ID: 1179229666

View in Genome Browser
Species Human (GRCh38)
Location 21:39489997-39490019
Sequence ATGAGGGTATGGAGAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 600}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179229661_1179229666 1 Left 1179229661 21:39489973-39489995 CCATTACAAGGATTCTGTTCATG 0: 1
1: 0
2: 0
3: 7
4: 176
Right 1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG 0: 1
1: 0
2: 4
3: 46
4: 600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179229666 Original CRISPR ATGAGGGTATGGAGAAAAGA AGG Intronic
900861875 1:5239628-5239650 GTTAGCGGATGGAGAAAAGAGGG + Intergenic
901690278 1:10968681-10968703 AGGTGGGGATGGAGAAATGACGG - Intronic
903215400 1:21840982-21841004 ATGAGTGGATGGAGAGAGGAAGG - Intronic
904447993 1:30590032-30590054 ATTAGGTTATGGAGAGATGAAGG - Intergenic
905483447 1:38277416-38277438 ATGAGTGAATGGATAAACGATGG - Intergenic
906113364 1:43339006-43339028 ATGGGGATATGGAGAGAAAAAGG + Intronic
907193598 1:52668620-52668642 ATGAGTGTATGGAGCAAAGGAGG + Intronic
907829831 1:58054331-58054353 ATGAGGTTATGAAATAAAGATGG - Intronic
908131688 1:61081684-61081706 GCGGGGGTCTGGAGAAAAGAAGG - Intronic
908434981 1:64096877-64096899 GTGAGGTTGTGGAGAAAAAAAGG - Intronic
908843429 1:68300795-68300817 AGGAAGGAATGGAGGAAAGAAGG - Intergenic
908844355 1:68309875-68309897 ATGAGGGGATTCAGAATAGATGG - Intergenic
909022201 1:70444586-70444608 AGGAGGGAAAGAAGAAAAGAAGG - Intergenic
909089111 1:71204002-71204024 AGGAAGGAATAGAGAAAAGAAGG + Intergenic
909783488 1:79580208-79580230 CTGAGGGTAGAGAGAAATGAGGG - Intergenic
909923274 1:81407789-81407811 AATAGGGGAAGGAGAAAAGAAGG + Intronic
910159506 1:84258381-84258403 ATGAAGGTAAGGTGAAGAGATGG + Intergenic
910232216 1:84997926-84997948 ATGAGAGAGTGAAGAAAAGAAGG - Intergenic
910451533 1:87351574-87351596 AGGAGGGTAGGGAGAATGGAAGG + Intergenic
910825965 1:91407395-91407417 ATTAGGGAAAGGGGAAAAGAAGG - Intergenic
910925591 1:92395040-92395062 ATGAAATTATGGAGAAAAGATGG + Exonic
911378651 1:97084473-97084495 AAGAGGATATGGAGGAGAGAGGG - Intronic
911777179 1:101829390-101829412 TTGAGGGTATTGAAAAGAGAGGG - Intronic
912131818 1:106612772-106612794 AAGAGGGTGTAGATAAAAGAAGG - Intergenic
912160983 1:106984971-106984993 ATGAGGGTGAGGAGAGAGGAGGG - Intergenic
912506180 1:110157975-110157997 ATGAGGGGATGGAGCACAGCAGG - Intronic
912606561 1:110996045-110996067 GTGAGGATATGAAGAAAACAGGG - Intergenic
912752668 1:112298639-112298661 AAGGAGGTATGGAGGAAAGAAGG + Intergenic
913059308 1:115190253-115190275 ATGAGGGAATGCAGAAAGGCAGG - Intergenic
913491615 1:119385107-119385129 ATGGAGGAAAGGAGAAAAGAGGG - Intronic
913594052 1:120356382-120356404 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
914093204 1:144522608-144522630 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
914305320 1:146411280-146411302 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
914596737 1:149161532-149161554 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
914783711 1:150809175-150809197 ATGTGGGGAAGGAGAAAAAAAGG + Intergenic
916425014 1:164671894-164671916 AAGAGGGTCTGGAGAAGAAAGGG - Intronic
916510111 1:165465899-165465921 AGGAGGGTGTGGAGAAAGGGAGG - Intergenic
916532380 1:165669481-165669503 ATGTGTGTAAGGAGAAAAAAGGG + Intronic
916570789 1:166025497-166025519 AGGAGGGAAAGAAGAAAAGAAGG - Intergenic
916779534 1:168009514-168009536 AAGAAGGGATGGAGGAAAGAAGG - Intronic
916992740 1:170262097-170262119 AGGAGGGGGAGGAGAAAAGAGGG + Intergenic
917021170 1:170589507-170589529 ATTAGGAAATGGAGAAATGAGGG + Intergenic
917136656 1:171794522-171794544 CTGAAGGTATGGAGAACAAAAGG + Exonic
917267468 1:173236601-173236623 ATGAATGGATGGAGAAAATATGG + Intergenic
919026764 1:192181827-192181849 ATGGGAGGATGGAGAAAGGATGG - Intronic
919088971 1:192955655-192955677 ATGAGGGTAGCCAGAAAAAAAGG + Intergenic
919438989 1:197603113-197603135 ATGAGGGTGTATAGAAAATATGG - Intronic
919441328 1:197636901-197636923 AGGAGACTATGGGGAAAAGATGG + Intronic
921947139 1:220894075-220894097 GTTAGGGAATGGAGTAAAGAGGG - Intergenic
922249400 1:223834120-223834142 ATGAGGGCAGGGAGAACAGGGGG + Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
923316166 1:232782191-232782213 AGGAAAATATGGAGAAAAGATGG + Intergenic
923331357 1:232927749-232927771 ATGAGGCCATGGAGAAGAGCAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924059627 1:240158751-240158773 ATGAGAGTGTGGACAAAATAGGG - Intronic
924305509 1:242684571-242684593 ATGAAGGTATGGGTAAAAGAAGG + Intergenic
1062838936 10:654682-654704 ATGAGGACAGGGAGATAAGAGGG - Intronic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1063180689 10:3596352-3596374 AGGAGGGAAGGGAGAGAAGAGGG + Intergenic
1063260543 10:4384607-4384629 AAGAGGGAAAGAAGAAAAGAAGG - Intergenic
1063261733 10:4396843-4396865 AAAAGGGTATGGTGAAAATATGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064243595 10:13652183-13652205 ATGAGGCCATGGGTAAAAGAGGG - Intronic
1064895358 10:20229187-20229209 ATGAGGGAAGGGAGACAGGAGGG + Intronic
1064990389 10:21251744-21251766 ATGAGGACACAGAGAAAAGATGG + Intergenic
1065139135 10:22703562-22703584 ATGAGGGCAAGGAGGAAAGTGGG + Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065907104 10:30265810-30265832 GTGAGGATATGGAAAAAAGGGGG + Intergenic
1065951640 10:30657779-30657801 ATGAGTGGATGGAGAAAGGGAGG - Intergenic
1067068474 10:43116550-43116572 ATGAGGGAAGGGGGAGAAGAGGG - Intronic
1067399717 10:45959954-45959976 GTGAGGAACTGGAGAAAAGATGG - Intergenic
1067868045 10:49929248-49929270 GTGAGGAACTGGAGAAAAGATGG - Intronic
1068133966 10:52932069-52932091 AGGTGGGAATGGAGAAAAAAGGG + Intergenic
1068383068 10:56284175-56284197 ATGTGAGTATTGAGAAGAGAAGG - Intergenic
1068772134 10:60833831-60833853 GTCAGAGTAGGGAGAAAAGAGGG + Intergenic
1068829982 10:61482894-61482916 ATGAGGGTATTCAAAAGAGAAGG - Intergenic
1070330839 10:75415840-75415862 ATGAGGGTTTGGAGCAATGTGGG - Intergenic
1070470868 10:76778055-76778077 ATGCGCGTACAGAGAAAAGACGG + Intergenic
1070513457 10:77181716-77181738 ATCAGGATAAGGAGAAAATAAGG + Intronic
1071441623 10:85702989-85703011 ATAAGGAGATGAAGAAAAGAGGG + Intronic
1074186748 10:111104748-111104770 ATGAGGCCAGGGAGAAAAGTTGG - Intergenic
1077593186 11:3508768-3508790 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1077986019 11:7351824-7351846 CTGAGAGTAAGGAGAAAGGAAGG + Intronic
1078118910 11:8486111-8486133 TTGAGAGTATGGAGATCAGATGG - Intronic
1079346030 11:19653061-19653083 AGAAGGGAATGGAGAAAGGATGG - Intronic
1079511050 11:21210933-21210955 ATGATGGAAGGCAGAAAAGAAGG - Intronic
1079679607 11:23278416-23278438 TTGAGGCTCTGGCGAAAAGATGG + Intergenic
1079961184 11:26925931-26925953 ATGAAGACATGGAGAAAAGAAGG - Intergenic
1080255643 11:30287929-30287951 ATGTGGGTATGGAACAAAAACGG + Intergenic
1080915968 11:36659907-36659929 ATTAAGGCAAGGAGAAAAGAGGG + Intergenic
1081548549 11:44091044-44091066 AGGAGGGAATAGAGAAAAGGAGG - Intergenic
1082887989 11:58108669-58108691 ATGAAGACCTGGAGAAAAGATGG + Intronic
1083235564 11:61348630-61348652 GTGAGGTTATGGTGAGAAGATGG + Exonic
1084249021 11:67881486-67881508 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1084912729 11:72404218-72404240 ATGAGGGTGAGGAGAAGACATGG + Intronic
1085559755 11:77460397-77460419 ATGAGGTTGTGGAGACAGGAGGG + Intronic
1085923936 11:80991831-80991853 ATGAGGACACAGAGAAAAGAAGG - Intergenic
1086046021 11:82533051-82533073 ATGTGGGGTGGGAGAAAAGAAGG + Intergenic
1086720481 11:90115097-90115119 AAAAGGGTAGGGAGAAAGGAGGG + Intergenic
1087785549 11:102350315-102350337 AAGAGGGTTTGGAGAAAGGCTGG - Exonic
1088631454 11:111777731-111777753 GTGGAGGTATGTAGAAAAGAAGG - Intergenic
1088695171 11:112360274-112360296 ATGATGGGATGGAGAGAACATGG + Intergenic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1089916269 11:122159934-122159956 ATAGGGGTATGGAGAAATGAAGG - Intergenic
1090072412 11:123555321-123555343 AGCATGGTATGGTGAAAAGATGG + Intronic
1091209863 11:133847025-133847047 TTGAAGGTATGGGGAAGAGATGG - Intergenic
1092419306 12:8316908-8316930 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1092454645 12:8632410-8632432 ATGGGGTTATGGGGAAAAGGAGG + Intergenic
1092474894 12:8810077-8810099 ATGAGGGTATGGAGAGATAATGG - Intergenic
1093040623 12:14375425-14375447 ATAAGGGTTTGAGGAAAAGATGG + Intronic
1093680739 12:21999265-21999287 ATGAAGGTGTGGAATAAAGAAGG + Intergenic
1093743729 12:22716119-22716141 AGGAGGGCAGGGAGAAAAAAAGG + Intergenic
1093791685 12:23258641-23258663 AAGAGGCAATAGAGAAAAGAAGG + Intergenic
1094670714 12:32566191-32566213 GTGAGGTTATAGTGAAAAGATGG - Intronic
1096284101 12:50283354-50283376 AAGAGGGTGTGGAGAGAAGCCGG + Intronic
1096805811 12:54140578-54140600 AGGAGTGTAGGGAGAAAAAAGGG - Intergenic
1096915181 12:55024126-55024148 ATGAGGATAAGGAGAAAAAGGGG + Intronic
1097007750 12:55931358-55931380 ATGAGGGCGTGGAGAAAGGGTGG + Intronic
1097376376 12:58848197-58848219 ATGTGTGTGTGGAGAATAGAGGG - Intergenic
1098614193 12:72502856-72502878 ATGTGAATATGGAGAAATGAGGG + Intronic
1098617528 12:72547483-72547505 ATAAGGATCTGGAAAAAAGACGG + Intronic
1098917432 12:76272156-76272178 CTGAGGGGAGGGAGAAGAGACGG - Intergenic
1099552724 12:84068527-84068549 ATGAGGGAAATGAGGAAAGAGGG + Intergenic
1099868064 12:88309487-88309509 AGGAGGGAAGGAAGAAAAGAAGG - Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1101553877 12:105788606-105788628 ATCATGCTATGGAGGAAAGAAGG + Intergenic
1101870649 12:108562731-108562753 AAGAAGGTAGGGACAAAAGAGGG + Exonic
1102792554 12:115659466-115659488 ATGGGGGCAAGGAGAAAAGCAGG - Intergenic
1102992038 12:117322460-117322482 AGGAGGGAAGGGAGAAAGGAAGG - Intronic
1103030165 12:117606484-117606506 AGGAGGGGATGGAGGAAGGAAGG - Intronic
1103318231 12:120074261-120074283 ATGAAGGGAAGGAGAAAAGGAGG - Intronic
1103652433 12:122443398-122443420 AGGAGGGAATGAAGAAAGGAAGG - Intergenic
1103870745 12:124089862-124089884 ATGAGCAAATGGAGAAAAGAGGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105936809 13:25107955-25107977 GTGAGGGGAGGGAGAAGAGAGGG - Intergenic
1106178578 13:27351803-27351825 AGGAGGGAAGGAAGAAAAGAAGG - Intergenic
1106376121 13:29190011-29190033 ATGAGGACATAGTGAAAAGATGG + Intronic
1106770532 13:32957191-32957213 AAGCGGGTTGGGAGAAAAGATGG - Intergenic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1108055272 13:46479064-46479086 ATGAAGGGATGGACAAAAGTTGG + Intergenic
1108289004 13:48938957-48938979 ATAAGGGTATGGAAAAAGAATGG + Intergenic
1108697049 13:52911631-52911653 TAGAGGGTATGCAGAGAAGAAGG + Intergenic
1109326385 13:60872559-60872581 AGGAAGGCAAGGAGAAAAGATGG - Intergenic
1109339664 13:61039765-61039787 ACAAGGGTAGGGAGTAAAGACGG - Intergenic
1109690240 13:65878589-65878611 ATGAGGCAATGGAGAAAAAAAGG - Intergenic
1110706912 13:78607720-78607742 AGGAAGGAATGGAGAAAGGACGG + Intergenic
1110823160 13:79939989-79940011 ATGTGGGAGTGAAGAAAAGAAGG + Intergenic
1110964093 13:81669417-81669439 AGGAGGGAATGAGGAAAAGAAGG + Intergenic
1111987680 13:95081261-95081283 ATGTGGATGTGGAGAAAAGGGGG - Intronic
1112651401 13:101402813-101402835 ATGAGAGGAAGGAGAAAAGCAGG - Intronic
1113094127 13:106645755-106645777 ATGATGGAATGGAGAATTGAAGG + Intergenic
1113426623 13:110213685-110213707 ACGAGGGCAAGGAGAAAGGAGGG + Intronic
1113658930 13:112090715-112090737 AGGAGGGAAGGAAGAAAAGAAGG + Intergenic
1113733481 13:112658627-112658649 AGGAAGGTAGGAAGAAAAGAAGG + Intronic
1113808894 13:113125740-113125762 TTGAGGGAATGAAGGAAAGATGG - Intronic
1115114297 14:29861207-29861229 AAAATGGAATGGAGAAAAGAGGG + Intronic
1115622154 14:35151535-35151557 ATGGGGATATGAAGGAAAGAGGG - Intronic
1116058103 14:39888310-39888332 AAGAGAGGAAGGAGAAAAGAAGG + Intergenic
1116719490 14:48476504-48476526 ATGAGGGTTTGGAGAACATGGGG + Intergenic
1117166706 14:53041769-53041791 ATGAGAGTCTGGAAGAAAGAAGG + Intronic
1117339934 14:54784180-54784202 ATGAGGGTACAGAGATAACAAGG + Intronic
1117398040 14:55330831-55330853 AAAAGGCTATGGAGAAAAAAGGG - Intronic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118225025 14:63890564-63890586 ATGAGGGGAGGGAGACAGGAGGG + Intronic
1118501275 14:66364832-66364854 ATGAAGGTAGGGAGATAAGTAGG + Intergenic
1118615331 14:67571316-67571338 GTGAGAGTATGGGGAGAAGATGG - Intronic
1119833195 14:77722252-77722274 ATGAGGGCATAGAGTAAAGTAGG - Intronic
1120142591 14:80945184-80945206 CTGAGGATACAGAGAAAAGATGG - Intronic
1120414942 14:84207487-84207509 ATGAAGGAAGGGAGAAAAGGGGG - Intergenic
1120512075 14:85427122-85427144 ATCTGGGTTGGGAGAAAAGAGGG - Intergenic
1120515198 14:85462218-85462240 ATGAAGGAAAGAAGAAAAGAAGG - Intergenic
1120764444 14:88315890-88315912 ACAAGGGAATGAAGAAAAGAAGG + Intronic
1120848506 14:89147490-89147512 GTGGGGGAATGGATAAAAGAGGG + Intronic
1121863504 14:97341074-97341096 ATGAGAGTATAGAGAAGAGAGGG + Intergenic
1122706505 14:103625260-103625282 AAGAGGGTGGGGAGGAAAGAGGG - Intronic
1122753001 14:103953223-103953245 AGAAGGGTATGGAGAAGAGCTGG - Intronic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1124872324 15:33555340-33555362 GGGAGGGTATGGAGCAAAGGAGG + Intronic
1124967284 15:34444435-34444457 ATGAGAGTTTGGGAAAAAGAAGG + Intergenic
1126796254 15:52262432-52262454 ATGGGGGTTTGGGGAAAAAAGGG + Intronic
1127517818 15:59713404-59713426 AGGAGGGAAGGGAGGAAAGAAGG - Intergenic
1127629613 15:60814815-60814837 ATGAGAGTATGGAGAAATAAAGG + Intronic
1127726098 15:61751546-61751568 ATGAGGGTAAGGGTAAGAGAAGG - Intergenic
1127851217 15:62913553-62913575 ATGAAGGTATGGAGGAGAGATGG + Intergenic
1128839400 15:70837485-70837507 TTGAGGGGATGGAGTAGAGAAGG - Intronic
1129513166 15:76139776-76139798 AGCATGGTATGGAGAAAAGTGGG + Intronic
1129914987 15:79260908-79260930 ATGAGGGCAGGGAGAGAAAAAGG + Intergenic
1130418553 15:83717541-83717563 GTAAGGGAAGGGAGAAAAGAAGG + Intronic
1130449176 15:84033701-84033723 ATGAGGCTGTGAAGAAAAGTAGG - Intronic
1131349948 15:91690387-91690409 AAAAGGGTATGCAGAAAAAAAGG - Intergenic
1131403336 15:92143998-92144020 AGCAGGGTAGGCAGAAAAGAAGG + Intronic
1131569228 15:93516874-93516896 TTGAGGGTAGGGAGAAGACAAGG - Intergenic
1131985720 15:98041549-98041571 ATGAGGGAATTCAGGAAAGAGGG - Intergenic
1132169180 15:99630005-99630027 AAGAGGGGAGGGAGAAGAGAGGG - Intronic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1133358821 16:5157379-5157401 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1133361738 16:5179470-5179492 GTGAGGGTATGATGAGAAGATGG - Intergenic
1133470331 16:6069023-6069045 ATGAAGGAAGGGAGAAAGGAAGG + Intronic
1133560390 16:6945150-6945172 ATGAGAGTATGGGGAAAAAAGGG + Intronic
1133702548 16:8322595-8322617 ATGAAGGGATGGAGAGAAGGTGG - Intergenic
1134634813 16:15784242-15784264 ATGATGGCAGGGAGAGAAGAGGG + Intronic
1134804030 16:17109549-17109571 AACAGGGTATTGAGACAAGAGGG + Intronic
1135353217 16:21747930-21747952 GTTTGGCTATGGAGAAAAGATGG - Intronic
1135451704 16:22564053-22564075 GTTTGGCTATGGAGAAAAGATGG - Intergenic
1135565477 16:23508388-23508410 AGGAGGCAATGGAGAACAGAAGG - Intronic
1136291063 16:29271652-29271674 ATGAGGGAGGGGAGAAAAGAAGG + Intergenic
1136483837 16:30558469-30558491 ATGAGGGTACGGAGAGAACGCGG - Intronic
1137857185 16:51806740-51806762 ATGAGGATATAGTGAGAAGATGG - Intergenic
1139316409 16:66073730-66073752 TTGAGGGAGTGGAAAAAAGAAGG + Intergenic
1139368289 16:66447414-66447436 ATGAGGGTTTGGTGAACACAGGG + Intronic
1139657877 16:68399912-68399934 ATGAGGCTACGGAGAGAAGCTGG - Intronic
1139684304 16:68590776-68590798 AGGAGGGAAGGGAGAAAAGAAGG - Intergenic
1140046881 16:71445572-71445594 ATAATAGTATGGAGAAAATAGGG - Intergenic
1140239971 16:73191811-73191833 AAGAGGGGAAGGAGAAAAGCTGG + Intergenic
1140642265 16:76989889-76989911 ATTAGGGCAGGGAGAAAAAATGG + Intergenic
1140962227 16:79927271-79927293 ATGAGATTATGGAGAAAAACAGG - Intergenic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141856215 16:86683075-86683097 AGGAGGGAAGGAAGAAAAGAAGG + Intergenic
1142096933 16:88245126-88245148 ATGAGGGAGGGGAGGAAAGAAGG + Intergenic
1142321571 16:89386501-89386523 ATGAGGGTGTGGGGGAAAGGGGG + Intronic
1142346872 16:89559769-89559791 GTGAGGGTAGGGAAGAAAGAGGG + Intergenic
1143250243 17:5518155-5518177 ATGAGGGTTTGGATTCAAGATGG - Intronic
1144032660 17:11336325-11336347 ATGTGGGTATGGGGTAAAGGAGG + Intronic
1144392856 17:14812273-14812295 ATGGGGGCTTGAAGAAAAGAAGG - Intergenic
1144414281 17:15031685-15031707 ATCAGGGTTTGGAGAAACCATGG + Intergenic
1144508890 17:15857983-15858005 ATGAATGGATGAAGAAAAGATGG - Intergenic
1145173005 17:20675623-20675645 ATGAATGGATGAAGAAAAGATGG - Intergenic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146965221 17:37022042-37022064 ATAAGGGTACAGATAAAAGAAGG + Intronic
1147031966 17:37645759-37645781 ATGTGTGAATGGAGAAGAGAAGG + Intergenic
1147176775 17:38660694-38660716 AGGAGCTTATGGAGAGAAGAGGG - Intergenic
1147334768 17:39720574-39720596 AAGGGGGTATGGAGAGGAGAGGG + Intronic
1148604483 17:48918662-48918684 ATGAATGTTTGGAGAAAGGATGG - Intronic
1148643610 17:49206392-49206414 ATGAGAGTAGAGGGAAAAGACGG + Exonic
1148989985 17:51657472-51657494 AGGTGGGTCTGGAGAAAAGCAGG + Intronic
1149066814 17:52490359-52490381 ATGAGTATATGTAGAAACGAGGG + Intergenic
1149707119 17:58705266-58705288 ATGAGGACACAGAGAAAAGATGG - Intronic
1149885787 17:60338806-60338828 TTGAGGGGATTGAGAAAACAAGG - Intronic
1149934168 17:60787051-60787073 ATTAGGGTAGTGAGAAAAAAAGG - Intronic
1149962669 17:61129147-61129169 CTGAGGGTATGGAGTAAGAAAGG + Intronic
1150481368 17:65514016-65514038 ATGAGGGTACTGTGAAGAGAAGG + Intergenic
1152776297 17:82204113-82204135 ACGAGGCTCTGGAGCAAAGACGG + Intronic
1153319674 18:3760242-3760264 ATGAGGGCCTGGAGAAAATCAGG + Intronic
1153859386 18:9185622-9185644 ATGAGGATATGTAGAAAGTATGG + Intronic
1154205591 18:12334150-12334172 GGGAGGCTATGGAGAAGAGAGGG - Intronic
1154365902 18:13708779-13708801 ACTAGGCTCTGGAGAAAAGAAGG - Intronic
1155040397 18:22060537-22060559 ATTAGGAAATGGAAAAAAGAGGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155642327 18:28033104-28033126 AGTAGGGTATAGACAAAAGATGG + Intronic
1155760405 18:29558352-29558374 AAGAGGGGATTAAGAAAAGAAGG + Intergenic
1155897289 18:31346139-31346161 ATGAGGGAATGTAGAGAAGGAGG + Exonic
1156316876 18:35977707-35977729 AAAAGGGTATGGAGGAAAAATGG - Intronic
1156598961 18:38581109-38581131 TTGATGGTATGAAGAAAAGCAGG - Intergenic
1156825249 18:41423340-41423362 AAGAGGGACTGGAGAAAAAAAGG - Intergenic
1157023121 18:43810445-43810467 ATGAATGGATGGAGAAAAGGAGG + Intergenic
1158054395 18:53261333-53261355 ACGAGGGTGTGGAGCCAAGATGG - Intronic
1158086060 18:53653180-53653202 GAGAGGGTAATGAGAAAAGAAGG + Intergenic
1158251093 18:55488441-55488463 ATTAGGAGATGGAGAAGAGAGGG + Intronic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1158817502 18:61120208-61120230 ATGAAGGGATGAAGAAAATATGG - Intergenic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159283112 18:66312307-66312329 AAGAAGGAATGAAGAAAAGATGG + Intergenic
1159356097 18:67338377-67338399 ATGAAGGAATGGAGGAAGGAAGG - Intergenic
1159394434 18:67838124-67838146 AAGAAGGAAGGGAGAAAAGAAGG - Intergenic
1159555170 18:69938306-69938328 TAGAGGGCATAGAGAAAAGAGGG - Intronic
1159993424 18:74938173-74938195 ATGACTATATGGACAAAAGAAGG - Intronic
1160053875 18:75461627-75461649 AGGAGGGTAGGAAGAAAGGAGGG - Intergenic
1161329203 19:3678369-3678391 ATGGAGGGATGGAGAATAGATGG + Intronic
1161752702 19:6109733-6109755 TTGAGGGTATGAGTAAAAGAGGG + Intronic
1162335220 19:10055968-10055990 ATGTGGGGATGAAGAAGAGATGG - Intergenic
1163297649 19:16422503-16422525 ATGAGGGAGTGGAGAGAAAAAGG + Intronic
1164587069 19:29482621-29482643 TTGAGGGCAGGGGGAAAAGAAGG - Intergenic
1165476014 19:36031547-36031569 AGGAGGGTATGGAGCTGAGAGGG - Intronic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1168261855 19:55199705-55199727 AGGAGGGGAGGGAGAAAGGAAGG + Intronic
925149200 2:1602947-1602969 GTGAGGTTATGGTGAGAAGACGG - Intergenic
925602737 2:5625753-5625775 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
926440831 2:12886825-12886847 ATGAGGGTATGGAGAAGGAATGG + Intergenic
926597316 2:14805362-14805384 ATGAGGGTAAGGAGGAAAACCGG + Intergenic
926818821 2:16829344-16829366 ATGAGGGTATAGATAAAACAAGG - Intergenic
927153752 2:20210301-20210323 AGGAGCTTTTGGAGAAAAGAGGG + Intronic
927220654 2:20705483-20705505 AAGAGGGGATGGAGAAAACAGGG - Intronic
927512105 2:23650195-23650217 CTCAGGGGCTGGAGAAAAGAGGG + Intronic
928279822 2:29935837-29935859 ATCAGGCTATGGAGAAAAGGAGG - Intergenic
929059951 2:37913941-37913963 AGGAGGAGAAGGAGAAAAGACGG + Intergenic
929444769 2:41993026-41993048 GTGCGGGGAGGGAGAAAAGATGG - Intergenic
929651487 2:43684181-43684203 AAGAAGGGAAGGAGAAAAGAAGG - Intronic
929831578 2:45351033-45351055 ATGAGGAGTGGGAGAAAAGAAGG - Intergenic
930673129 2:54172423-54172445 TTGATGATTTGGAGAAAAGAAGG - Intronic
930894280 2:56427283-56427305 AGGAGCGTAGGGAGAAAAAAGGG + Intergenic
930926694 2:56826832-56826854 ATGTGGGCATGGAGAAATGTTGG + Intergenic
931039422 2:58280536-58280558 ATGAAGGAAGGAAGAAAAGAAGG + Intergenic
931063695 2:58560380-58560402 ATGAAGAAATGGAGAAAGGATGG + Intergenic
931208378 2:60169341-60169363 TTGAATGTATGGAGGAAAGAAGG - Intergenic
931991663 2:67796659-67796681 GAGAGGGTATGAAGAAAAAATGG - Intergenic
932513857 2:72324802-72324824 TTGAGGGGTTGAAGAAAAGAGGG + Intronic
932932927 2:76063416-76063438 ATGAGGAAATAGAGAAAAGCAGG + Intergenic
935623578 2:105149611-105149633 AAGAGTGAATGGATAAAAGATGG + Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
935913896 2:107927867-107927889 GTGAGGCTATGGGGAGAAGATGG - Intergenic
936599368 2:113880853-113880875 AGGATGGAAGGGAGAAAAGAAGG - Intergenic
936679837 2:114757302-114757324 AAGAGGGAAGGGAGAAAGGAGGG + Intronic
938515269 2:131998121-131998143 GTGAGGATATAAAGAAAAGACGG + Intergenic
939234404 2:139472433-139472455 ATGAATGGATGGAGAAAATATGG + Intergenic
939623232 2:144446333-144446355 AGGAAGGGAGGGAGAAAAGAAGG - Intronic
939679756 2:145115878-145115900 ATGAGAGTTTGGAGAAGAAAGGG + Intergenic
939959757 2:148556149-148556171 ATGGGGGAATGAAGAAGAGAGGG - Intergenic
940754640 2:157668227-157668249 CTGAGGATATGGAGTAAAAAAGG - Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941339294 2:164286939-164286961 ATGAGGGAAGGAAGGAAAGAGGG + Intergenic
941474882 2:165938741-165938763 AAGAGGGGAAGGAGAAAGGAAGG + Intronic
941849154 2:170161841-170161863 ATGAGCTTATGGTGAAAACATGG + Intergenic
942114050 2:172710665-172710687 AGGCTGGTATAGAGAAAAGAAGG - Intergenic
942627071 2:177912594-177912616 CTGAGGGTCTGGAAATAAGAGGG - Intronic
942873439 2:180764173-180764195 GGGAGGGGATGGAGAAAAAAGGG + Intergenic
943328221 2:186527040-186527062 ATGAGTGGATAGAGAAAACATGG - Intergenic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943812691 2:192209287-192209309 ATGAGTAAATGAAGAAAAGAAGG - Intergenic
945020573 2:205567010-205567032 ATGAGGGTAAGAAGAAACGGTGG + Intronic
946170137 2:217890265-217890287 ATGAGGCTAGGAAGGAAAGAGGG - Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946327144 2:218990604-218990626 ATGAGGGGGTGGAGGAAATAAGG - Intronic
946940723 2:224767658-224767680 TTAAGGGCAGGGAGAAAAGAAGG - Intronic
947835987 2:233176123-233176145 ATAAGGATATTGATAAAAGAGGG + Intronic
1168975603 20:1963216-1963238 AGGAAGGGACGGAGAAAAGAAGG + Intergenic
1169014046 20:2277092-2277114 ATGAGTGGATAGAGAAAAGGTGG - Intergenic
1169728587 20:8762698-8762720 ATGAGGCCATGGAGAAAACCAGG - Intronic
1169948218 20:11012145-11012167 GTGAGGGTATGGTGAGAAAATGG - Intergenic
1169949017 20:11022058-11022080 ATGAGTGTATAAAGAAAATATGG + Intergenic
1170501839 20:16982518-16982540 AGGAGGGAAAGAAGAAAAGAAGG - Intergenic
1171256527 20:23692839-23692861 GTGAGGAGAGGGAGAAAAGAAGG - Intergenic
1171263878 20:23754766-23754788 GTGAGGAGAGGGAGAAAAGAAGG - Intergenic
1171273055 20:23831443-23831465 TTGAGGAGAGGGAGAAAAGAAGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172905773 20:38368210-38368232 ATGAGGGGATGGAGAAACCTTGG + Intronic
1173104075 20:40115433-40115455 ATGAGGGGACATAGAAAAGAAGG + Intergenic
1173590193 20:44219153-44219175 AGGAGGGAAAGGAGAAAGGATGG - Intergenic
1174360277 20:50024494-50024516 ATAAGGGTAAGGGGTAAAGAAGG - Intergenic
1175062294 20:56254637-56254659 ATGAGGGGAAGGAGAGGAGAAGG + Intergenic
1176366058 21:6033672-6033694 ATGAGGGGAAGAAGTAAAGATGG - Intergenic
1176932187 21:14826832-14826854 ATGAGGCGATTGAGAAAAGGAGG - Intergenic
1177214892 21:18115467-18115489 ATGGAGGTGTGGAAAAAAGAAGG - Intronic
1177665226 21:24147946-24147968 AAGAGGATAAGGAGAAAGGAGGG - Intergenic
1178774719 21:35538936-35538958 ATGAAAGTATGCAGCAAAGAGGG - Intronic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179381687 21:40905285-40905307 ATGTGTGTAAGGGGAAAAGAAGG + Intergenic
1179757459 21:43504873-43504895 ATGAGGGGAAGAAGTAAAGATGG + Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182113580 22:27742080-27742102 AGGAGGGAAAGGAGAAAAGAGGG - Intergenic
1182198520 22:28544532-28544554 ATTAGGGGATGGATAAAATAAGG + Intronic
1182446759 22:30394139-30394161 ATTAGGGGATGGAGAAAAAGTGG + Intronic
1182582798 22:31325182-31325204 GTGAATGTATGAAGAAAAGAGGG - Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183724845 22:39582781-39582803 GTGAGTGTATGGGGGAAAGATGG - Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949765740 3:7523814-7523836 ATGCGGGGATGGGGAGAAGAAGG + Intronic
949879381 3:8649619-8649641 ATGCGGGTATGAGGAAAAGGGGG - Intronic
950876762 3:16282569-16282591 TTGAGAGTATGAAGAGAAGAGGG + Intronic
951149626 3:19273436-19273458 ATGATCCTCTGGAGAAAAGAAGG - Intronic
951530683 3:23695422-23695444 ATGTGGGTATGTACAAAACAAGG - Intergenic
952031713 3:29150640-29150662 AAGAGGATGTGGAGAAAAGAAGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952740742 3:36731798-36731820 GTGAGGGGAGGGAGAAAAGAAGG - Intronic
952951311 3:38527724-38527746 CTGAGGGTAAAGAGAACAGAAGG - Intronic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
955642845 3:61105116-61105138 GTGATTGTCTGGAGAAAAGAAGG + Intronic
956016851 3:64892945-64892967 AGGAGGGTCTGCTGAAAAGATGG - Intergenic
956725851 3:72156015-72156037 ATGGGGCAATGGGGAAAAGACGG + Intergenic
957063288 3:75499656-75499678 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
957182229 3:76893799-76893821 AGGAGGGTATGAAGAATGGAAGG - Intronic
957228003 3:77473917-77473939 ATGGGGGTTTGGAGGAAGGAAGG - Intronic
958506988 3:94992546-94992568 ATGAAGGTAAGAAGAAAAGAAGG + Intergenic
959349842 3:105248323-105248345 GTGAGGACATGGAAAAAAGATGG + Intergenic
959869722 3:111312634-111312656 ATTCTGGTATGGAGAAAACAAGG - Intronic
960008640 3:112808932-112808954 ATGATGGAAGGGAGAATAGAAGG - Intronic
960092437 3:113655334-113655356 AGGAGAGTATGGAGGATAGAAGG + Exonic
960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG + Intergenic
960255786 3:115510104-115510126 ATGTGGGAATGAAGAAACGAAGG + Intergenic
960967877 3:123117700-123117722 ATGAGTGTATGAAGAAAATGTGG - Intronic
961290110 3:125839921-125839943 ATGAGGGTCTTCAGCAAAGATGG + Intergenic
961522765 3:127476749-127476771 AAGAGGGAAGGGAGAAAAGTAGG + Intergenic
961896990 3:130176107-130176129 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
961948291 3:130717591-130717613 ATGAATCTATGAAGAAAAGAAGG + Intronic
962071145 3:132034880-132034902 AGGAGGGTACTGAGAAAAGAGGG + Exonic
963033164 3:140999454-140999476 ATGAGGGTAGGGAGGAATAAAGG - Intergenic
963075830 3:141345437-141345459 ATGGGGGCATGAAGAAATGAGGG + Intronic
963306165 3:143655552-143655574 AAGAGGGTATGTAGAGGAGAAGG - Intronic
963650249 3:147970385-147970407 ATGAAGATATGGAGAAGATATGG - Intergenic
963673870 3:148284204-148284226 ATGAGGACATAGAGAGAAGATGG - Intergenic
964432128 3:156618374-156618396 ATGAGGCAATTGAGAACAGACGG - Intergenic
964564339 3:158033193-158033215 AGGAGGATGAGGAGAAAAGAAGG + Intergenic
965682525 3:171266095-171266117 AGGAGGGAAAGAAGAAAAGATGG + Intronic
966666644 3:182479208-182479230 AAGAGGCTATAGAGAAAGGAAGG + Intergenic
967012667 3:185451309-185451331 ATGAGTGTCTGCCGAAAAGAAGG - Exonic
967241723 3:187446038-187446060 ATGAGAAAATTGAGAAAAGAGGG - Intergenic
967774910 3:193376319-193376341 GTGAGGGCACAGAGAAAAGATGG - Intronic
969007171 4:4029661-4029683 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
969746443 4:9076400-9076422 ATGAGGGTCTTTAGCAAAGATGG + Intergenic
969805791 4:9607795-9607817 ATGAGGGTCTTTAGCAAAGATGG + Intergenic
970060018 4:12022401-12022423 ATGAGGGCATGGCAAAAAGTGGG + Intergenic
970104848 4:12569790-12569812 ATGAGGGACAGGGGAAAAGAGGG + Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970631960 4:17956952-17956974 ATGAGAGTATTGGGATAAGATGG + Intronic
970688647 4:18596920-18596942 AGGAGAGGATGGAGGAAAGAAGG + Intergenic
971618152 4:28820342-28820364 AGGAAGGAATGGAGGAAAGAAGG + Intergenic
971773521 4:30930240-30930262 ATAAGGCTATGGAGAACAGTGGG + Intronic
971781748 4:31044007-31044029 ATGAGAGAAAGGAGAGAAGATGG + Intronic
972384595 4:38552829-38552851 ATGAGGGTATTGAGTCAAAATGG + Intergenic
972841515 4:42935437-42935459 ATTAGGGTCTGGACAAATGAGGG + Intronic
972973407 4:44604841-44604863 ATGAGGACACAGAGAAAAGATGG - Intergenic
973178505 4:47239528-47239550 ATGAGGCTATATAGAAATGATGG - Intronic
973178656 4:47241318-47241340 AAGGGGGTAGGGGGAAAAGAAGG - Intronic
974423035 4:61703069-61703091 AGGAGGTTATGGAGAAACAAGGG - Intronic
974602527 4:64103973-64103995 ATGTGCACATGGAGAAAAGACGG - Intergenic
974880430 4:67749984-67750006 ATGAAGGTAAGAAGAAAGGATGG + Intronic
975337956 4:73203268-73203290 ATGAGGGTTTGGAGAAACTGAGG - Intronic
975407510 4:74007904-74007926 ACGAGGATATGGAGAAACCAGGG - Intergenic
975877699 4:78863613-78863635 GTGATGGCAAGGAGAAAAGAAGG + Intronic
976449843 4:85175773-85175795 ATGTGGGTATGGATATAAAAAGG - Intergenic
976954394 4:90877683-90877705 ATTAAGGAATGGAGAATAGAAGG + Intronic
977093169 4:92704805-92704827 AAGAAGGCAGGGAGAAAAGAGGG - Intronic
977284448 4:95085087-95085109 ATGAGTGTATGGGGAAGAAAGGG - Intronic
977531606 4:98207133-98207155 AGGAGGGTTTTGAGAGAAGATGG + Intergenic
977785683 4:101032042-101032064 ATGAGGGAATGGGGGAAAGGTGG + Intronic
977992973 4:103466843-103466865 TTGAGGGAAAGGAGAAAGGAAGG + Intergenic
978340347 4:107715917-107715939 ATGAGGATATTGAGAGATGAAGG + Intronic
978689647 4:111491111-111491133 ATGAAGGAATGAAGAAAATAAGG - Intergenic
978847137 4:113286928-113286950 AGAAAGGCATGGAGAAAAGATGG - Intronic
979036624 4:115727708-115727730 ATGAGAGAGTGCAGAAAAGATGG - Intergenic
979619430 4:122782558-122782580 AACAGGGTATGTATAAAAGAAGG + Intergenic
979769246 4:124502209-124502231 AAGAAGGAATGGAGAAAGGAAGG + Intergenic
979882000 4:125971293-125971315 ATGTGTGTTTGGAAAAAAGATGG - Intergenic
980079497 4:128328960-128328982 ATGAGGATATAGAGAAATTAGGG + Intergenic
980492654 4:133549296-133549318 ATTCAGGTATGGAGAAAACAGGG - Intergenic
981792695 4:148557449-148557471 ATGAGGTTGTGGGAAAAAGAGGG + Intergenic
982457244 4:155625076-155625098 AAAAGGGTATGGCAAAAAGAAGG + Intergenic
982780937 4:159490810-159490832 ATTGGGTTATGGAGAAAAGCTGG + Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
984134235 4:175915740-175915762 CTCAGGGTATGGGGAAAAAAAGG + Intronic
984179564 4:176464958-176464980 AAGAGGGAACAGAGAAAAGAGGG - Intergenic
984184456 4:176526307-176526329 ATGTGGGGAGGGAGAAAACAGGG + Intergenic
984908798 4:184652910-184652932 AGGAGGGAAGGGAGAAAGGAAGG + Intronic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
985181641 4:187271527-187271549 ACGAGGGTAGGGAGAAAATCGGG - Intergenic
986793716 5:11189178-11189200 ATGGAGGAAGGGAGAAAAGAAGG - Intronic
987306355 5:16641303-16641325 GTGAGGGTTTTCAGAAAAGAAGG + Intergenic
988218316 5:28306740-28306762 ATGAGGTTAGAGTGAAAAGATGG + Intergenic
988296244 5:29366255-29366277 GTGAGGATGTGGAGAAAAGGGGG - Intergenic
988923714 5:35967820-35967842 ATGAGGGGATGGAGAAATAGAGG - Intronic
989352415 5:40501359-40501381 AGGAGGGATTGGAGAAAAGTAGG - Intergenic
989502133 5:42179864-42179886 TTGAGGGTAGAGAGGAAAGAGGG + Intergenic
990532121 5:56684516-56684538 ATGAGGGGATGGAGAGAATGTGG - Intergenic
991260970 5:64667657-64667679 ATGAAGGAAGGGAGAAAAGAAGG + Intergenic
992531213 5:77653371-77653393 ATGAGGGGATGGTGCAAAGTGGG + Intergenic
992984063 5:82209462-82209484 ATGAGGACATGGCAAAAAGATGG + Intronic
993342669 5:86743326-86743348 ATGATGCTATGGAGAAACCAAGG - Intergenic
994003601 5:94811172-94811194 AAGATGGAATGGAGTAAAGAAGG - Intronic
994152772 5:96468001-96468023 ATGAGTGGATAGAGAAAAGTTGG + Intergenic
994287784 5:97991310-97991332 AGGAGGGGGTGGAGAAAAGAAGG + Intergenic
994597823 5:101861285-101861307 ATGATTGTTTGGAGGAAAGAAGG - Intergenic
995239140 5:109865944-109865966 ATGAGGTTTTGGAGGAAAGCTGG - Intronic
996431170 5:123379255-123379277 GAAAGGTTATGGAGAAAAGATGG - Intronic
996518361 5:124398878-124398900 ATTAGGTTATGGAAAAAAGTTGG - Intergenic
996686510 5:126287387-126287409 ATGAGGGTTTGGGTAAAAGGAGG + Intergenic
996726400 5:126676413-126676435 TTGAGTGTATGGAGAAAGCAGGG + Intergenic
997020816 5:129999595-129999617 ATGAGACTATAGGGAAAAGAAGG - Intronic
997383048 5:133450998-133451020 ATGATGGGAGGGAGGAAAGAAGG + Intronic
997785475 5:136708138-136708160 AGGAGGGTATGGAGAAATGTCGG + Intergenic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
998757821 5:145400016-145400038 GTGAGGGTGTGGAGATAATATGG - Intergenic
1001066456 5:168538594-168538616 TTGAAGGGATGGTGAAAAGATGG - Intergenic
1001498244 5:172205922-172205944 ATGGGGGCAGGGAGAAAAGATGG + Intergenic
1001701839 5:173712446-173712468 ATGAGGGCAAGGAGAAAAACCGG + Intergenic
1003385752 6:5665945-5665967 ATGAGGGTTTGGAGAGGAGGTGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003841657 6:10126863-10126885 AGCACGGTATGGAGAAAAGTCGG - Intronic
1003994058 6:11520335-11520357 TTGAGGGAATAGATAAAAGAGGG - Intergenic
1004040791 6:11972899-11972921 ATGAGGGCATGGGGAAAGGGAGG - Intergenic
1004122504 6:12838245-12838267 ATGAGGGTATGAAAATCAGAAGG + Intronic
1004171990 6:13302414-13302436 ATGGCGGTGTGGAGAACAGAGGG - Intronic
1004380521 6:15128537-15128559 ATGAGGGGCTGGAGACAGGAAGG - Intergenic
1004407437 6:15347218-15347240 ATGAGGATATGGGGAAAAGAAGG + Intronic
1004738603 6:18433553-18433575 CTGAGTGGAGGGAGAAAAGACGG + Intronic
1005203279 6:23371633-23371655 GTGCGGGTATGGATAAGAGAGGG - Intergenic
1006411146 6:33874193-33874215 ATGAAGGTCTTGAGAAAAGTGGG - Intergenic
1007019735 6:38507487-38507509 TGGATGGTATGGAGAGAAGAGGG - Intronic
1007379077 6:41475190-41475212 ATGGGGTCATGGGGAAAAGAAGG - Intergenic
1007981111 6:46158983-46159005 AGGAGGATGTTGAGAAAAGATGG + Intergenic
1008580644 6:52903626-52903648 ATGAGGGTATCTAGTAGAGAAGG - Intronic
1009428534 6:63541012-63541034 AGGAGGGAATGAAGAAAGGAAGG + Intronic
1009561828 6:65256113-65256135 ATGAGTGGATAGAGAAAAGGTGG + Intronic
1010248677 6:73685695-73685717 TTGAGGGGATGGACAACAGAGGG - Intergenic
1011906720 6:92379360-92379382 AAGAGGCTATTGAGAAGAGATGG - Intergenic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1012473921 6:99601237-99601259 ATGAGGGCAAGGGGAAAAGAGGG - Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1012724528 6:102792630-102792652 AAGAGGTTACAGAGAAAAGAAGG - Intergenic
1013384419 6:109610935-109610957 TGGAGGGGATGGAGAAAAGGTGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013838219 6:114358290-114358312 ATAAGACTATGGAGAAAGGAAGG + Intergenic
1014497005 6:122137719-122137741 AAGAGGGTATGGTGAGAGGATGG - Intergenic
1014554003 6:122823407-122823429 CTGAGGTAATGGAAAAAAGATGG - Intergenic
1014834311 6:126143312-126143334 ATAAGGGTATGGAGAATATTGGG + Intergenic
1014957287 6:127636426-127636448 AAGGTGGTTTGGAGAAAAGAAGG - Intergenic
1015868571 6:137752768-137752790 GTAAGGGTATGAAGAAAAGCAGG + Intergenic
1016800499 6:148164126-148164148 ATCAGGGATTGGAGAAAAGTAGG - Intergenic
1017511968 6:155122419-155122441 AGGAGGGAATGGAGAATGGAAGG + Intronic
1017542188 6:155414129-155414151 AAGAGGCTATGGAGGAAAAATGG + Intronic
1018368325 6:163144955-163144977 CAGAGGGGATGGGGAAAAGAGGG - Intronic
1018440157 6:163805120-163805142 ATGAAGGCAGTGAGAAAAGATGG + Intergenic
1018663640 6:166113474-166113496 CTGAGGCTGTGCAGAAAAGAGGG - Intergenic
1019026839 6:168973012-168973034 GTGTGTGTATGGAGAAAAAAGGG - Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019327600 7:445986-446008 ATGGAGAGATGGAGAAAAGAAGG + Intergenic
1019646554 7:2132769-2132791 ATGGGTGAATGGATAAAAGATGG - Intronic
1020327672 7:6987779-6987801 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1020518447 7:9155601-9155623 AGGAGGATATGAAGAAAAGATGG + Intergenic
1020874731 7:13678285-13678307 ATGAGGGGGTGGAGCCAAGATGG - Intergenic
1020885703 7:13816848-13816870 ATCAGGGGAAGGAGAGAAGAGGG - Intergenic
1021090461 7:16477184-16477206 ATAAAGGAATGGAGAAAACAGGG - Intronic
1021902294 7:25298182-25298204 ACAAGGGTAAGGACAAAAGAAGG + Intergenic
1023206425 7:37755303-37755325 ATGAGGGTGTGGAAAAAAAAGGG - Intronic
1023418666 7:39955158-39955180 GTGAGGGTGTGCTGAAAAGAGGG + Intronic
1023449274 7:40265469-40265491 ATGAGGGAAGGAAGAAAAGAAGG - Intronic
1023863290 7:44227632-44227654 AGGAGGGTCTGGAGGACAGAGGG + Intronic
1026154775 7:67817444-67817466 ATGAGGATACAGAGAGAAGATGG - Intergenic
1026306908 7:69150364-69150386 AGGAGGGAAGGGAGAAAAGGTGG - Intergenic
1027487315 7:78778294-78778316 ATTAAAGTGTGGAGAAAAGAAGG - Intronic
1027662953 7:81009291-81009313 ATGAGGGTATTGACAAAAAATGG + Intergenic
1028199278 7:87941768-87941790 ATGAGGTTATGGTGCACAGAAGG + Intronic
1028211219 7:88077355-88077377 ATGAGGGTCGGGAGCCAAGATGG + Intronic
1028960768 7:96747770-96747792 AGGAAGGAAGGGAGAAAAGAAGG - Intergenic
1029361351 7:100090532-100090554 ATGAGGGGAAGGAGAAAGGTAGG + Intronic
1030264753 7:107608113-107608135 ATTACGGTATGGAAAAAGGAGGG - Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030477402 7:110053723-110053745 ATGAGTGGATAGAGAAAATATGG - Intergenic
1030916730 7:115323901-115323923 ATGATGGAAAGAAGAAAAGAGGG + Intergenic
1031208026 7:118787338-118787360 ATGAGGTTAAAGAGAAAAGTAGG + Intergenic
1031285564 7:119862736-119862758 ATGAGTGTATGGAAAATACAGGG - Intergenic
1031500440 7:122507870-122507892 ATGAGGGTAAGGAAAAAAGAGGG + Intronic
1031623174 7:123960666-123960688 AGGGGGGTATGGGGAAAGGAAGG - Intronic
1031633697 7:124075987-124076009 ATGAGGTTTGGGAGAACAGAGGG - Intergenic
1031819187 7:126477695-126477717 ATGAAGGGAGGGAGAAAGGAAGG + Intronic
1031920364 7:127595771-127595793 ATGAGGGTTGGGAGAACAGCCGG - Exonic
1032633462 7:133679873-133679895 ATGAGAGTAAGTGGAAAAGAAGG + Intronic
1032650094 7:133868777-133868799 ACAAGGGTAAGGAGAACAGAAGG - Intronic
1032663464 7:134011630-134011652 ATGAAGGAATGAAGAAATGAAGG - Intronic
1033519347 7:142145348-142145370 GGGAGGGTAAGGAGGAAAGAAGG - Intronic
1033866102 7:145692147-145692169 AAGAGGGAAAGGAAAAAAGAAGG - Intergenic
1034426259 7:151015843-151015865 GTGAGGGGAGGGAGAAAGGACGG - Intronic
1034740391 7:153468081-153468103 TTGAGGGGATGGAGAAAAGGTGG - Intergenic
1034861818 7:154602259-154602281 AGGATGGTATGGTGAAATGATGG - Intronic
1035898721 8:3434661-3434683 AGGGGGATATGGAGAAAAGGTGG - Intronic
1036088476 8:5638781-5638803 ATGAGGGTAAAGAGGAAATAAGG + Intergenic
1036130647 8:6106476-6106498 ATGAGGGGATGGAAGAAAGAAGG - Intergenic
1036368942 8:8146318-8146340 ATGAGGGTCTTTAGCAAAGATGG + Intergenic
1036595518 8:10208560-10208582 AGGAAAGAATGGAGAAAAGAAGG - Intronic
1036881950 8:12519324-12519346 ATGAGGGTCTTTAGCAAAGATGG - Intergenic
1037249012 8:16871112-16871134 ATGAGGCTAGGGAGAGAGGAAGG + Intergenic
1038401229 8:27286437-27286459 ATCAGCGTCTGCAGAAAAGAAGG - Exonic
1038449356 8:27629715-27629737 GTGAGGCCATGTAGAAAAGAAGG - Intergenic
1038545427 8:28422601-28422623 AGGAGGGTAAAGAGAAAACAAGG - Intronic
1039035886 8:33358889-33358911 ATGAGGTTATAGCAAAAAGAGGG + Intergenic
1039306067 8:36264396-36264418 ATGAGGATATGGAGATGACAGGG - Intergenic
1039809017 8:41028034-41028056 ATGAGAGAATGGAGTAATGAAGG - Intergenic
1039935180 8:42036803-42036825 GTGAGGGTAAGGAGAAAGAAAGG + Intronic
1040445972 8:47494003-47494025 GTGAGGGGAAGGAGAAAAGAAGG - Intronic
1041966976 8:63689435-63689457 GAGGGGGTATGGAGAAAGGAAGG - Intergenic
1041998882 8:64097676-64097698 ATGGGAATATGGAGAAGAGAGGG + Intergenic
1041998890 8:64097727-64097749 ATGGGAATATGGAGAAGAGAGGG + Intergenic
1042356725 8:67836538-67836560 ATGGAGGTAGGGAGGAAAGAAGG - Intergenic
1043319698 8:78968691-78968713 AGGAGGGAAGGGAGAAAAGCGGG + Intergenic
1043519860 8:81033414-81033436 ATCAGGGTATAGAGATAATAAGG + Intronic
1044526397 8:93256542-93256564 AGGAGGATATGAAGAGAAGATGG + Intergenic
1044559831 8:93602019-93602041 AGTAGGGTATGGGGAAAGGAAGG - Intergenic
1044581697 8:93832083-93832105 ATGAGGGTAGAGAGGAAAGTTGG - Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1045203728 8:100014803-100014825 ATGAGGGTAGAGAGCATAGAAGG - Intronic
1046145942 8:110158606-110158628 AGGAGGGGAGGGAAAAAAGAAGG - Intergenic
1046928831 8:119823183-119823205 TTGAAGGTATGGGAAAAAGATGG - Intronic
1047550219 8:125863353-125863375 ATGAGGGCAAGGAGAAGTGAAGG + Intergenic
1047622534 8:126622574-126622596 ATTAGGGAAGGGAGAAAATAAGG - Intergenic
1048065115 8:130959861-130959883 GTGAGGGTATGGAGACATGCTGG + Intronic
1048100139 8:131342194-131342216 AAGAGGGTAGGGAGAGTAGAGGG - Intergenic
1048376828 8:133830141-133830163 ATAAGGGAAAGAAGAAAAGAAGG + Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1049474752 8:142791648-142791670 ATGAGTGGATGGAGAATGGATGG - Intergenic
1049474809 8:142791949-142791971 ATGAGTGGATGGAGAATGGATGG - Intergenic
1049501523 8:142970269-142970291 AGGAAGGGATGGAGAAAAGAGGG + Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050436654 9:5617955-5617977 ATTAGGGTCTGGGGAAAAGGAGG + Intergenic
1051394719 9:16607337-16607359 ATTAGGGAATGTAGAAAAAAAGG + Intronic
1052274388 9:26661068-26661090 ATGAAGGGATGGAGGAAAGGAGG + Intergenic
1052291993 9:26852473-26852495 AAAAGGGTATTGAGAGAAGAGGG + Intronic
1052293791 9:26874605-26874627 ATGAAGGTATTTAGAAATGATGG + Intronic
1053442636 9:38128607-38128629 ATGGGGGTATGTTGAAAAGAAGG + Intergenic
1054943832 9:70773107-70773129 ATGAGAGAAGGGAGAGAAGATGG + Intronic
1055280731 9:74671165-74671187 AGGAGGGAAGGAAGAAAAGAAGG + Intronic
1056048907 9:82747399-82747421 ATGAAGGGAGAGAGAAAAGAAGG + Intergenic
1056869724 9:90266290-90266312 ATGAGGGAAGGAAGGAAAGAAGG - Intergenic
1058357727 9:104104039-104104061 ATAAGGGGATACAGAAAAGAAGG - Intronic
1059512422 9:114861903-114861925 CTGGGGGTATGGAGAACATAGGG - Intergenic
1059698061 9:116747650-116747672 ATGAGGGTGGGCAGTAAAGAGGG - Intronic
1060041684 9:120306058-120306080 ATGAGGGTGTAGAGAAGAAAAGG + Intergenic
1060204355 9:121673935-121673957 TTCAGGGTCTGGAGAAAAGCAGG + Intronic
1060874161 9:127068160-127068182 ATGACTGCATGTAGAAAAGAAGG + Intronic
1185708457 X:2282611-2282633 AAGAGGGGAGGGAGAGAAGAAGG + Intronic
1185986955 X:4845423-4845445 GTGAGGGCACAGAGAAAAGACGG + Intergenic
1186053629 X:5626580-5626602 AGGAGGGAAGGGAGAAAGGATGG + Intergenic
1186695214 X:12023153-12023175 ATGAGGTTACAGTGAAAAGATGG + Intergenic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1188845503 X:35066999-35067021 ATGAGGACGTGGAGAAAAGAGGG - Intergenic
1189373495 X:40448347-40448369 AAGGTGGTATGGAGGAAAGATGG - Intergenic
1189986946 X:46562001-46562023 AAGAGGGGATGTGGAAAAGATGG - Intergenic
1190832484 X:54071615-54071637 ATGAAGGTTTGGAGAGAAAAGGG - Exonic
1191673200 X:63768355-63768377 ATGAGTGGATGAAGAAAATATGG - Intronic
1191813540 X:65217847-65217869 AAGAGGATATGGAGAATGGATGG + Intergenic
1191937728 X:66443037-66443059 AGGAGGGAATGGGGAGAAGAGGG - Intergenic
1192017078 X:67342748-67342770 ATTAGGGGAAGGAGAAAAGGGGG - Intergenic
1192187392 X:68959252-68959274 CTGAGGGTTTGGAGAAAAAGAGG + Intergenic
1192629398 X:72764259-72764281 ATGAACGTATGGAGAAAATGTGG + Intergenic
1192652312 X:72956555-72956577 ATGAACGTATGGAGAAAATGTGG - Intergenic
1192912125 X:75616396-75616418 ATGAGGGGGTGGAGCCAAGATGG + Intergenic
1192963883 X:76157284-76157306 ATGAAGGGAAGGAGAAAACAGGG + Intergenic
1193061959 X:77216201-77216223 GTGAGGATATAGAGAAAAGGTGG - Intergenic
1193273600 X:79557796-79557818 ATGAAGGTAGGGAGGAAAGAAGG + Intergenic
1193618101 X:83715006-83715028 ATTAGAGTATTGAGAAAAGAAGG - Intergenic
1193933990 X:87592491-87592513 GTGAGGATGTGGAGAAAAGGGGG - Intronic
1195119550 X:101736551-101736573 ATGAGGGTTAGGAGAAGAGGTGG + Intergenic
1195198809 X:102526130-102526152 GTGAGGGGATGGAAAAAATAGGG - Intergenic
1195574329 X:106432901-106432923 ATGAGGGTATGAATCAGAGAGGG + Intergenic
1195617363 X:106922869-106922891 ATGAGGCTGTGAAGAAAAGCCGG + Intronic
1195625384 X:107000766-107000788 ATGAAGGAATGAAGAAAACAAGG + Intergenic
1196045249 X:111249873-111249895 AGGAAGGTAGGAAGAAAAGAAGG + Intronic
1196208399 X:112967423-112967445 ATGAGGGGCAGGAGACAAGAGGG + Intergenic
1196767691 X:119263438-119263460 ATGAGGGTAGGGAGGAAATGTGG - Intergenic
1196976904 X:121168246-121168268 AAGGGGCTGTGGAGAAAAGAGGG + Intergenic
1197334526 X:125195988-125196010 AGGAGGGAAGGAAGAAAAGAAGG + Intergenic
1198097503 X:133394481-133394503 ATCAGGGCAAGGAGAAAAGAGGG + Intronic
1198730472 X:139722512-139722534 ATTTGGGAATGGAGAAAGGAAGG + Intergenic
1199280865 X:145997637-145997659 AGGAATATATGGAGAAAAGAAGG - Intergenic
1199770092 X:150969646-150969668 ATGAGGGAAAGGAGAGAAGGCGG + Intergenic
1201363116 Y:13175009-13175031 ATGAGGGAATGGAGAAGGGTAGG + Intergenic