGGAGGG - Intronic
1167311531 19:48740254-48740276 TCTGGTGAACGGAAGGAGGGCGG - Exonic
1167436460 19:49481320-49481342 ACTGGGGACCTGAAGGAGCAAGG + Intronic
1167502547 19:49856080-49856102 CCTGGTCTCCTGAGGGAGAAGGG - Intronic
1167711744 19:51115856-51115878 CCTGGGGACCAGACTGAGGAGGG + Intergenic
1167765283 19:51478614-51478636 CCTGGGGTCCTCCAGGAGGAGGG - Exonic
1202710528 1_KI270714v1_random:17197-17219 CCTGGGGACCTGAAGGAGTCAGG + Intergenic
926693715 2:15755512-15755534 CCTGGTGACCTGCAGCAGCGAGG + Intergenic
926942381 2:18151978-18152000 CCTGCTTATCTGAGGGAGGAGGG + Intronic
929568761 2:43006691-43006713 CCTGCTGCCCTCAAGGAGTATGG + Intergenic
929818995 2:45258504-45258526 CCTGGAGATTAGAAGGAGGAAGG - Intergenic
934158362 2:89224742-89224764 CATGGTCATCTGAATGAGGAAGG + Intergenic
934208906 2:89957683-89957705 CATGGTCATCTGAATGAGGAAGG - Intergenic
934913978 2:98283391-98283413 ACTGGTGACCTGAAGCAAGGTGG + Intronic
934942129 2:98510319-98510341 GCTGGTGAGGTGAAAGAGGAAGG + Intronic
935921678 2:108022340-108022362 CCTGGTCATCAGAAGGAGGTGGG + Intergenic
936642495 2:114330571-114330593 CCCTGTGGGCTGAAGGAGGATGG + Intergenic
936721715 2:115259163-115259185 CCTGGTGCCCAAAGGGAGGAAGG + Intronic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937131200 2:119515125-119515147 ACTGGTGACATGAAGGTGAATGG + Intronic
937141475 2:119605601-119605623 CCTGGTGAGGTGGAGGATGATGG - Intronic
937219907 2:120336777-120336799 CCTGTGGACCTGAATCAGGAGGG + Intergenic
937344911 2:121119495-121119517 CCTGGGGACCTGAAAAAGAAAGG + Intergenic
938757846 2:134397187-134397209 CCTAGTGACAATAAGGAGGATGG + Intronic
939231282 2:139429293-139429315 CTTGGTGGCCTGATGGAGGTGGG - Intergenic
940308846 2:152255433-152255455 GCTGGTGACCTGAACCAAGAAGG + Intergenic
941494202 2:166180859-166180881 CCTGGGGCGGTGAAGGAGGAAGG + Intergenic
941929787 2:170928543-170928565 CCTGGCTACCTGAAGGAGGTAGG + Exonic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
945916518 2:215710404-215710426 CCTGGTGGGGTGAAGGAAGAAGG - Intergenic
946085587 2:217168196-217168218 CCTTTGGACCTGAAGGTGGAAGG + Intergenic
946248925 2:218401550-218401572 TCTGGTCACCTGAAGTAGGGAGG - Exonic
946254941 2:218435448-218435470 CTTGGTAACCTGGAGGCGGAGGG - Intronic
946397941 2:219452702-219452724 GTTGGTGCCCTGAAGGAGGCTGG + Intronic
947829074 2:233126013-233126035 CCTGGTGACCAGAGGGAGATGGG + Intronic
947983503 2:234429270-234429292 CCTGCTGACTTGGAGGAGAAAGG - Intergenic
948053929 2:234997461-234997483 CCTGGTGTCCTTCAGGATGAAGG + Intronic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
1169211128 20:3766955-3766977 CCCGGTGGTATGAAGGAGGAGGG - Intronic
1169280954 20:4266550-4266572 CCTGGTGAACTGGATGTGGAGGG + Intergenic
1170585436 20:17730703-17730725 CCTGGGGACATGATGGAGGCAGG - Intronic
1170666774 20:18393350-18393372 CCTGGTGCCCAGCATGAGGATGG - Intronic
1171374620 20:24683943-24683965 CCTGGAGACTTGAAAGATGAGGG - Intergenic
1171854759 20:30333942-30333964 ACTGGGGACCTGAAAGCGGAGGG + Intergenic
1172534648 20:35664177-35664199 CTTCGTGGCCTGAAGGTGGAGGG - Intronic
1172997708 20:39083390-39083412 GCAGGAGACCTGAAGGAGGGAGG - Intergenic
1173006144 20:39141220-39141242 CCTGGTGGCATGGAGGAGGAAGG - Intergenic
1173464964 20:43273553-43273575 CATGGTTACCTGAAGGAGGGTGG - Intergenic
1173926436 20:46784672-46784694 CCTGGTGACCTGAGGGAGGGAGG + Intergenic
1175057901 20:56214786-56214808 CCTGGTGATGGGAAGGAGAATGG - Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175744485 20:61445587-61445609 CCTGCTGACCTGTTGGAAGAAGG - Intronic
1175757973 20:61541884-61541906 CCAGGTGCCCTGAGGGAGGGAGG - Intronic
1176073320 20:63237778-63237800 CCAGGTGGCAAGAAGGAGGAGGG - Intronic
1176111220 20:63411597-63411619 CCTGGGGCCCTGGTGGAGGAAGG + Intronic
1176285273 21:5016067-5016089 CCTGGTTCCCAGAAGGAGGCTGG + Intergenic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1179871908 21:44247408-44247430 CCTGGTTCCCAGAAGGAGGCTGG - Intronic
1180588693 22:16917346-16917368 CATGGTCACCTGAATGAGGGAGG + Intergenic
1180853797 22:19034177-19034199 CATGGTGAGATGAAGGTGGAAGG + Intergenic
1180982720 22:19886431-19886453 CCTGGAGCCCTGCAGGAGGTTGG + Intronic
1181464534 22:23103794-23103816 CCAGCTGACCTGAGGGAGGAAGG - Intronic
1182134556 22:27889161-27889183 CCTGATAACCTGAGGGAGGAGGG + Intronic
1183215145 22:36474527-36474549 ACTTGTTACCTGGAGGAGGAAGG + Intronic
1183456420 22:37925647-37925669 GCTGGTGTCCTGGAGGAGGGGGG - Exonic
1184783293 22:46659667-46659689 CATGCTGACCTGCAGGAGGCGGG - Intronic
1184783455 22:46660329-46660351 TCTGGAAGCCTGAAGGAGGAGGG + Intronic
1184851833 22:47125348-47125370 CCTGGAGACCTGGGGGAGCAGGG + Intronic
1185095893 22:48806009-48806031 CCCAGTGACCTGAAAGAGGAGGG + Intronic
1185139469 22:49092292-49092314 CCTGGTGACGTGGGGGTGGAGGG + Intergenic
951891998 3:27576102-27576124 CCTGGTCACCAGAAGGAACAAGG - Intergenic
952164409 3:30731227-30731249 CCTGGGTACCTGGAGGACGAAGG - Intronic
952629501 3:35448462-35448484 CCTGGTGAGAAGAATGAGGAAGG + Intergenic
952865676 3:37853737-37853759 CCAGGGGAGCTGAAAGAGGAGGG + Intergenic
952942555 3:38455041-38455063 CCTGGAGGCCCGAAGGAAGAGGG - Intronic
954296453 3:49677021-49677043 CCTGGTGAGCTGGAGGTGGCAGG + Exonic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
955550408 3:60078850-60078872 TCTGGGGATCTGAGGGAGGAGGG + Intronic
961584394 3:127910226-127910248 CCAGGAGACCTGGAGGTGGAGGG + Intergenic
962494873 3:135929119-135929141 CCTGGAAACCTGCAGTAGGAAGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
967462588 3:189763623-189763645 CCTGGTCACTTGAAAGAGGTGGG + Intronic
968684042 4:1944254-1944276 CCTGGTTTCCTGAAGGAGGTGGG + Intronic
968693293 4:2008143-2008165 CCTGGTGACCTGGGCGAGGGCGG - Intronic
968902330 4:3437545-3437567 CCTGGTGACAAGAAGGAGATGGG + Intronic
969429634 4:7146586-7146608 CCTGGCCACCTCAAGGAGGAGGG + Intergenic
969756449 4:9153249-9153271 CCTGGAGACCTGGAGGAAGCCGG - Intergenic
973789000 4:54361546-54361568 GCCTGTGAGCTGAAGGAGGATGG + Intergenic
978979266 4:114922045-114922067 CCTGGTGACTGGAAGGCGGTGGG - Intronic
980711385 4:136573110-136573132 CCTGATGACCTGAGGTAGAACGG + Intergenic
980969757 4:139557023-139557045 CCTGGCGACCCGAAGGAGGGCGG - Intronic
981628363 4:146787860-146787882 GCTGGTGACCGACAGGAGGAGGG - Intronic
982086594 4:151842165-151842187 CTTGGGTACCTGAGGGAGGAGGG + Intergenic
985885542 5:2674917-2674939 CCTGGTGACCTGTATGAACAGGG + Intergenic
985999629 5:3620310-3620332 CCTCGTGACCTGTAGCAGGCAGG - Intergenic
986135808 5:4976655-4976677 CCTGTAGAGCTGAAGGCGGAAGG - Intergenic
986156537 5:5182199-5182221 CCTGGTGACCTCAAGGACATGGG + Exonic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987468022 5:18295703-18295725 CCTGTTGACTTAAAGGTGGAAGG + Intergenic
987634738 5:20525516-20525538 CCAGGTGAACTGCAGGAAGAAGG - Intronic
988632921 5:32950412-32950434 CCTAGTAATGTGAAGGAGGACGG + Intergenic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
991926605 5:71711826-71711848 CCTGGGGACAGGATGGAGGAAGG + Intergenic
992459203 5:76944350-76944372 CCTGGTGCTCTGGAGGAAGATGG + Intergenic
997720741 5:136076794-136076816 CCTGGTGACCTTGTGGGGGAGGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999571521 5:152925106-152925128 CCTGATGATCTGAAGTGGGATGG + Intergenic
999583246 5:153062781-153062803 GCTGGTGACCTTAAAGAGGATGG - Intergenic
999657550 5:153825527-153825549 CCCAGTTACCTGAAGGAGGTTGG - Intergenic
1000293369 5:159891700-159891722 GCTGAAGACCTGAGGGAGGAGGG - Intergenic
1001079251 5:168654897-168654919 CCTGGGGAACTGAAGGGGGTAGG - Intergenic
1001326758 5:170733954-170733976 CCTGGGGACCTGCAGAAGGAAGG + Intronic
1002587829 5:180263175-180263197 CCTGAGCACCTGAAGGATGAGGG - Intronic
1002653694 5:180724377-180724399 GCTGGTCACCTGGAGGGGGAAGG + Intergenic
1002810201 6:621075-621097 ACTGGTCACCTGAACGTGGAGGG - Intronic
1004511214 6:16285901-16285923 GCTGGCAACCTGAATGAGGAGGG + Intronic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1006935422 6:37713866-37713888 GCTGGTCAGATGAAGGAGGATGG - Intergenic
1006946622 6:37788644-37788666 CATGGCCACCTGAAGCAGGATGG - Intergenic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007712991 6:43836393-43836415 CCTGGGGAACTGCAGGAGCAAGG + Intergenic
1007788584 6:44296484-44296506 GCTGGGGACCTGAGGAAGGATGG - Intronic
1007943858 6:45807708-45807730 TCTGGTGACCTGAAGCAGGATGG + Intergenic
1008517957 6:52335873-52335895 CCAGGTGTCCTGAAGAAGTAGGG + Intergenic
1011071607 6:83391737-83391759 CCTGGAGACCAGAAGCAGGATGG - Intronic
1014003599 6:116392251-116392273 AATGGAGGCCTGAAGGAGGAGGG + Intronic
1014052256 6:116968529-116968551 CCTTGTGTCCTGCAGGAAGAAGG + Intergenic
1014744214 6:125180944-125180966 TCTGGTGGCATGAAGGAGGCTGG + Intronic
1015110147 6:129583450-129583472 CCTGTTGTCCTTAATGAGGATGG + Intronic
1015881988 6:137879107-137879129 GCTGGTGACAGGAAGGAGGGAGG - Exonic
1015937549 6:138418341-138418363 CCTGGGGCCCTGAAGGAAGGTGG + Exonic
1016320527 6:142839640-142839662 CCTGGTGAACTCAGGGAGCATGG - Intronic
1019597340 7:1864246-1864268 CCTGAACACCTGAAGGAGGAGGG + Intronic
1019642946 7:2114412-2114434 CTTTGTGGCCTTAAGGAGGATGG - Intronic
1019840003 7:3431666-3431688 CCTGGTGGACTAAGGGAGGATGG + Intronic
1020022575 7:4877934-4877956 CCTGGTGTCCTGAAGGTGTTTGG - Exonic
1021454930 7:20819506-20819528 CTTGTTGAAATGAAGGAGGATGG - Intergenic
1022972144 7:35528170-35528192 CCAGGTGACCTGGAGGAGCTTGG + Intergenic
1023805051 7:43866974-43866996 CCAGGTTACCTGAAGAGGGAAGG + Exonic
1024189960 7:46996121-46996143 CCTGGGAACCTGAAGCAGCAGGG - Intergenic
1024550294 7:50557166-50557188 TCTGCTGACATGAAGGAGGAAGG + Intronic
1031482301 7:122293018-122293040 CCTGGTAAACTAAAGGAGTATGG - Intergenic
1032514173 7:132494835-132494857 CCTGGGGAACTGCTGGAGGAAGG - Intronic
1034463066 7:151209225-151209247 TCTGGTGCCCTGAAGAAGGTGGG - Intronic
1034471165 7:151255087-151255109 CCTGGTGCCCTCAAGGCCGAGGG - Intronic
1034546886 7:151795039-151795061 CCTGGGGCCCTGAACTAGGAAGG - Intronic
1035588434 8:794820-794842 CCTGGTGACCTGAGTGAGGTTGG + Intergenic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1036345406 8:7958325-7958347 CCTGGTGTCCTGTAGAAGAATGG - Intergenic
1036862538 8:12365329-12365351 CCTGGTGTCCTGTAGAAGAATGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038389343 8:27180481-27180503 CCTGGGGACCTGAAGGACCCAGG + Intergenic
1038466216 8:27766292-27766314 CCTGGAGCCCTGAAGGACAAAGG + Intronic
1039152705 8:34525159-34525181 CCTGGTGGCGTGAAGGGGGTTGG - Intergenic
1041104003 8:54424327-54424349 TCTGGAGAACTGAAGGAGGCAGG - Intergenic
1042945829 8:74153624-74153646 CCTGATGTCCTGAAGCAAGAGGG + Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045692595 8:104774908-104774930 CCTGGGGACCAGAAGTATGAAGG - Intronic
1048443832 8:134478713-134478735 CTCGGTGACCTGCGGGAGGAGGG + Exonic
1048799666 8:138184321-138184343 CCTGTTCACCTGCAGGATGAAGG - Intronic
1048880636 8:138869741-138869763 CCTGGTGACCTGCAGCTGGAGGG + Intronic
1049276268 8:141721599-141721621 CCTGGAGACCGAAAGGAGGGTGG - Intergenic
1049392693 8:142380312-142380334 GGTGGTGCCCGGAAGGAGGAAGG - Intronic
1049581503 8:143413240-143413262 TCTGGTGACCTGGCGGAGGGTGG - Intergenic
1049695778 8:143983727-143983749 CCTCGGGAGCTGGAGGAGGAAGG - Exonic
1050186538 9:2981080-2981102 CCTGGTGACAAGAAGGAGGCAGG - Intergenic
1050243913 9:3667961-3667983 TCTGGTGAGGTGAAGGAGGAGGG + Intergenic
1050402622 9:5271964-5271986 CCTAGAGACCTGAAGGAGGTAGG - Intergenic
1054874279 9:70078966-70078988 GCTGGTCACCTGAAGCAGGCTGG - Intronic
1057049714 9:91914537-91914559 CAAGGTGACCGGCAGGAGGATGG - Intronic
1060556790 9:124512160-124512182 CCTGGAGAGCTGGAGGTGGAGGG + Intergenic
1060880879 9:127117208-127117230 ACTTGTGAGCTGAAGGAGGGAGG - Intronic
1061670580 9:132185968-132185990 CCTGGTGTGGGGAAGGAGGAGGG + Intronic
1061874689 9:133537744-133537766 CCTGGTGCCCTGAAGCATGAAGG - Intronic
1062029561 9:134356091-134356113 CCTGGTGACCTGGAAAAGCATGG + Intronic
1062062443 9:134503693-134503715 CCAGTAGACCTGAAGGATGAGGG - Intergenic
1062416199 9:136451527-136451549 TCTGGTGACCAGAGGGAGGCAGG + Intronic
1062564645 9:137158759-137158781 CCCTCTGGCCTGAAGGAGGAGGG + Intronic
1062735431 9:138134807-138134829 CCTGGTGACATCCAGGAGCAGGG + Intergenic
1185451232 X:281373-281395 CCTGCTGCCCGGAAGGAGGGAGG - Exonic
1186590053 X:10920595-10920617 GCTGGTGACTTTAAGGAGGCGGG + Intergenic
1188013001 X:25077233-25077255 CCTGGGGACAGGAAGGAGGATGG - Intergenic
1188905453 X:35785963-35785985 CCTGCTGACTTCAAGGAAGAAGG - Intergenic
1189261492 X:39682136-39682158 CTTGGTGACCTGCAGGAAGCAGG - Intergenic
1190243818 X:48677307-48677329 CCTGGAAGCCTGAGGGAGGAAGG + Intronic
1190280752 X:48927835-48927857 GCTGGTGACCTGAAAGACCAAGG - Intronic
1192327501 X:70145364-70145386 GATGGTGACCTGAAATAGGAAGG - Intronic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1193131337 X:77922769-77922791 TCTGGTGCCCTAAAGGACGAAGG - Intronic
1193942494 X:87692944-87692966 CCTGGTGACTAGAAGAAGGATGG - Intergenic
1195247257 X:103005721-103005743 CTTGGTGACCTGATGGAGACTGG + Intergenic
1197698632 X:129578486-129578508 CCTGTTTACATGAAGGTGGAAGG - Intronic
1199559214 X:149145577-149145599 CATGTTGACCAGAAGTAGGATGG + Intergenic
1200076941 X:153555960-153555982 CCTGCAGATCTGATGGAGGAAGG + Intronic
1200232201 X:154449667-154449689 CCTGCGGACCTGAGGGAGGAAGG - Exonic
1200397655 X:156000656-156000678 CCTGGTGACATTCAGGAGCAGGG + Intronic