ID: 1179237021

View in Genome Browser
Species Human (GRCh38)
Location 21:39556601-39556623
Sequence ATGAAGCAACGGTATGGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179237021 Original CRISPR ATGAAGCAACGGTATGGTTT AGG (reversed) Intronic
909163131 1:72180518-72180540 ATGAAACAGAGGTATGGATTGGG + Intronic
910101139 1:83578711-83578733 ATGATGCAACTGTAAGTTTTTGG + Intergenic
913340858 1:117756984-117757006 ATGAAGAAGAGGGATGGTTTGGG + Intergenic
1067098588 10:43318506-43318528 ATGAAGCACCAAGATGGTTTGGG - Intergenic
1068849297 10:61718231-61718253 ATGAAGCAAAGGTCAGATTTTGG + Intronic
1070048669 10:72865222-72865244 ATAAAGCAACGGGTTGTTTTAGG - Intronic
1083366745 11:62145850-62145872 ATGAAGCAACAAGATGGTCTGGG - Intronic
1085613973 11:77980339-77980361 CTGAAGCAATGCTATTGTTTTGG + Intronic
1086187468 11:84035792-84035814 AGCAAGAAACGATATGGTTTAGG + Intronic
1089490516 11:118880542-118880564 ATGAAGCAGGGTTCTGGTTTTGG + Intergenic
1091518862 12:1215235-1215257 AAAAAGCAACAGTATGGATTAGG - Intronic
1093097689 12:14990532-14990554 ATGACGAAACAGTATGGTATTGG + Intergenic
1095563672 12:43595181-43595203 AAGAAGCAAGGATTTGGTTTGGG + Intergenic
1096584306 12:52609632-52609654 ATGAACGAACTGTATGATTTTGG + Intronic
1096763242 12:53861306-53861328 ATGAAGTAACAGTTTGGCTTGGG + Intergenic
1098092558 12:66919635-66919657 ATGAAGCAAGAATTTGGTTTGGG + Intergenic
1099057489 12:77862823-77862845 ATGAAGCAACTGTTTATTTTAGG + Intronic
1100204245 12:92330999-92331021 AGGAAGCAAGGGTCTCGTTTGGG - Intergenic
1100906149 12:99301835-99301857 ATAAAGCAACGGTAAGGCATTGG + Intronic
1109317426 13:60766781-60766803 ATGAAGAAGAGGGATGGTTTTGG + Intergenic
1113556457 13:111239517-111239539 ACGAAGCAACGCCAGGGTTTAGG - Intronic
1118776605 14:68977959-68977981 AGGAAGCAGCGGTAGGGTTGAGG + Intronic
1128629132 15:69245657-69245679 ATAAAGCAACAGCAGGGTTTGGG - Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG + Intergenic
1151898841 17:76998327-76998349 ATGAAGCAAAGGTACAGTTAGGG - Intergenic
1153619424 18:6963102-6963124 ATTAAGCAACTATATGATTTTGG + Intronic
1154035465 18:10797591-10797613 ATGCAGCACATGTATGGTTTTGG + Intronic
1156102506 18:33614194-33614216 AAAAAGCAACAGCATGGTTTGGG - Intronic
1159927686 18:74283359-74283381 CTGAATCATCGGTGTGGTTTTGG - Intronic
927374469 2:22397438-22397460 ATGAAACAAAGGAATGCTTTGGG - Intergenic
928985043 2:37172806-37172828 AACAAGCAAATGTATGGTTTAGG - Intronic
931554646 2:63489032-63489054 ATGAAGCAACAGCCTGGTGTAGG + Intronic
936626489 2:114154656-114154678 GTGGAGCAAAGGAATGGTTTTGG + Intergenic
940914848 2:159242735-159242757 ATGTAGCAATGATACGGTTTAGG - Intronic
941109365 2:161401730-161401752 ATGAAGCAACTATGTTGTTTAGG + Intronic
944894808 2:204152905-204152927 ATGAAACAACGGTCAGGATTTGG + Intergenic
948120947 2:235529973-235529995 CTGAAGCTTCTGTATGGTTTTGG + Intronic
1170768931 20:19315382-19315404 AAGAAGCAAGTGTATGGTTGAGG + Intronic
1174311304 20:49657160-49657182 CTGAAGCCACGGTCTGGTCTTGG + Intronic
1174998013 20:55593112-55593134 AAGATGCAACGGTATGATTGTGG - Intergenic
1179237021 21:39556601-39556623 ATGAAGCAACGGTATGGTTTAGG - Intronic
1180913781 22:19471369-19471391 ATGGAGCAACAGTATTTTTTAGG - Intronic
949568807 3:5271393-5271415 ATGAAGAGACAGTATTGTTTTGG + Intergenic
954510787 3:51123117-51123139 ATGAAGCTACGGACTGGTTATGG - Intronic
959120339 3:102224612-102224634 ATGAAGCAACCCTATGCATTTGG + Intronic
962776343 3:138664092-138664114 AGGAAACAGAGGTATGGTTTGGG - Intronic
964440063 3:156699218-156699240 ATAAAGCAACAGCAAGGTTTGGG + Intronic
967663182 3:192138206-192138228 ATGAAGCGCCAGTTTGGTTTGGG + Intergenic
969892873 4:10275963-10275985 ATGAAGCACTGGTATGGGTGTGG - Intergenic
970220820 4:13808876-13808898 ATGAAGAAAAGCTATGGGTTTGG + Intergenic
970388343 4:15579869-15579891 ATGCAGGAAATGTATGGTTTGGG - Intronic
977596940 4:98893440-98893462 ATAAAGCAACTGCAGGGTTTGGG - Intronic
977981146 4:103323680-103323702 ATAAAGCAATGGCAGGGTTTGGG - Intergenic
979907676 4:126316853-126316875 ATCCATCAAAGGTATGGTTTAGG - Intergenic
984599336 4:181708486-181708508 ATGAAGAAAAGGTTTGGGTTTGG + Intergenic
987133446 5:14880289-14880311 ATGAGGAAACGGGATAGTTTGGG + Intergenic
990833135 5:59983155-59983177 ATGAAGCAACAGCATGCTTATGG - Intronic
994257003 5:97609281-97609303 ATGATGCTACAGTATGTTTTTGG + Intergenic
1004221740 6:13753226-13753248 ATGAAGCAATGGGAAGTTTTAGG + Intergenic
1005605341 6:27472168-27472190 AGGAAGGAACGGTATGCTTAGGG - Intronic
1011609324 6:89134840-89134862 ATTAGGCAAAGGGATGGTTTCGG + Intergenic
1013341526 6:109220485-109220507 ATGGAGAAACGGTAAGGTCTAGG + Intergenic
1013567262 6:111379592-111379614 CTGAAGACAGGGTATGGTTTTGG - Intronic
1021682053 7:23143281-23143303 ATGAAGCAACAGTATTATTTTGG + Intronic
1027006181 7:74695272-74695294 ATAAAGCAATGGCAGGGTTTTGG + Intronic
1037111458 8:15168466-15168488 ATGAAGCAAGGGTTGGGTTGTGG - Intronic
1044742008 8:95337180-95337202 GTGAACCAAAGGGATGGTTTAGG + Intergenic
1045580840 8:103478159-103478181 CTGAAGCAAGTGTATGTTTTAGG + Intergenic
1057114215 9:92504962-92504984 ATGAAGCAAGGCTGGGGTTTGGG + Intronic
1062681737 9:137785685-137785707 ATGATGCAACCATATGTTTTTGG - Intronic
1188302450 X:28521772-28521794 AAGAAGCCTCTGTATGGTTTTGG - Intergenic
1192681069 X:73254543-73254565 ATGAAACAACGGGATGGGTAAGG + Intergenic
1200622708 Y:5472857-5472879 CTGAAGCAAAAGTAGGGTTTAGG - Intronic