ID: 1179229543

View in Genome Browser
Species Human (GRCh38)
Location 21:39489037-39489059
Sequence CAAGAAGACCAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 697
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 621}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179229543 Original CRISPR CAAGAAGACCAGAGGGAAGA AGG Intronic
900471953 1:2859453-2859475 GAGGAAGACAAGAGGGAGGAAGG + Intergenic
900634939 1:3658289-3658311 CAAGAACCCCGTAGGGAAGAGGG - Intronic
900806218 1:4769826-4769848 AAAGAAGGAAAGAGGGAAGAGGG - Intronic
901283552 1:8058433-8058455 AAAGAAGCCCAAGGGGAAGAAGG - Intergenic
902124270 1:14195402-14195424 CCAGAAGCCCAGAGAGAATATGG + Intergenic
902313402 1:15599339-15599361 CAAGAAGAGCAAAGTGAGGAAGG + Intergenic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
904119239 1:28185504-28185526 AAAGAATACCATAGGGAAAAGGG + Intronic
904405552 1:30285954-30285976 CAAGAGGCCAGGAGGGAAGACGG + Intergenic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
904811821 1:33168281-33168303 CCAGAAGAGTAGAAGGAAGAAGG + Intronic
905266165 1:36755666-36755688 CAAGGAGACAAAAGGGATGAGGG - Intergenic
905424633 1:37873221-37873243 AAAGAAGGCAGGAGGGAAGAGGG + Intronic
906112065 1:43330603-43330625 CATGAAGAGCAGAGGACAGAGGG + Intergenic
906832120 1:49044189-49044211 CAAGAGGAAGAGAGGGAAGTAGG + Intronic
906835342 1:49077813-49077835 AAAGATGACCAAAGGGAGGAGGG + Intronic
908021980 1:59907549-59907571 CAAGAAGCTCAGAGGCAAGAGGG - Intronic
908142759 1:61204158-61204180 CAAGAGGGCCAGAGGAAAGCAGG - Intronic
908229597 1:62090687-62090709 CAACAAGACCAGAGGGGTGGAGG - Intronic
908637452 1:66184024-66184046 CAAGATGATCTGAGGGATGATGG + Intronic
908804530 1:67916612-67916634 CAAGTAGAGCAGTGGGGAGAAGG - Intergenic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
910282709 1:85519063-85519085 CAAGAAGAAACGAGGAAAGACGG + Intronic
910421774 1:87071956-87071978 CAAGAAAAGGAGAGGAAAGAAGG - Intronic
910509761 1:87990658-87990680 CTAGAGGACCAGTGGGGAGAAGG - Intergenic
911128251 1:94361677-94361699 CAAGAAGTGCAGAGCGAAGAGGG + Intergenic
911377588 1:97069857-97069879 AAAGAAGAACAGAGAGATGAAGG + Intergenic
912373598 1:109192581-109192603 CAAGGAAACAAGAGGGGAGAGGG - Intronic
912716066 1:111984496-111984518 CAAGAAGGCCCGTGGGAAGGAGG - Intronic
913413707 1:118581169-118581191 CAAGAAGATCAGGGAGAAGTTGG + Intergenic
913668493 1:121072213-121072235 CAAGAAGTACAGAGCGAAGTGGG + Intergenic
913969620 1:143404896-143404918 AAAGAAGAACGGAGGGAAGGAGG - Intergenic
914020237 1:143859656-143859678 CAAGAAGTACAGAGCGAAGTGGG + Intergenic
914063995 1:144230489-144230511 AAAGAAGAACGGAGGGAAGGAGG - Intergenic
914115155 1:144735865-144735887 AAAGAAGAACGGAGGGAAGGAGG + Intergenic
914207303 1:145543917-145543939 CAAGAAGAAACGAGGAAAGATGG - Intergenic
914658737 1:149767568-149767590 CAAGAAGTACAGAGCGAAGTGGG + Intergenic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915668756 1:157469308-157469330 TAAGAAGACCATAGGAAATATGG - Intergenic
915799097 1:158769597-158769619 TAAGAAGACCGGAGGGCAGAAGG - Intergenic
916723325 1:167501745-167501767 CAAGGAGACCAGAAGGCAGGAGG + Intronic
916835687 1:168542742-168542764 AAAGAAGGCCAAAGGAAAGAAGG + Intronic
917005416 1:170410823-170410845 CAAGAATTGCAGAGGGCAGAGGG - Intergenic
917261309 1:173172989-173173011 CAAGAAGTGCAGAGTGAAGGAGG + Intergenic
917871881 1:179249368-179249390 AAGGAAGACCAGAGGGAGCATGG + Intergenic
918053212 1:180993145-180993167 GAAGAAGACCAGAGGGTAAGAGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919742722 1:200990462-200990484 CAAAAGGAGCAGAGGGAAGTGGG + Intronic
920042840 1:203114327-203114349 AAAGAATACAAGAGGGAAGGAGG + Intronic
920111605 1:203591149-203591171 GCAGAGGAACAGAGGGAAGAAGG + Intergenic
920193417 1:204210317-204210339 CAAGAAGAAGAGAGAGAAGTAGG - Intronic
920212161 1:204336034-204336056 GAAGAAGACCAGATGGAATTAGG - Intronic
920507790 1:206528926-206528948 AAAGAAGGCCAAGGGGAAGAAGG + Intronic
920548143 1:206835887-206835909 CAAGAAAGACAGAGGCAAGAAGG + Intronic
920680764 1:208070879-208070901 GAAGAAATCCAGAGGGAAGCTGG + Intronic
920811043 1:209285886-209285908 CAAGAAGGCAAGTGGCAAGATGG - Intergenic
921568063 1:216744732-216744754 CTAGAAGAACAGATGGAAGATGG - Intronic
921596554 1:217060436-217060458 CAAGAAGTTCAGAGGAAAGGGGG - Intronic
922105306 1:222508436-222508458 CAAGAAGGCAAGAGGGCAAAAGG + Intergenic
922151401 1:223008052-223008074 AATGAAGACTAGAGGGAGGAGGG + Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922265639 1:223981014-223981036 CAAGAAGGCAAGAGGGCAAAAGG + Intergenic
922714162 1:227858073-227858095 CGGCAAGACCAGAGGGAAAAAGG + Intergenic
922753457 1:228081862-228081884 CAAGAAGACCTGAGGGTGGTGGG + Intergenic
923086656 1:230707786-230707808 TCAGACGAGCAGAGGGAAGACGG - Intronic
923364404 1:233245494-233245516 CAAGAAGGGCTGAGGGAGGAGGG + Intronic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923484405 1:234415226-234415248 TGAGAAGACAGGAGGGAAGAGGG + Intronic
923621739 1:235585133-235585155 AAGGAAGACCAGAGGGAGGGAGG - Intronic
923776098 1:236979877-236979899 CAAGGACACCAGAGGAAAGCAGG + Intergenic
924069809 1:240264864-240264886 CAATAATATCAGAGGGAAGGAGG - Intronic
1063023687 10:2156237-2156259 AAAGAAGGCCAGAGGGAGGCTGG + Intergenic
1063038277 10:2310913-2310935 CGAGAAGACAAGAGAGGAGAAGG + Intergenic
1063147119 10:3305686-3305708 CCAGAAGCCCAGATGCAAGAAGG - Intergenic
1063499496 10:6540035-6540057 CAAGAAGAACAGGCAGAAGAGGG - Intronic
1063563199 10:7148290-7148312 TGAGAGCACCAGAGGGAAGAAGG - Intergenic
1063587994 10:7370175-7370197 GAAGAAGGGCAGAGGAAAGAGGG - Intronic
1063688259 10:8258908-8258930 TAACTAGAGCAGAGGGAAGAAGG + Intergenic
1063919717 10:10920760-10920782 CAAGAAGAAAGGAAGGAAGAAGG + Intergenic
1064571238 10:16695391-16695413 AAAGCAGAGCAGAGGGAAGGAGG + Intronic
1066191290 10:33058376-33058398 AAAGAAGGCCAAGGGGAAGAAGG - Intergenic
1067908152 10:50315934-50315956 AAAAAAGAGCAGAAGGAAGAGGG + Intronic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068450873 10:57186058-57186080 CAAGAAGACCAGAAAGAGCAAGG + Intergenic
1068798198 10:61107814-61107836 AAAGGAGACAAGAGGGAAAAGGG + Intergenic
1069566275 10:69465376-69465398 CCAGAAGACCACAGTGGAGAAGG - Intronic
1069567817 10:69475118-69475140 AAAGAAAACCAGGGGGAGGAGGG + Intronic
1071437287 10:85659258-85659280 CAGGAAGAAGAGAGGAAAGATGG + Intronic
1071559063 10:86631574-86631596 AAAGAAGGCCAAAGGGAAGAAGG - Intergenic
1071949090 10:90682644-90682666 CAAGAAGCCTAAAGGGAAGAGGG + Intergenic
1071964846 10:90842216-90842238 CAAAAAGAACAGAGGGCAAAAGG - Intronic
1072390679 10:94982964-94982986 CAAGAAGAAAAGTGGGGAGAGGG - Intronic
1072569243 10:96643926-96643948 AATGAAAACCAGAGGGAAGGAGG + Intronic
1072606611 10:96989048-96989070 AAAGAAGAACAGAGAGAAAAGGG - Intergenic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1073347696 10:102796656-102796678 CAAGAAGCTCAGAGTTAAGAAGG - Intronic
1073379165 10:103065024-103065046 GATGGAGTCCAGAGGGAAGATGG + Intronic
1074306928 10:112287679-112287701 CCAGAAGCCCAGAGGGAGGAAGG + Intronic
1074453097 10:113575403-113575425 AGAGAAGACCAAAGGCAAGAGGG - Intronic
1074454604 10:113586371-113586393 CCAGAAGACCAGTGGCTAGAAGG + Intronic
1074728565 10:116342815-116342837 CAGGAAGAACAGAGAGAAGCAGG - Intronic
1075518913 10:123132402-123132424 CAAGGAGCCAAGAGGGCAGAAGG - Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076357763 10:129865464-129865486 CCAGAAGACCACAGGGGAGGTGG - Intronic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1077057440 11:601674-601696 GAAGAAGAGAAGAGGGAAGAAGG + Exonic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077307105 11:1873350-1873372 CAAGAAGCACAGAGGGGAGCTGG - Intronic
1077354278 11:2107892-2107914 CAACTAGACCAGAGGGGACAAGG - Intergenic
1077367736 11:2167925-2167947 CGAGAAGCCCTGAGGGCAGAGGG + Exonic
1077979699 11:7287215-7287237 CAAGAAGTGCAGAGTGAAGGGGG + Intronic
1078033996 11:7783708-7783730 AAAGAAGGCCAAGGGGAAGAAGG + Intergenic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1078713519 11:13817609-13817631 CAAGATCACCAGAGGAGAGAAGG + Intergenic
1078966280 11:16347994-16348016 CAAGAAGAAGAGAAAGAAGAGGG + Intronic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079517423 11:21285508-21285530 AAATAAGACCATAGGAAAGATGG - Intronic
1079528663 11:21421690-21421712 CAAGCAGACGAGAGAGAAAAAGG + Intronic
1079590668 11:22178744-22178766 CAAGAAGTACAGAGTGAAGGTGG - Intergenic
1080205636 11:29725775-29725797 AAAGAAGACCAAGGGGAAGAAGG + Intergenic
1080248152 11:30203031-30203053 CAAGACAGCCAGATGGAAGAGGG - Intergenic
1080358568 11:31484232-31484254 GAAGAAGAAAACAGGGAAGATGG - Intronic
1080915969 11:36659914-36659936 CAAGGAGAAAAGAGGGATGAAGG + Intergenic
1081663468 11:44902750-44902772 CAGGAAGACCTGAGGAGAGAAGG + Intronic
1081885962 11:46496667-46496689 CAAGAAGACAACAGAGAAAAAGG + Intronic
1082751561 11:57023950-57023972 ACAGAAGACAAAAGGGAAGAAGG + Intergenic
1083250545 11:61464015-61464037 CAAGAAGAGGAGAGAGGAGAGGG - Intronic
1083550175 11:63582359-63582381 CAACCAGCACAGAGGGAAGAAGG + Intronic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084095355 11:66907688-66907710 TTAGAAGAGCAGAGGGTAGAAGG - Intronic
1084337478 11:68468450-68468472 CAAGAAGTCCACAGTGAAAAGGG - Intronic
1084486579 11:69451682-69451704 AAGGAAGAAAAGAGGGAAGATGG + Intergenic
1085663768 11:78394384-78394406 AAAGAAGAGCAGAGATAAGAGGG + Intronic
1085801295 11:79592400-79592422 CAAGAAGACCAGAGGAGTAAAGG + Intergenic
1085906432 11:80769736-80769758 CAAGAAGTGCAGAGTGAAGGAGG - Intergenic
1088325459 11:108596239-108596261 CAAGAAGAGTAGAGTGAAGATGG + Intergenic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090357184 11:126147763-126147785 CAAGAAGGCCAGAGGCAGGTAGG - Intergenic
1090935514 11:131338419-131338441 CAAGAAGTGCAGAGTGAAGTGGG + Intergenic
1091053975 11:132401445-132401467 CAAGAAGCCCAGTGGGCAGTTGG - Intergenic
1092043055 12:5402605-5402627 AGAGCAGACCACAGGGAAGATGG - Intergenic
1092173568 12:6388339-6388361 CAAGAAGGGCAGAGGGGAGGAGG - Intronic
1092210677 12:6644434-6644456 CAAGAACACAAGCAGGAAGAGGG - Exonic
1092334298 12:7615153-7615175 GAAAAAGAAAAGAGGGAAGAAGG + Intergenic
1092507364 12:9117341-9117363 CAGGAAGACCAGATGGGAGCTGG + Intergenic
1092594085 12:9981193-9981215 CAAGAAGAACTGAAGTAAGATGG + Intronic
1093098531 12:14999596-14999618 CAAGAAGACCACAAGAATGAAGG + Intergenic
1093384664 12:18537498-18537520 ACAAAAGACCAGAGAGAAGATGG - Intronic
1093576844 12:20741084-20741106 AGAGAAGTACAGAGGGAAGAGGG + Intronic
1095319187 12:40805255-40805277 CCAGAAGAAAAGAGGGAAAAGGG - Intronic
1095646100 12:44549361-44549383 TAACAAGATCATAGGGAAGAGGG + Intronic
1095659759 12:44717862-44717884 CAAGGAGACCAGAGTGATGCAGG + Intronic
1096546360 12:52342830-52342852 GAAGAAGGCTGGAGGGAAGAGGG - Intergenic
1096666520 12:53169969-53169991 CATGGAGACGAGAGGGATGAAGG + Intronic
1097368246 12:58743287-58743309 GAAGAAGGGCAGAGTGAAGAGGG - Intronic
1098213227 12:68188016-68188038 CAAGAAGAAGAGAGGGAGAATGG + Intergenic
1098946908 12:76599682-76599704 AAAGAAGACCAAGGGGAAGAAGG + Intergenic
1099197407 12:79633935-79633957 AAATAAGACAAGAGGTAAGACGG + Intronic
1099279716 12:80628814-80628836 AAAGTAGAACAGAGGGAAGAAGG + Intronic
1099305657 12:80951825-80951847 CATAAAGACCTGAGGGAAGGGGG - Intronic
1100224617 12:92543531-92543553 CAAGTAATCCAGAGGGAATAAGG - Intergenic
1100616475 12:96235235-96235257 CAAGAAGGGCAGGGGGAAGGAGG - Intronic
1101091718 12:101293864-101293886 TAAAAAGACCAAAGGGAACACGG - Intronic
1102362776 12:112302636-112302658 AAAGAAGGCCAAGGGGAAGAAGG - Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102464530 12:113120683-113120705 CAAGTAGGCAAGAGGGAAGATGG + Intronic
1102503891 12:113371878-113371900 CAAGAAGGCCACAGGCTAGAGGG - Intronic
1102527044 12:113519797-113519819 CCAGAAGGGCAGAGGGAAGGGGG - Intergenic
1102660579 12:114524091-114524113 CAAGAAGTTCAGAGCGAAGTTGG + Intergenic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1103256304 12:119544241-119544263 CAAGAAGAGGAGAGGAGAGAGGG + Intergenic
1103898741 12:124292265-124292287 TAGGAAGGGCAGAGGGAAGAAGG - Intronic
1104170054 12:126271780-126271802 CAAGAAGTGCAGAGCGAAGGTGG + Intergenic
1105284689 13:18994482-18994504 CCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284765 13:18994947-18994969 CAAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284789 13:18995089-18995111 CCAGAAGGCCAGAGGGTAGAAGG + Intergenic
1105284955 13:18996079-18996101 AAAGAAGACCAGAGGACAGAAGG + Intergenic
1105284975 13:18996189-18996211 CTAGAAGGCCAGAAGGCAGAGGG + Intergenic
1105284985 13:18996254-18996276 GCAGAAGACTAGAAGGAAGAAGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1106753237 13:32796211-32796233 AAAGAAAGCCACAGGGAAGAAGG - Intergenic
1107569176 13:41638477-41638499 GAAGCAGACAAGAGGGAAGCTGG + Intronic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1107943378 13:45394627-45394649 GATGAAGACAAGAAGGAAGAGGG + Exonic
1108730254 13:53227906-53227928 CAGGAAGACCTCAGGGAATAGGG - Intergenic
1108796044 13:54032542-54032564 CAAGAAGTTCAGAGTGAAGGAGG + Intergenic
1109186293 13:59272698-59272720 CAAGAATACCACAAGCAAGATGG + Intergenic
1110135206 13:72059334-72059356 GTAGAAAACCATAGGGAAGAAGG - Intergenic
1110146590 13:72199177-72199199 CCAGATGACCAGAGGGAGGGGGG + Intergenic
1110342526 13:74409556-74409578 CAAGAAGCCCAGAGGCAACAGGG + Intergenic
1111299221 13:86324767-86324789 CAAGCCTACCAGAGGGCAGAGGG - Intergenic
1111915048 13:94351939-94351961 CAAGGAGAGGAGAGAGAAGAAGG + Intronic
1112317108 13:98372619-98372641 TAATAAGAAAAGAGGGAAGATGG + Intronic
1112404198 13:99103646-99103668 CAAGAAGAAAGGAGGGAGGAGGG - Intergenic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1113432712 13:110264454-110264476 TAAGAACAACAGAGGGAGGACGG + Intronic
1113433129 13:110267313-110267335 CAAGAAGGACAGAGGGAGAACGG + Intronic
1113588183 13:111480012-111480034 CATGAAAACCACTGGGAAGAAGG + Intergenic
1114814961 14:25946286-25946308 CAAGAATACCAGTGGGGATAAGG - Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115084094 14:29492727-29492749 CAAGAATCCCAGAGGGAGAATGG - Intergenic
1115165530 14:30444819-30444841 ACAGAAGACCAGAGAGCAGAAGG + Intergenic
1115550310 14:34499169-34499191 CAAGAAAACCAGTTGGAAGATGG + Intergenic
1115663464 14:35520968-35520990 CAGGAATACCAAAGGGAAGTAGG + Intergenic
1115700994 14:35952855-35952877 AAAGGAGACCACAGGGAGGAGGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117901162 14:60534929-60534951 CAAGAAGTACAGAGTGAAGTGGG - Intergenic
1118380708 14:65215248-65215270 CAAGAAGAGTAGAGGGGAGTTGG + Intergenic
1118629342 14:67688518-67688540 GGAGAAGAGCAGGGGGAAGAGGG + Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1120907632 14:89634090-89634112 GAACAAAACTAGAGGGAAGAAGG + Intronic
1121209830 14:92199898-92199920 CAAGAAGAGCAGAGAGGAGAGGG + Intergenic
1121296730 14:92832445-92832467 AGATAAGACCAGATGGAAGATGG + Intronic
1121344969 14:93128898-93128920 CAAGACCTCCAGAGGAAAGAAGG + Intergenic
1121399681 14:93662653-93662675 CAGGTAGGCCAGAGTGAAGACGG - Exonic
1121786598 14:96666184-96666206 AAAGGAGAGCAAAGGGAAGACGG - Intergenic
1121803773 14:96797146-96797168 CTAGAAGACCAGGGAGCAGAAGG + Intergenic
1121913848 14:97818255-97818277 AAAGAAGACAAGAGGAAGGAAGG - Intergenic
1122632746 14:103114473-103114495 CAGGAAGACTAGAGATAAGAAGG - Intergenic
1122927223 14:104910454-104910476 CCAGAATTCCAAAGGGAAGAGGG - Intergenic
1124957793 15:34370972-34370994 GAAGAAGAAAAGACGGAAGAAGG - Intergenic
1125235849 15:37512536-37512558 CCAGTAGACTAGAGGCAAGAAGG - Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1127365318 15:58284187-58284209 GAAGAAGAGAAGTGGGAAGAAGG + Intronic
1127484686 15:59408121-59408143 GAAGAAGGCCAAGGGGAAGAAGG - Intronic
1127484691 15:59408136-59408158 CAAGATGCCAAAAGGGAAGAAGG - Intronic
1127566499 15:60194280-60194302 CAGGAAGAGGAGAGGGAACAGGG - Intergenic
1127831205 15:62753159-62753181 CAAGAGGACAAGAGGGCACAAGG - Intronic
1128109215 15:65066145-65066167 AAAGAAGAAGAGAGGGATGAAGG + Intronic
1128341839 15:66827712-66827734 CAAGGAGAACAGAGGAAAGAAGG - Intergenic
1128637288 15:69311204-69311226 CAAGTAGAAGGGAGGGAAGACGG + Intronic
1128979837 15:72178185-72178207 CAAGAGGGCCAGGGTGAAGAAGG - Intronic
1131099127 15:89674220-89674242 CAAGTCGACCAGAGGAAGGATGG - Intronic
1131637840 15:94256844-94256866 GAAGAAGACCAGTGGAAGGAAGG - Intronic
1133754905 16:8755232-8755254 CGAGAAGACCAGAGGGAGGGAGG - Intronic
1134019457 16:10911331-10911353 AAAGAAGAAAAGGGGGAAGAAGG - Intronic
1134755488 16:16663653-16663675 GAAGAAGTCCTGAGCGAAGAGGG - Intergenic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1135172488 16:20198214-20198236 CAAAAAGATCAGAGGGCAAAAGG - Intergenic
1135709358 16:24701826-24701848 CCATAAGACCAGAAGGAAGGAGG - Intergenic
1135918134 16:26624404-26624426 CCAGAAAACCAGAGGGGAGGAGG + Intergenic
1136598752 16:31269860-31269882 ACAGAAGACTAGAGGGAGGAGGG - Intronic
1136922117 16:34341841-34341863 GAAGAAAACCTGAGGAAAGAGGG + Intergenic
1136946120 16:34653039-34653061 AAAGAAGAAAAGAAGGAAGAAGG + Intergenic
1136982456 16:35069965-35069987 GAAGAAAACCTGAGGAAAGAGGG - Intergenic
1137462165 16:48674887-48674909 GAAAAAGATCAGATGGAAGAAGG + Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138592517 16:58009847-58009869 GAAGAAGCCCAGAAGGCAGAGGG - Intronic
1138640992 16:58386703-58386725 CAAGAAGACGACAAGGATGAAGG + Intronic
1139147574 16:64342719-64342741 CAAGAAGAGTAGAGGTAATAGGG + Intergenic
1139871385 16:70111372-70111394 CAAGAACTTCAGAGGGAGGAGGG + Intergenic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140364550 16:74371117-74371139 CAAGAACTTCAGAGGGAGGAGGG - Intergenic
1140481366 16:75264679-75264701 GCAGATGACCAGAGGGAAGCTGG - Intronic
1140746307 16:77983319-77983341 CAAGAAGCACAGAGGGCAGGAGG + Intergenic
1141186113 16:81788807-81788829 CAAACAGTCAAGAGGGAAGATGG - Intronic
1141235759 16:82214519-82214541 CAAGAAGTGCAGAGTGAAGGAGG - Intergenic
1141477021 16:84280936-84280958 CAAGAAGTCCAGAGGTAGGCTGG + Intergenic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1141845211 16:86603834-86603856 AAAGAAGAGAAGAAGGAAGAGGG - Intergenic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142909292 17:3073333-3073355 GGAGAAGATAAGAGGGAAGAGGG + Intergenic
1142925268 17:3230905-3230927 GGAGAAGATAAGAGGGAAGAGGG - Intergenic
1143455353 17:7064191-7064213 CAAGAAAAACAGGGCGAAGAGGG + Intergenic
1143777715 17:9210231-9210253 CAGGAAGGTCTGAGGGAAGAGGG - Intronic
1143916196 17:10295180-10295202 CTAGAAGAGCAGAGGGAAGGAGG - Intergenic
1143998346 17:11028973-11028995 CAAGAAAGCCAGTGGGAGGATGG + Intergenic
1144120716 17:12150251-12150273 CACGAAGAACTGAGGAAAGAAGG + Intergenic
1144400567 17:14895112-14895134 CAGGAACTCCAGAGGGTAGAGGG + Intergenic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144879752 17:18425240-18425262 CTAGAAGACCAGAGGGGAGGAGG + Intergenic
1145736196 17:27233487-27233509 CAAGAAGCTCAGAGCAAAGACGG + Intergenic
1145994746 17:29098909-29098931 CAAGAAGAACAAAGGGGTGAAGG - Exonic
1146004814 17:29154585-29154607 CAAGATCAACAGAGGCAAGAGGG - Intronic
1146619996 17:34389684-34389706 CACGCAGACCAGATGGAAGCTGG - Intergenic
1146646929 17:34581960-34581982 AAATCAGACCAGAGGGAAGGAGG + Intronic
1147498813 17:40942534-40942556 GAAGAAGAAGAGAAGGAAGAAGG - Intergenic
1147498864 17:40942827-40942849 GAAGAAGAAGAGAAGGAAGAAGG - Intergenic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147948059 17:44091657-44091679 CCTCAACACCAGAGGGAAGATGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148171528 17:45524944-45524966 CAAGAAGACAAGTGGGAGTATGG - Intergenic
1148243089 17:46012781-46012803 CACCCAGGCCAGAGGGAAGAGGG + Intronic
1148277840 17:46321472-46321494 CAAGAAGACAAGTGGGAGTATGG + Intronic
1148300047 17:46539326-46539348 CAAGAAGACAAGTGGGAGTATGG + Intronic
1148364495 17:47043605-47043627 CAAGAAGACAAGTGGGAGTATGG + Intronic
1148794661 17:50191237-50191259 CAAAAAGGCCAGAGGGGAAAGGG + Intronic
1148862820 17:50613416-50613438 CAAGAGGCCCAGAAGGAAGGCGG - Intronic
1150558806 17:66277375-66277397 GAAGAAGAACAGAGAGAAGCTGG - Intergenic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151345799 17:73500499-73500521 GAAGGAGAACAGAAGGAAGATGG - Intronic
1151458745 17:74242204-74242226 CAAAAAGGCCAGAGGAATGAAGG + Intronic
1152337063 17:79704792-79704814 CAAGAGGGCGAGAGGGAGGAGGG + Intergenic
1152395356 17:80029687-80029709 AAAGGAGACAAGAGGGGAGACGG - Intronic
1153623337 18:7000374-7000396 GAAAAACAGCAGAGGGAAGATGG + Intronic
1153906821 18:9669176-9669198 CAAGAAGGGCAGAGGAAGGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155904115 18:31428868-31428890 CATGAAGTCCAGAGGGATAAGGG - Intergenic
1156522626 18:37734642-37734664 AAAGAAGAACAGAGGGAACTGGG - Intergenic
1156674779 18:39514424-39514446 AAAAAAGACAAGAGGGAGGAAGG + Intergenic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1156902430 18:42316056-42316078 CACTAAAACCAGAGGGCAGAAGG - Intergenic
1157027865 18:43868220-43868242 CAAGCAGACCAAAGGGAATTAGG - Intergenic
1157170458 18:45399872-45399894 GAAGAAGAAAAGAAGGAAGAGGG - Intronic
1157466197 18:47947920-47947942 CCAGAAGAATAGAGGGAATAAGG + Intergenic
1157698037 18:49739240-49739262 CAGGCAGACCAGAGTGAAGTTGG + Intergenic
1157741949 18:50101304-50101326 AAAGAAGGTCACAGGGAAGAGGG + Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1157945299 18:51972782-51972804 CAAGAAGGCTAGAGGGGAGCTGG - Intergenic
1158175186 18:54648402-54648424 CAAGAAGAGAAGAGAAAAGAAGG - Intergenic
1158897349 18:61927512-61927534 CCAGAAGACCCCAGGGCAGATGG - Intergenic
1160119052 18:76110972-76110994 GAACTAGACAAGAGGGAAGAAGG + Intergenic
1160755734 19:756218-756240 TAACAAGACCAGCGGGAAGAGGG + Intronic
1161137885 19:2631099-2631121 CATGAAGACCAGAGGAAGAATGG + Intronic
1161592185 19:5133860-5133882 CTAGAAGAACAGAGGGGAGAGGG - Intronic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1162516198 19:11149283-11149305 CAAGGAGAGCAGAGAGAAGGTGG + Intronic
1163466136 19:17469690-17469712 GAAGTAGACAGGAGGGAAGAGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1165426056 19:35746036-35746058 CTAGAGCACCCGAGGGAAGAGGG + Intronic
1168140263 19:54381208-54381230 CAAGAAGACCTGAAGGAGAAGGG - Intergenic
925034678 2:676573-676595 CCAGAAGACCAGAGGCACGGAGG + Intronic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926246933 2:11128664-11128686 CAACAAGACAACAGGGAAGCCGG + Intergenic
926534358 2:14092511-14092533 CGGGAAGAAAAGAGGGAAGATGG + Intergenic
926688900 2:15719207-15719229 CAAGAAGTGAGGAGGGAAGACGG + Intronic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
928244482 2:29615309-29615331 CTAGAAGAACAGAAGAAAGAGGG - Intronic
929241491 2:39658211-39658233 CAAGAAGGGCAGAGAGAAAACGG - Intergenic
929380009 2:41338035-41338057 AAAGAGGAACAGAGGGAAGGAGG + Intergenic
930417797 2:51110936-51110958 AAAGAAGACCAGAGAGAGGAAGG - Intergenic
930573086 2:53111510-53111532 TAAAAAGACAAGGGGGAAGAAGG + Intergenic
930755371 2:54967555-54967577 CAAGAGGACCACAGGGAACAGGG + Intronic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931544073 2:63361544-63361566 CAAGAATAACATAGGGAACATGG + Intronic
931760954 2:65416561-65416583 CAAGAAAAGCAGAGGGGAGGGGG + Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
933313953 2:80693602-80693624 CAAGAAGAATAGAAGGAGGAAGG + Intergenic
933620539 2:84534686-84534708 CAAGAGGAAAAGAGGAAAGAAGG - Intronic
933699853 2:85246844-85246866 CAAGTGGACAAGAGGGAAGGAGG - Intronic
934174313 2:89565809-89565831 AAAGAAGAACGGAGGGAAGGAGG - Intergenic
934284628 2:91640159-91640181 AAAGAAGAACGGAGGGAAGGAGG - Intergenic
934924093 2:98369569-98369591 CAAGAAAACCAGGGTCAAGAGGG + Intronic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935189765 2:100767551-100767573 CAACAATTACAGAGGGAAGAAGG + Intergenic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
936444955 2:112587917-112587939 CAAGGAGACCAGAGAGAGGCTGG - Intronic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937766672 2:125669238-125669260 CAAGAAGACTGGAGTGAAGCAGG - Intergenic
938572373 2:132572236-132572258 CAAGAACACCAGACGGAAGAAGG - Intronic
938708053 2:133951028-133951050 CAAGAAGACTAGAGGTAGGAAGG + Intergenic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
939763228 2:146211140-146211162 CAAGAAGAACAGAGGGTACATGG + Intergenic
940712557 2:157179894-157179916 CAAGAAGACAACAGGGTAGCTGG + Intergenic
940838135 2:158548436-158548458 AAAGAAGGCCAAGGGGAAGAAGG + Intronic
941235133 2:162962180-162962202 CAAGAATAACATGGGGAAGACGG - Intergenic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
942913024 2:181269224-181269246 CAAGAAGAAGAGAAGAAAGATGG - Intergenic
944299043 2:198101592-198101614 GAAGAAGTCTAGAGGGATGAGGG + Intronic
944331892 2:198478691-198478713 TAAAAAGACCAGAGATAAGAAGG - Intronic
944831636 2:203538830-203538852 CAAGAAGACCAGACTGGAGCAGG + Intergenic
944937578 2:204585136-204585158 CAAGAAAACAAGAGGGAAGAGGG - Intronic
944937827 2:204587898-204587920 CAAGAAGTCCAGAGCAAAGTGGG - Intronic
945071925 2:205999313-205999335 CAAGAAGGCGAAAGAGAAGATGG + Exonic
945225361 2:207528125-207528147 ACATAAGACCAGAGGGAAGAGGG + Intergenic
946588574 2:221218081-221218103 CATGATGACCACAGGGACGAAGG + Intergenic
946922650 2:224595757-224595779 CACGAAGTCCAGAGGCAGGATGG + Intergenic
947747924 2:232518896-232518918 CCTGAAGACCAGAGGCAGGAGGG + Intergenic
948311640 2:236991568-236991590 CAAGAAGGGCAGAGTGAAGTGGG - Intergenic
948676877 2:239602024-239602046 CAGGAAGGCCAGAGGGTAAATGG - Intergenic
948872341 2:240809295-240809317 AAAAAAGACCAGAGGGCAGAGGG + Intronic
949061272 2:241959182-241959204 AAATAGGACCAGAAGGAAGATGG + Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169352306 20:4878913-4878935 CAAAAAGATCAGAGAGGAGAGGG - Intronic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170487413 20:16832826-16832848 GAAGAAGAAAAGAGTGAAGAAGG - Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171365165 20:24618053-24618075 CAGGAAGAGCCGGGGGAAGAGGG + Intronic
1171482952 20:25467891-25467913 CAAGAAAACCAGAGAAAAAATGG + Intronic
1171941161 20:31331186-31331208 GAAGAAGAAGAGAGAGAAGAAGG + Intergenic
1172637599 20:36420491-36420513 AATGAAGACCCAAGGGAAGAGGG + Intronic
1174316781 20:49709302-49709324 CATAAAGGCCAGAGGGTAGAGGG + Intronic
1174950894 20:55040621-55040643 CAAGAATAGCACAGGAAAGACGG - Intergenic
1175804625 20:61820653-61820675 CAAGAACACAAGAGGGATGGGGG - Intronic
1175927752 20:62479364-62479386 CAAGAAGAGAAGAGGGCAAAGGG - Intergenic
1176697553 21:9998006-9998028 AAAGAAGGCCGAAGGGAAGAAGG - Intergenic
1177333982 21:19700008-19700030 CAAGAACACCACAGGGGAAACGG + Intergenic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1178293490 21:31388881-31388903 CAAGAAGACAAGGGGAAAGAAGG + Intronic
1178338477 21:31765293-31765315 CAAGAAGTCCAGAATGAAGAGGG - Intergenic
1178582407 21:33847848-33847870 CCAGGAGATCAGAGGAAAGATGG - Intronic
1179183599 21:39065638-39065660 CAAGAAAACCTGAGAGAAGCTGG + Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179229551 21:39489170-39489192 ACAAAAGACCAGATGGAAGAGGG + Intronic
1179393768 21:41018449-41018471 GCAGAATACCAGAGGGAAGGAGG + Intergenic
1180146846 21:45925899-45925921 CAAGTAGACAAGTGTGAAGAAGG + Intronic
1180338481 22:11599881-11599903 AGAGAAGAACAGAGGGAAGCAGG - Intergenic
1180839035 22:18950147-18950169 GAAGAAAACCTGAGGAAAGAGGG - Intergenic
1181615296 22:24050069-24050091 AAGGAAGACCAGAGGGCAAAAGG - Intronic
1182515249 22:30854946-30854968 CAAGGAGAACAGAGCGAAGTTGG + Intronic
1182683066 22:32097643-32097665 GAAGAAGACAAAAGGGAAGAAGG + Intronic
1182968010 22:34541199-34541221 CAAGAAGTGCCGAGGGAAGGTGG + Intergenic
1183420038 22:37706424-37706446 CAAGAAGGCCAGAGGCTAGGAGG + Intronic
1184064126 22:42106354-42106376 GAAGGAGAAGAGAGGGAAGAGGG + Intergenic
1184227084 22:43135204-43135226 CAAGAATACCAAAGGGAAGCTGG + Intronic
1184296731 22:43529791-43529813 AAAGAAGTCCAGAGGTAGGAAGG - Intronic
1184298159 22:43539273-43539295 TAAGTAGAGCAGAGGGAAGAGGG - Intronic
1184355354 22:43975875-43975897 AGAGAAAACCAGAGGGAAGAAGG - Intronic
1184542050 22:45132610-45132632 AAAGGAGGCCAGAGGGAAGAAGG + Intergenic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1184842190 22:47058557-47058579 CAAGCAGAAGAGAGGGCAGAGGG - Intronic
1185193556 22:49453809-49453831 CAAGAAGATCTGTGGGAGGAAGG - Intronic
949730232 3:7102737-7102759 AAAGAAGACCAGAAGAGAGAAGG - Intronic
949737845 3:7194938-7194960 GAAGAGGACCTGAGGGAAGAGGG + Intronic
949851907 3:8428503-8428525 CAATAAGACCTGAGGGGTGAGGG - Intergenic
950566058 3:13770400-13770422 TATGCAGACCAGAGGGGAGAAGG + Intergenic
951344627 3:21532277-21532299 GAAGAAGTCCAAAGGTAAGATGG - Intronic
951664813 3:25110986-25111008 AAAGAAGAACAGTGGGAATAGGG + Intergenic
951802494 3:26611829-26611851 CAAGAAGACAAGAGGGTATGGGG - Intergenic
951995366 3:28721973-28721995 CAAGAAGTGCAGAGCGAAGTGGG - Intergenic
952005501 3:28837934-28837956 CAAGAAGACTTGAAGAAAGATGG + Intergenic
952055489 3:29439952-29439974 CAGGAAGACCAGACGGAAGTCGG + Intronic
952262549 3:31754389-31754411 CAAGATGAGCGGAAGGAAGAGGG + Intronic
954272296 3:49519322-49519344 CAAGAAGGCTAAAGGGAAGCAGG - Intronic
954277352 3:49551294-49551316 GTAGAAGACCAGAGGGAAAATGG - Intergenic
954873846 3:53787725-53787747 CATGAGGACCAGCAGGAAGAGGG + Intronic
955150654 3:56363784-56363806 AAAGAAGGAAAGAGGGAAGAAGG + Intronic
955666636 3:61355991-61356013 CAAGCAGAGCAGGGGGAAGTGGG + Intergenic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
956214803 3:66837919-66837941 GAAGATGGCGAGAGGGAAGAAGG + Intergenic
956626620 3:71273120-71273142 CACAAGGACCAGAAGGAAGAAGG - Intronic
956750985 3:72343837-72343859 CAAGAGGGACAGAGGCAAGAGGG - Intergenic
960683749 3:120275969-120275991 GCAGAAGATCAGAGTGAAGAGGG - Intronic
961852488 3:129835167-129835189 CAAGAGGATCAAAGGAAAGAGGG - Intronic
962232414 3:133677035-133677057 AAAAAAGACCAAAGGGAAGGGGG + Intergenic
962956180 3:140269042-140269064 CAAGAAGACAAGAGGCACTATGG - Intronic
963053534 3:141163388-141163410 CCAGAAAAAGAGAGGGAAGAGGG - Intergenic
963226924 3:142871979-142872001 CAAGAAGAGTAGGGTGAAGATGG - Intronic
965080130 3:164023272-164023294 TAAGAAGAGAAGAGGGAAGCGGG + Intergenic
965904415 3:173685957-173685979 CAAGAAGGGTAAAGGGAAGAGGG + Intronic
966576243 3:181505849-181505871 AAAGAAGGCCAACGGGAAGAAGG - Intergenic
966885140 3:184373338-184373360 CTAGAAGACCTGAGGGAAGAAGG - Intronic
968680115 4:1912656-1912678 CAAGAAGCAGAAAGGGAAGATGG - Intronic
968885107 4:3324729-3324751 GAAGAAGGCCAAAGGGAAGGAGG - Intronic
969079367 4:4606579-4606601 TGAGAAGCACAGAGGGAAGAAGG - Intergenic
969301368 4:6299271-6299293 CAAGAGGAGCAGAGGGCTGAGGG - Intronic
970056598 4:11980320-11980342 AAAGATGATCACAGGGAAGATGG + Intergenic
970348878 4:15181055-15181077 CAAGAAGTCCAGAGGTAGGCAGG + Intergenic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
971436153 4:26626734-26626756 CAAAAAGACCATTAGGAAGAGGG - Intronic
971961651 4:33495767-33495789 AAAGAAGACCAGAGACAAAAAGG - Intergenic
972573296 4:40329833-40329855 CAGGAAGACAATAGGGAAGGTGG + Intergenic
972578722 4:40375954-40375976 AAAGAAAACCAGAGAGAGGAAGG - Intergenic
973107160 4:46354476-46354498 CAAGAAAAACACAGGGAACAAGG + Intronic
975170552 4:71227601-71227623 AAAGAAGAGCAAAGGGAAGAAGG - Intronic
975237252 4:72013732-72013754 CAGGAAGACTAGAGGGTAGAAGG + Intergenic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
979490412 4:121320323-121320345 CTAGCAGATCAGAGGGAGGAAGG + Intergenic
980370098 4:131857880-131857902 AAAGAAGGCCAAAGGGAAGAAGG - Intergenic
980447046 4:132922894-132922916 CAATAAGACCAGAGAGAGGTAGG - Intergenic
980525572 4:133987977-133987999 CAAGAAGTGCAGAGTGAAGTGGG + Intergenic
980591101 4:134890672-134890694 CAAGAAGTCCAGGGGAAAGCAGG + Intergenic
981193679 4:141893063-141893085 CAGGAAGACTAAAGGGAGGAGGG + Intergenic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981680349 4:147390338-147390360 CAATAAGAATAAAGGGAAGAAGG + Intergenic
982197867 4:152934743-152934765 CAAGGAGATCAAAGGGATGAGGG + Intergenic
982291127 4:153783776-153783798 CACAAAGAACAGAGGCAAGATGG + Intronic
982501047 4:156155166-156155188 CAGAAACACCAGAGGGCAGAAGG + Intergenic
983326394 4:166262893-166262915 CATGAAGACCAGAAGCAAGCTGG - Intergenic
984149894 4:176114931-176114953 CAAGAAGTTCAGAGTGAACAGGG + Intronic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
985287392 4:188349991-188350013 AAAGAAGGCCAAGGGGAAGAAGG - Intergenic
985374523 4:189321228-189321250 AAATAAAACCAGAGGGAAAAAGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
986164641 5:5263395-5263417 AATGAAGACCAGAGGGATGAAGG - Intronic
986224874 5:5803232-5803254 CAAGAAGAAAAGAGGTAAGATGG + Intergenic
987185647 5:15415651-15415673 AAGGAAGACAAGAGGGAGGACGG + Intergenic
988714489 5:33811598-33811620 CAAGGAGACTAGAGAGAAAATGG + Intronic
988810781 5:34783213-34783235 GAAGAAAACCAGAGGAAAGCGGG - Intronic
988833557 5:35009797-35009819 CAAGAATTCTAGAGGGATGAGGG - Intronic
989121328 5:38007490-38007512 CAAGAAGTGCAGAGCGAAGTTGG + Intergenic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
989308666 5:39987477-39987499 CAAGAAGAACAAAGAGAAGTAGG + Intergenic
989380444 5:40804751-40804773 AAAGAAAATCAGAGGGAAGTAGG + Intergenic
989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG + Intergenic
989792223 5:45419660-45419682 AAAGAAGATCAGACAGAAGAAGG + Intronic
990013047 5:51023415-51023437 CAGGAAGGCCAGAAGGGAGAAGG - Intergenic
990359636 5:55005827-55005849 TAAGAAGCTCAGAGGGAAGGTGG - Intronic
990635088 5:57716560-57716582 CAAGAAGACAACAAGGACGATGG - Intergenic
991319599 5:65356522-65356544 CAAGAGGACCAGAGAGCAGCTGG + Intronic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
992103411 5:73429342-73429364 TAAGGAGACCAGAGAGAAAAAGG + Intergenic
992447950 5:76850726-76850748 ACAGAAGAAGAGAGGGAAGAGGG + Intronic
992623449 5:78616042-78616064 GGAGAAGAACAGAGGGCAGAAGG - Intronic
993004768 5:82418183-82418205 CAAGCATACAGGAGGGAAGAGGG - Intergenic
993527061 5:88977821-88977843 CAAGAGTACCAGAAGGTAGAGGG + Intergenic
994214974 5:97127533-97127555 AATGAAGTGCAGAGGGAAGAAGG + Intronic
994441604 5:99813008-99813030 CAAAAATGCCAGAGGGATGAAGG + Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994944338 5:106366462-106366484 CAAAATGATCAGAGTGAAGAGGG + Intergenic
996367506 5:122718768-122718790 CAAGGAGACCAGAAGTTAGATGG - Intergenic
996578203 5:124999905-124999927 CAAGAAGGGCAGAGGAAAAAAGG + Intergenic
997311416 5:132886831-132886853 AAAGAAGACCAGCGAGAAGTGGG - Intronic
997372079 5:133368433-133368455 TAAGATCAACAGAGGGAAGAGGG - Intronic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
999081879 5:148852251-148852273 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999082092 5:148854331-148854353 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999929603 5:156416681-156416703 AAAGGAGACCAGAGAGATGAAGG - Intronic
1000565452 5:162841243-162841265 AGAGATGACCAGAGTGAAGAGGG + Intergenic
1000903321 5:166934782-166934804 GAAGCAGCCCAGAGGGAAGGTGG + Intergenic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1001677409 5:173530127-173530149 CAAGAAGCCCAGAGGCAGGCAGG - Intergenic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1003040773 6:2685488-2685510 CATCAAGACCAGAGGCATGAAGG - Exonic
1003263539 6:4546749-4546771 CTTGAAGACCACAGGGGAGAGGG - Intergenic
1003630199 6:7779780-7779802 CAAGAAAACCAAAGTGAAGGGGG + Intronic
1003763073 6:9203905-9203927 AAAGAAGAAAGGAGGGAAGAAGG + Intergenic
1003840909 6:10118463-10118485 AAAGAAGGCCAAGGGGAAGAAGG + Intronic
1004737904 6:18426601-18426623 AAAGAAACCCAGAGAGAAGAGGG - Intronic
1006022796 6:31127250-31127272 CCAGAACACAGGAGGGAAGATGG - Intronic
1006176746 6:32127152-32127174 GAGGAAGAGCAGGGGGAAGATGG + Exonic
1006676845 6:35770832-35770854 CTAGAAGACCAGGGGGACTAGGG - Intergenic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007965776 6:46002540-46002562 GAAGAGGACCAGAAGGAAGTGGG - Intronic
1008045786 6:46849901-46849923 GAAGAAGAAAAGAGGGGAGATGG - Intergenic
1009393818 6:63173540-63173562 CAAAGAGCCCAGAGGAAAGAGGG - Intergenic
1009745648 6:67811498-67811520 CCAGCAGATCAAAGGGAAGAAGG + Intergenic
1010147873 6:72693175-72693197 TAAGAAGACAAGCAGGAAGAAGG + Intronic
1010686937 6:78864276-78864298 CAAGAGGATCAGAGGTGAGATGG - Intergenic
1011259517 6:85456648-85456670 GGAGAAGACAAGAGAGAAGAGGG + Intronic
1011623954 6:89268496-89268518 CAAGCAGACCAGGGGGATGTGGG + Intronic
1011763512 6:90593937-90593959 CAAGAAGAAGAGCGGGAACAAGG + Intergenic
1011790376 6:90892560-90892582 CAAGAAGTGCAGAGTGAAGTAGG - Intergenic
1012307545 6:97677182-97677204 AAGGAAGCCCAGAGGAAAGAGGG - Intergenic
1012678878 6:102153746-102153768 TGAGAAGAAAAGAGGGAAGAGGG + Intergenic
1012779245 6:103535886-103535908 TCAGAAAAACAGAGGGAAGAGGG - Intergenic
1013114415 6:107090625-107090647 CAATAAGACAAGGGAGAAGAGGG + Intronic
1014062342 6:117086199-117086221 CCAGAAGAAGAGAAGGAAGAGGG + Intergenic
1014420675 6:121241016-121241038 CAAGAAGAAAAGAGGGAGAAAGG + Intronic
1014978522 6:127919156-127919178 CAAGCAGACAGGAGGGAAAATGG - Intergenic
1015434806 6:133173184-133173206 CAAGAAGAAGAGAAGAAAGAAGG + Intergenic
1015783946 6:136901129-136901151 AAAGAAGACCAAGGGCAAGACGG - Intronic
1015901361 6:138071367-138071389 AGAGAAGAGGAGAGGGAAGAGGG - Intergenic
1017191460 6:151658355-151658377 CAGGAATACCAGAGGGGAAAAGG - Intronic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1018775715 6:167013534-167013556 GAAGAAGACAAGCGGGCAGAAGG + Exonic
1019151024 6:170005964-170005986 CCAGAACACCATAGGGATGATGG + Intergenic
1019735678 7:2648785-2648807 CAAGGAGACCTGAGCGAGGAGGG + Intronic
1019812442 7:3174683-3174705 CCAGCAGGCCAGAGGGAAGGTGG - Intergenic
1020412863 7:7912415-7912437 AAAGAAAAACAAAGGGAAGAAGG - Intronic
1020807607 7:12809574-12809596 GAAGAAATCCAAAGGGAAGAGGG - Intergenic
1021508687 7:21411948-21411970 CAAGAAGCCCACAGGGAAGCTGG - Intergenic
1021893711 7:25212930-25212952 AAAGAAGGCCAAGGGGAAGAAGG - Intergenic
1021968230 7:25943153-25943175 CAGGAAGCCCAGAGGTAAGGAGG - Intergenic
1022047948 7:26638343-26638365 CGAGAAGTGCAGAGGGAAGGAGG - Intronic
1022468886 7:30669615-30669637 CAAGAAGACTAGAGAGCAGATGG - Intronic
1023176220 7:37438132-37438154 CAAGAAAACAAGAGGAAAGGTGG - Intronic
1023330019 7:39105088-39105110 CATCAAGAGCAGAGGGCAGATGG + Intronic
1023620745 7:42069655-42069677 AAAGAAGTACAGAGTGAAGATGG + Intronic
1024153576 7:46597901-46597923 GAAGAAGCCCAGAGAGAAGTAGG - Intergenic
1024252183 7:47514530-47514552 AAAGGAGACCAGAGGGAAAGTGG - Intronic
1024331504 7:48159988-48160010 CAGGAAGGCCAGCAGGAAGAAGG - Intergenic
1026015831 7:66669909-66669931 CAACGAGAACAGAGGGAAGTGGG - Intronic
1026788070 7:73314118-73314140 AAAGAAGGCCAAGGGGAAGAAGG + Intronic
1028835632 7:95371937-95371959 CAAGAAGACAAGTGGATAGAAGG + Intronic
1029058066 7:97767461-97767483 CAATAACAGCAGAAGGAAGATGG - Intergenic
1030162023 7:106518640-106518662 GAAGGAGAGGAGAGGGAAGAAGG - Intergenic
1030367866 7:108666822-108666844 GAAGAAGAAGAGAGGGAAGAAGG - Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1030841514 7:114359432-114359454 CTAGAAGAGCTGTGGGAAGAGGG + Intronic
1031339201 7:120578108-120578130 GAAGAAGAAAAGAAGGAAGAAGG + Intronic
1032139695 7:129316472-129316494 CAAAAAGTCCTGAGGGATGAAGG - Intronic
1032760206 7:134933487-134933509 CAAGAGGAGGAGAGGGAACAAGG + Exonic
1033022325 7:137738913-137738935 CAACGAGACCTGAGGGATGAGGG - Intronic
1033300150 7:140177654-140177676 CAAGGAGACCAGAGCGTCGATGG + Intergenic
1033554403 7:142476040-142476062 CAAGAGGAGCAAAGGGTAGATGG + Intergenic
1033559033 7:142513597-142513619 CAAGAGGAGCAAAGGGTAGATGG + Intergenic
1033626158 7:143111649-143111671 CTTGAAGACCAAAGGCAAGAAGG - Intergenic
1033919136 7:146366573-146366595 CAAGAAGACCAAAGGGATTTAGG + Intronic
1035172786 7:157028649-157028671 CCAGAAGACCAGTGAGAACACGG - Intergenic
1035339586 7:158151658-158151680 AAAGGAAACAAGAGGGAAGAAGG - Intronic
1036711306 8:11080774-11080796 CAAGAACACCAGAGACAAGCTGG + Intronic
1036711519 8:11082493-11082515 CAAGAACACCAGAGGCAAGCTGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037895706 8:22652923-22652945 CAACCATACCAGAGGAAAGAGGG - Intronic
1038546723 8:28431283-28431305 CAAGATGGGCTGAGGGAAGATGG + Intronic
1038608890 8:29040782-29040804 AAAGAAGACCAGAGTAAAAAAGG - Intronic
1039110232 8:34034016-34034038 GAGGAAGACAATAGGGAAGAAGG + Intergenic
1039334224 8:36572263-36572285 CAAGAAGTCAAGAAGGAAAAAGG - Intergenic
1039388468 8:37157804-37157826 CAAGAAGAGCAGAGGCTAAAAGG + Intergenic
1040617076 8:49047614-49047636 GAAGAAAGCCAGAGGAAAGATGG + Intergenic
1040691318 8:49942043-49942065 CAAAAAGACAAAAGGGAGGAAGG + Intronic
1040988247 8:53319707-53319729 CAACAAGACCAGATTGAAAATGG - Intergenic
1040988593 8:53324264-53324286 CAAAAAGAGCAAAGGTAAGAAGG + Intergenic
1041095252 8:54343164-54343186 GAAGGAGAAGAGAGGGAAGAAGG - Intergenic
1041813601 8:61940625-61940647 TAAGAAGTCCAGAAGTAAGATGG - Intergenic
1041939107 8:63367180-63367202 GAAGAAGACAAGAGGGCAGGTGG + Intergenic
1042692317 8:71514672-71514694 CAAGAATAGCACAGGAAAGATGG + Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044381458 8:91538975-91538997 CAAGAACACAAGATGGAAAAAGG - Intergenic
1044879960 8:96713525-96713547 CAAGAAGTGCAGAGTGAAGTGGG + Intronic
1044928527 8:97230039-97230061 GAAAAAGACAGGAGGGAAGATGG + Intergenic
1046577333 8:116047261-116047283 TAAGAGGACCAGAGAGTAGAGGG + Intergenic
1046755915 8:117972778-117972800 TAAGAAGTGCAGAGTGAAGAGGG + Intronic
1046783107 8:118236912-118236934 TGAGAAGACCAAAGGGCAGAAGG + Intronic
1046902899 8:119541808-119541830 CAGGAAGACAAGCGGTAAGATGG + Intergenic
1047428032 8:124764541-124764563 GAAGAAAGCCAGAGGGAAGAAGG + Intergenic
1048132924 8:131717512-131717534 AAAGAAGAGCAGAAAGAAGATGG + Intergenic
1048375088 8:133816284-133816306 AAAGAAGCCCACAGGGCAGAAGG - Intergenic
1048821200 8:138382310-138382332 TAAGCAGAGCACAGGGAAGACGG - Intronic
1048918994 8:139210775-139210797 CAGGAAGACCAGAGGCATCACGG + Intergenic
1049388186 8:142354774-142354796 CACGAAAAGCAGGGGGAAGAGGG + Intronic
1049431584 8:142567673-142567695 CTCGAGGACCAGAGGGATGAGGG + Intergenic
1049702930 8:144023230-144023252 GAAGAGGTCCTGAGGGAAGAGGG - Intronic
1050259649 9:3828061-3828083 CAGGAAAACCAGAGAGAAAAAGG + Exonic
1050340955 9:4638176-4638198 TAGGAAGACAGGAGGGAAGATGG + Intronic
1050396416 9:5202730-5202752 GATGAAGACTAGAAGGAAGAGGG - Intergenic
1051073399 9:13201514-13201536 GAAGGAGACCAGAGAGAAAAAGG - Intronic
1051160677 9:14204259-14204281 AAAGAAGGCCAAGGGGAAGAAGG + Intronic
1052276696 9:26684735-26684757 TAAGAACAACAGAGGGAAGCTGG + Intergenic
1052353087 9:27476985-27477007 GAAGAAGACGGGAGGGAGGAGGG - Intronic
1052915511 9:33922191-33922213 GAAGAAGACCTGAAGGCAGATGG + Exonic
1053238839 9:36479515-36479537 CCAGAAGACCAGGGAGCAGAAGG + Intronic
1053249025 9:36559085-36559107 CATGGAGCCCAGAGGGAAAAAGG - Intergenic
1053276165 9:36785040-36785062 AGAGAAGACCAAGGGGAAGAAGG + Intergenic
1053278555 9:36801472-36801494 CAGGAAGAGCAAAGAGAAGATGG + Intergenic
1053476330 9:38384548-38384570 AAGGAAGCCCAGAGGGAAGCAGG - Intergenic
1053634672 9:39984368-39984390 AAAGAAGGCCAAAGGGAAGAAGG - Intergenic
1053651739 9:40176509-40176531 GAAGAAGAAAAGAGGGGAGATGG + Intergenic
1053654078 9:40197706-40197728 GAAGAGGACGAGTGGGAAGAGGG + Intergenic
1053771256 9:41479965-41479987 AAAAAAGGCCAAAGGGAAGAAGG + Intergenic
1053902129 9:42805831-42805853 GAAGAAGAAAAGAGGGGAGATGG + Intergenic
1053904465 9:42826882-42826904 GAAGAGGACGAGTGGGAAGAGGG + Intergenic
1054209215 9:62266329-62266351 AAAGAAGGCCAAAGGGAAGAAGG + Intergenic
1054315602 9:63581801-63581823 AAAGAAGGCCAAAGGGAAGAAGG - Intergenic
1054366193 9:64343922-64343944 GAAGAGGACGAGTGGGAAGAGGG + Intergenic
1054530520 9:66178632-66178654 GAAGAGGACGAGTGGGAAGAGGG - Intergenic
1054532846 9:66199693-66199715 GAAGAAGAAAAGAGGGGAGATGG - Intergenic
1054673823 9:67833652-67833674 GAAGAGGACGAGTGGGAAGAGGG + Intergenic
1054729371 9:68685304-68685326 GATGAAGATCAGAGAGAAGAGGG - Intergenic
1054739855 9:68794004-68794026 GAAGAAGACATGAGAGAAGATGG + Intronic
1055006599 9:71514656-71514678 AAAGAAGACTAGATGGAATATGG - Intergenic
1055887493 9:81081221-81081243 GAAGAAGACAAGGGAGAAGATGG - Intergenic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1057810520 9:98253649-98253671 CAAGCAGACAAGAGGGAGAAAGG - Intronic
1057846175 9:98526407-98526429 TAAGGAGACCTGAGAGAAGAGGG - Intronic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058116622 9:101091954-101091976 TAAGAAGTGCAGAGGGAAGGAGG - Intronic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1058593770 9:106593069-106593091 CATGAAGACCAAAAGGAATAAGG + Intergenic
1059933258 9:119282496-119282518 GAAGAAGGACAGAGGGAGGAGGG + Intronic
1059937486 9:119325638-119325660 CAAGACGACCAGTAGGAAGATGG - Intronic
1060010534 9:120039685-120039707 GAAGAAGAGGAGGGGGAAGAGGG + Intergenic
1060801624 9:126548931-126548953 CAGGAAGGCCAGAGGAAAGGGGG - Intergenic
1060876083 9:127084516-127084538 CACAAAGAGCAGTGGGAAGAGGG - Intronic
1061136875 9:128739817-128739839 ACAGAAGACCAGAAGGAAGGTGG + Intronic
1061252458 9:129434521-129434543 GAAGAAGGCCAGTGGGAAGGGGG + Intergenic
1062058585 9:134482350-134482372 GCAGAAGATCAAAGGGAAGATGG + Intergenic
1185465278 X:350842-350864 GAAGCACACCAGTGGGAAGAGGG + Intronic
1185746759 X:2579648-2579670 CAAGAAGAGTTGAGGGAAGAGGG - Intergenic
1186623512 X:11266618-11266640 CATGAAGAGCAGAGAGAAAAGGG + Intronic
1186684227 X:11907953-11907975 AAAGAAGAGGAGAAGGAAGAAGG - Intergenic
1187081538 X:15994480-15994502 GAACAAGATAAGAGGGAAGAAGG - Intergenic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187257983 X:17658568-17658590 CTAGAAGACTAGAGGAATGATGG - Intronic
1189085872 X:38023232-38023254 GAAGAAAACAATAGGGAAGATGG - Intronic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1189574800 X:42340236-42340258 AAAGAAGAAAAGAGAGAAGAAGG - Intergenic
1189590927 X:42510294-42510316 AAAGAAGAAAAGAGAGAAGAAGG + Intergenic
1190298707 X:49043453-49043475 GAAGAAGACGAGGGGGAGGAGGG - Exonic
1191149377 X:57204468-57204490 AAAGAAAACCAGAGGAAAGTGGG - Intergenic
1193752922 X:85369334-85369356 CAAGAAGACAAGAAAAAAGAGGG + Intronic
1195146464 X:102022234-102022256 CAGGAAGAAGAGAGTGAAGAGGG - Intergenic
1196083743 X:111661422-111661444 CAAGAGGAAGAGAGGGAAGGGGG - Intergenic
1196245631 X:113396094-113396116 GAAGAAGATCAGAGAGGAGAAGG - Intergenic
1197457048 X:126689938-126689960 AAAGAAGAAGAGAGGGGAGAAGG - Intergenic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1197815983 X:130499293-130499315 CAAGAAAAACAAAGGGAATAAGG - Intergenic
1197880954 X:131165882-131165904 CCAGAAGAACAGAGGTCAGATGG + Intergenic
1199539500 X:148943555-148943577 CAAGAACACTAGAAGGTAGAAGG - Intronic
1199767000 X:150948590-150948612 AAAAAAAACCAGAGGAAAGAGGG + Intergenic
1199778578 X:151037568-151037590 CAGGAAGCCCAGTGGGCAGAAGG + Intergenic
1201073578 Y:10170810-10170832 AAGGAAGAACAGAGGGAAGGAGG - Intergenic
1201700650 Y:16877910-16877932 GAAGAAAACCTGAGGGAAGCAGG + Intergenic
1201958903 Y:19657086-19657108 GAAGAAAACCTGAGGAAAGAGGG - Intergenic