ID: 1179231061

View in Genome Browser
Species Human (GRCh38)
Location 21:39504247-39504269
Sequence CAAGGGGCAAACATTGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179231057_1179231061 2 Left 1179231057 21:39504222-39504244 CCAATAGCAGTCTTGAGAAAAGT 0: 1
1: 0
2: 0
3: 13
4: 181
Right 1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG 0: 1
1: 0
2: 2
3: 8
4: 145
1179231053_1179231061 19 Left 1179231053 21:39504205-39504227 CCCCTCTCTGGCTTCCTCCAATA 0: 1
1: 0
2: 6
3: 46
4: 463
Right 1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG 0: 1
1: 0
2: 2
3: 8
4: 145
1179231055_1179231061 17 Left 1179231055 21:39504207-39504229 CCTCTCTGGCTTCCTCCAATAGC 0: 1
1: 0
2: 5
3: 15
4: 225
Right 1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG 0: 1
1: 0
2: 2
3: 8
4: 145
1179231052_1179231061 22 Left 1179231052 21:39504202-39504224 CCACCCCTCTCTGGCTTCCTCCA 0: 1
1: 0
2: 11
3: 128
4: 1292
Right 1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG 0: 1
1: 0
2: 2
3: 8
4: 145
1179231056_1179231061 5 Left 1179231056 21:39504219-39504241 CCTCCAATAGCAGTCTTGAGAAA 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG 0: 1
1: 0
2: 2
3: 8
4: 145
1179231054_1179231061 18 Left 1179231054 21:39504206-39504228 CCCTCTCTGGCTTCCTCCAATAG 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG 0: 1
1: 0
2: 2
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179231061 Original CRISPR CAAGGGGCAAACATTGATGT AGG Intronic
905245023 1:36606753-36606775 CAAGGGCCAGACATGAATGTTGG + Intergenic
907171297 1:52467813-52467835 CAAGGAGAAAACATTGTTGATGG - Intronic
907325445 1:53635127-53635149 AGAGGGGCAAAAATTGATGCAGG + Intronic
912722494 1:112031929-112031951 CAAAAGGCAAAAATTGATGCTGG + Intergenic
916335707 1:163668969-163668991 CAGGGAGCAAACATTGAGGTGGG + Intergenic
918355350 1:183702679-183702701 CATGGGGCACATACTGATGTGGG + Intronic
918722144 1:187866605-187866627 CAAGGGGCAAAGATTGGTGTTGG - Intergenic
918787048 1:188776084-188776106 AAAGGGGCCAACATTGAGCTTGG + Intergenic
920438780 1:205964898-205964920 CAATGGGCAAACCATGGTGTGGG + Intergenic
924920589 1:248625266-248625288 CAAAGGGCAAACATGGATACAGG - Intergenic
1063504765 10:6586651-6586673 CAAGAGGCAAACCTTGAGATGGG + Intergenic
1068007128 10:51404881-51404903 CAAGGGGCCATCCTTAATGTTGG + Intronic
1069846546 10:71376019-71376041 GAAGGGGCAAAAATAGAGGTGGG + Intergenic
1074330328 10:112500687-112500709 CAAGAGTCCAACATTGATCTAGG - Intronic
1075034859 10:119056078-119056100 CAGGAGGCAAACATCGGTGTAGG - Intronic
1075086705 10:119418639-119418661 CAAGGGGCAGGCATTCATGGCGG + Intronic
1076454446 10:130580071-130580093 CCTGGGGCAAACCTGGATGTCGG - Intergenic
1084177706 11:67432054-67432076 CTAGGGGCAAGGCTTGATGTGGG - Intronic
1085496848 11:76978123-76978145 CATGGGCCATACATTGATGGTGG + Intronic
1085560594 11:77469728-77469750 GAAGGAGCAAACACTGGTGTGGG + Intronic
1087588873 11:100158713-100158735 CAAGGGGCAACCATACATGCTGG + Intronic
1089343362 11:117774625-117774647 GAAGGGGAACAAATTGATGTGGG - Intronic
1090469230 11:126964773-126964795 CAAGAGGTAAATATTGATGGAGG + Intronic
1092258953 12:6942189-6942211 CAAGGGGCATACATTGCAGAGGG - Exonic
1096129432 12:49145975-49145997 AAAGGAGCAGACAGTGATGTTGG + Intergenic
1096561718 12:52440293-52440315 CACGGGGCAAACACTGTTCTGGG - Intergenic
1098574489 12:72025614-72025636 AGAGGGGCAACCATTGCTGTGGG - Intronic
1100191747 12:92200364-92200386 CAAGGGGCAAACATTTCTCTGGG + Intergenic
1101649198 12:106659570-106659592 TAAAGAGCAAACATTTATGTAGG + Intronic
1102376174 12:112423000-112423022 AAAGAGGCAAAAAGTGATGTTGG + Intronic
1102411988 12:112728063-112728085 CAAGGGGGAAAGCTTGATGTGGG + Intronic
1107772102 13:43798723-43798745 GATGGGGGAAACATTGATATAGG - Intergenic
1108131121 13:47301486-47301508 CATGTGGCAAGCAATGATGTAGG - Intergenic
1112077037 13:95926323-95926345 TAAGGGGCAAACTTTTATATAGG - Intronic
1112485294 13:99814391-99814413 AAAGGGGCAAACAATGCTTTTGG - Intronic
1112520577 13:100091185-100091207 CAGTGGGAAGACATTGATGTTGG + Intronic
1113188423 13:107716470-107716492 CCAGGGGCACAGCTTGATGTGGG + Intronic
1113316513 13:109185786-109185808 AAAGGTGCAAACATGGATGAAGG - Intronic
1114842752 14:26284589-26284611 CAAGGGATCAACATTGATCTAGG + Intergenic
1116082160 14:40187905-40187927 CAAGGTGTAAAAATAGATGTAGG - Intergenic
1116855848 14:49951664-49951686 CAAGGAGCAATCACAGATGTGGG + Intergenic
1116864204 14:50018142-50018164 AAAGGGGCCAGCTTTGATGTGGG + Intergenic
1119037704 14:71244726-71244748 CAAGGGGATAACATGGAGGTAGG + Intergenic
1121284722 14:92726379-92726401 CAAGGGGCAAAAATCGAGGCTGG - Intronic
1121346919 14:93143100-93143122 CACAGGGCAAACATTAATTTGGG - Intergenic
1121435604 14:93917207-93917229 CAAGGGGCCAACGTTGGTCTAGG + Intergenic
1121745033 14:96281791-96281813 CAAGGGCCAACAATTGTTGTAGG + Exonic
1121933480 14:97994948-97994970 CAAGAGGCAGACCTTGAGGTGGG + Intergenic
1124115019 15:26832619-26832641 CAAAGGGCAAAAATTGCTGAAGG + Intronic
1128573756 15:68755261-68755283 AGAGGGGCAAACATGGATCTTGG - Intergenic
1128577174 15:68784059-68784081 AAAGGGACAAAAATTGAAGTGGG + Intronic
1133374904 16:5276784-5276806 CAAAAAGCAAAAATTGATGTTGG + Intergenic
1133819286 16:9222259-9222281 TAAGGAGCAGACATTGATGGTGG - Intergenic
1133819373 16:9222960-9222982 TAAGGAGCAGACATTGATGGTGG + Intergenic
1140878148 16:79172500-79172522 GGAGGAGCAAACATTTATGTAGG - Intronic
1141457935 16:84156772-84156794 AAAGGGTCAAACATTGATCCTGG - Intronic
1143588045 17:7861309-7861331 AAAGGTGGAAACATTGCTGTTGG + Exonic
1144334508 17:14256721-14256743 CAAGGAGCAAACCATGAAGTAGG - Intergenic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1149510664 17:57238469-57238491 CAAGGTGGACTCATTGATGTAGG - Intergenic
1150989845 17:70244463-70244485 CAAGAGGCAAACATAAATGAGGG + Intergenic
1152095872 17:78271388-78271410 CAAGAGGCAAACAGTCATGAAGG + Intergenic
1161977315 19:7613605-7613627 CAAGGGGGATAGATAGATGTGGG + Intronic
925831393 2:7899503-7899525 CCTGGGGCAGACAATGATGTGGG - Intergenic
927741216 2:25571424-25571446 CAAGGTGAAAACATTAATGTGGG - Intronic
931590153 2:63874172-63874194 AAAGGGGAAAAAAATGATGTTGG + Intronic
935213391 2:100957047-100957069 AAATGTGCAAACATTGAAGTAGG - Intronic
939722185 2:145667670-145667692 CAAGGATCAGACAATGATGTGGG - Intergenic
939752443 2:146064167-146064189 AAAGGGGCAAACATAGAGCTTGG - Intergenic
941269905 2:163412481-163412503 TAGGGGTCAAACATTGGTGTGGG + Intergenic
942183452 2:173402426-173402448 GAATGGCCAAACACTGATGTCGG + Intergenic
942418027 2:175779082-175779104 CAAGGGGCAAAAGTAGAAGTAGG + Intergenic
944879029 2:203992509-203992531 CAAGTGTCAAACATAGATGGTGG + Intergenic
946959459 2:224968449-224968471 CAAAGGGCAGTCATTGAAGTGGG - Intronic
947224352 2:227825862-227825884 AATGGGGCTAAGATTGATGTGGG - Intergenic
947239815 2:227982289-227982311 CAAGTGGTAAACTTTGATGCAGG + Intronic
1169263432 20:4153694-4153716 CACAGGGAAAACATTGCTGTTGG + Intronic
1169972567 20:11284521-11284543 GAAGGGGAAAACTTTTATGTAGG - Intergenic
1170045096 20:12076652-12076674 CCAGGGACAAGCATAGATGTAGG + Intergenic
1172857596 20:38018003-38018025 AAAGGGGCAAACCTTGATGGTGG + Intronic
1179032010 21:37729191-37729213 CAAGGTCAAAACACTGATGTTGG + Intronic
1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG + Intronic
1180371754 22:12044686-12044708 CAATGAGAAAACATGGATGTAGG + Intergenic
1181027555 22:20134579-20134601 CGAGGAGCAAACAGTGAAGTCGG - Intronic
1182376378 22:29851479-29851501 CAAGAGGCTAAAAGTGATGTGGG + Intergenic
1183813656 22:40279941-40279963 CATGGGGGAAACATTGATTCTGG + Intronic
949742046 3:7246867-7246889 AAAAGGACAAACATTGTTGTAGG + Intronic
952862585 3:37826267-37826289 CAAGAGGCAAACCTTTATTTGGG + Intergenic
955231961 3:57107454-57107476 GCAGAGGGAAACATTGATGTAGG + Intronic
956542825 3:70362006-70362028 CAAGGTGTAAACATTCATCTCGG - Intergenic
959183623 3:103014030-103014052 CAAAGGGTAAATATAGATGTTGG + Intergenic
960019180 3:112930673-112930695 AGAGGGGCAAACCTTTATGTGGG + Intronic
965219463 3:165908676-165908698 TAATGGGCAAACATTTAAGTTGG + Intergenic
970595509 4:17596669-17596691 CAAGGACCACACATTGCTGTTGG + Intronic
971807339 4:31376242-31376264 CAAGGGATAAACAATGATGAGGG + Intergenic
972749350 4:41973135-41973157 AAAGGGGCCAACATAGATCTTGG + Intergenic
973740227 4:53912436-53912458 CAAGGGGGAGACATTCATTTTGG - Intronic
973744073 4:53946321-53946343 CAAGCAGCAGACATTGATGCTGG - Intronic
973839993 4:54851631-54851653 CAATGGGGAAACAATGATGTTGG + Intergenic
974359392 4:60856739-60856761 CAAGAGGCAAACAATGTTTTAGG - Intergenic
975182889 4:71367436-71367458 CAACTGGCAAACATTTATCTAGG - Intronic
976167226 4:82268840-82268862 CAAGTGGGAAACATTGCTGAAGG - Intergenic
976330988 4:83830956-83830978 CAAGGGGCAAATATGGGGGTTGG - Intergenic
977359768 4:95987141-95987163 CAAGGGGTAAATATGCATGTGGG + Intergenic
983552607 4:169032788-169032810 CAAGAGGCAAGCACTGATGGGGG + Intergenic
983937780 4:173515015-173515037 CAAAGGGCACTCATTTATGTTGG + Intergenic
984455369 4:179959848-179959870 AAAGGGGCGAACATTGAACTGGG + Intergenic
986437642 5:7749875-7749897 CAAGGGAAAAACACTGCTGTGGG - Intronic
988592480 5:32561139-32561161 CAAGGGAGAAACTTTGAAGTGGG + Intronic
989365690 5:40652904-40652926 CGAGGCGCAAAAATAGATGTGGG - Intergenic
990075112 5:51835620-51835642 AAAGGGGTAAACAATGTTGTAGG - Intergenic
991086782 5:62654927-62654949 CAAGGGGAAGACATTGTTCTTGG + Intergenic
995109571 5:108413817-108413839 CAAGGAGCAAACAAAGATATAGG + Intergenic
995856024 5:116593146-116593168 CAAGGGGCCAATATTGACTTGGG - Intergenic
996901106 5:128542463-128542485 TAAGGGGCAAGCATTGCTTTTGG - Intronic
1001648938 5:173301809-173301831 CAAGGGGGAAACACAGCTGTTGG + Intergenic
1004275435 6:14231557-14231579 CAAGAGGCAAGAACTGATGTGGG - Intergenic
1008316587 6:50049761-50049783 CAAGGGGCCAGCATTAAAGTCGG - Intergenic
1009868430 6:69427066-69427088 CCAGAGGCAAACATTGAGGGTGG + Intergenic
1009939454 6:70272900-70272922 CAAGGGGAAAAAATTGAACTTGG - Intronic
1010832300 6:80545538-80545560 CAAGGGGAAAATATAAATGTAGG + Intergenic
1011696830 6:89920654-89920676 CAAGGGGCAGCCATGGGTGTAGG - Intergenic
1012835124 6:104254898-104254920 AAAGGGGCAAACAGTGATCCTGG + Intergenic
1014073098 6:117205565-117205587 GAAAGGGGAAACATTGAAGTAGG + Intergenic
1014959537 6:127666036-127666058 CATGGAGCAAACATTGATGCTGG + Intergenic
1021333126 7:19364105-19364127 CAAAGGGAAAAAATAGATGTGGG - Intergenic
1023646480 7:42322151-42322173 AAAGGGGAAAACATTGGTTTAGG - Intergenic
1028933405 7:96439638-96439660 CAAGGGTCAGAGAATGATGTTGG + Intergenic
1030899625 7:115106379-115106401 CAAGGGGCCACCAGTGATGCTGG - Intergenic
1031011348 7:116527316-116527338 CAAGAGGCATACATTGTTTTTGG - Intronic
1031125372 7:117767954-117767976 CAAGTGGTAAACATTGATACAGG - Intronic
1032172921 7:129600666-129600688 CAAGGGGAAGAAATTGATGGAGG - Intergenic
1036023938 8:4881886-4881908 CAGGGGAAAAACATTGATGCTGG + Intronic
1037530970 8:19773107-19773129 CCAGGGGCAAACATTGCTGTGGG + Intergenic
1041777773 8:61542497-61542519 GAAGGGGAAAAGATTTATGTTGG - Intronic
1041934690 8:63322310-63322332 CAAGAGGAAAACACTGGTGTAGG + Intergenic
1043051257 8:75388571-75388593 CAGGGGGCAAAAATCTATGTGGG - Intergenic
1043591264 8:81835925-81835947 CAAGGGGCAATCATTGGGGCAGG - Intronic
1043988633 8:86724505-86724527 CATGTGCCAGACATTGATGTAGG + Intronic
1046967255 8:120181475-120181497 GAATGGGCAAAAATTGATTTTGG + Intronic
1048180948 8:132193652-132193674 CACGGTGAAAACATTGATGCAGG + Intronic
1048769709 8:137882600-137882622 CAAGGGGCCAACATAGAGCTTGG + Intergenic
1048888498 8:138928101-138928123 CAAGGTGAGAAAATTGATGTGGG + Intergenic
1049914021 9:298915-298937 CAAAGGGCAAATACTAATGTGGG + Intronic
1053259235 9:36647343-36647365 CATGGGGCTATCATAGATGTGGG + Intronic
1056209260 9:84349749-84349771 CAAAGAACAAACATTGATATGGG + Intergenic
1056385333 9:86092078-86092100 CAAGGGTCAGACATGGTTGTGGG - Intronic
1186776389 X:12868893-12868915 CAAGGGGCAAAGACAGATGTGGG - Intronic
1187578751 X:20586150-20586172 AAAGGGGCAGAAATAGATGTAGG + Intergenic
1188947922 X:36330903-36330925 AAAGAGGGAAACATTGATATAGG - Intronic
1192298033 X:69870435-69870457 CTAGAGGCAAACAGAGATGTTGG + Intronic
1195094109 X:101489589-101489611 CCTGGGGCAAAGATTGATGCCGG + Exonic
1195417927 X:104641101-104641123 CAAGAGGTGTACATTGATGTTGG + Intronic
1195895155 X:109738846-109738868 CAAAGGGCAAAAATTTAGGTAGG - Intergenic
1195962506 X:110400779-110400801 CAAGGGGCTCACATTCAAGTGGG - Intronic