ID: 1179236696

View in Genome Browser
Species Human (GRCh38)
Location 21:39553822-39553844
Sequence CTGTTTAAGTGGGAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179236688_1179236696 20 Left 1179236688 21:39553779-39553801 CCAACTCAAGCTACAGTTTAGTT No data
Right 1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG No data
1179236690_1179236696 -9 Left 1179236690 21:39553808-39553830 CCTACATAATATTCCTGTTTAAG No data
Right 1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179236696 Original CRISPR CTGTTTAAGTGGGAGGTGGT TGG Intergenic
No off target data available for this crispr