ID: 1179238311

View in Genome Browser
Species Human (GRCh38)
Location 21:39566557-39566579
Sequence AGGGACAAGAAGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1191
Summary {0: 1, 1: 1, 2: 7, 3: 117, 4: 1065}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179238311 Original CRISPR AGGGACAAGAAGAAGCAGGA GGG (reversed) Intronic
900254492 1:1690906-1690928 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900263243 1:1744181-1744203 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900832187 1:4973261-4973283 AGGGATGAGAAGAAGAAGGCTGG - Intergenic
901058850 1:6462362-6462384 GGGGACAAGAGGAAGGAGGCGGG - Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901157103 1:7148444-7148466 AGGGAGAAGAAGGAGCATGGCGG - Intronic
901169543 1:7246628-7246650 AGGGATCAGAGGAAGGAGGAGGG - Intronic
901279418 1:8021892-8021914 AGGGACAGGAAGAGGCAGTGTGG - Intronic
901370405 1:8792854-8792876 CGGAACATAAAGAAGCAGGAAGG + Intronic
901395601 1:8979000-8979022 AAGGACAAGAAGAAGTACCAAGG + Intergenic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902174889 1:14641599-14641621 AGAGACTAGAAGAAGCAGCCAGG + Intronic
902360679 1:15941204-15941226 AGGGACAGGAAGGAGCAGCCAGG - Intergenic
903373836 1:22853599-22853621 AAGGACAAGAAGGAGCTGGGTGG + Intronic
903842968 1:26257620-26257642 AAGGACCAAAAGCAGCAGGATGG - Exonic
904624722 1:31796025-31796047 AGGGAGAGGAAGGAGCAGGATGG + Intronic
904671867 1:32171972-32171994 AGGAAGAAGAAGAAGAAGAAAGG - Exonic
904909280 1:33921951-33921973 AGGAAAGAGAAGCAGCAGGAAGG + Intronic
905183959 1:36182969-36182991 AGGGACAGTAAGGGGCAGGAAGG + Intergenic
905352121 1:37355096-37355118 AGGGAAAAGAGGAAGGAGGGAGG + Intergenic
905392063 1:37642622-37642644 AAGGACAAAAAGGAGCAGGCAGG - Intergenic
905608279 1:39324481-39324503 AGGTACAAGAACAAACAAGATGG - Intronic
905703696 1:40038916-40038938 AGAGAGAAGAGGAAGCAGGAAGG - Intergenic
905999825 1:42414759-42414781 AGGGAGAAGAACGAGCCGGATGG + Exonic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906289876 1:44612904-44612926 AGTGGGAAGAAGAAGAAGGAAGG + Intronic
906456503 1:46001778-46001800 AGGGAGAAGAAGAAGCAAAAAGG - Intronic
906490231 1:46262496-46262518 AGGGGCAAGAGCAGGCAGGAGGG + Intronic
906518246 1:46452238-46452260 AGAGACAAGAGGAAGCAGAGTGG + Intergenic
906647592 1:47486872-47486894 AAGGAAAAGAAAAAGCAGGAAGG - Intergenic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
906952175 1:50343881-50343903 AGGGACCAGGAGAAGGAGGTTGG - Intergenic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907555054 1:55336156-55336178 AGGCAGAAGAAGGGGCAGGAGGG + Intergenic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
908397870 1:63742817-63742839 AAGGAGAAGATGAAGCAGGGAGG + Intergenic
908403488 1:63792039-63792061 AGGGCCAAGAAGAATGAGCAGGG + Intronic
908702613 1:66919035-66919057 AGGGACAACTTGAAGCAGGGAGG - Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909664084 1:78114440-78114462 ATAGACAAAAACAAGCAGGATGG - Intronic
909686529 1:78355136-78355158 AGAAAGAAGAAAAAGCAGGAAGG - Intronic
910162140 1:84284799-84284821 AGAAAGAAGAAGAAGAAGGAGGG + Intergenic
910252795 1:85215669-85215691 AGGGCCAAGTAGCAGAAGGATGG - Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910641400 1:89466729-89466751 GGAGAAAAGGAGAAGCAGGAAGG + Intergenic
911070916 1:93831229-93831251 AGAGACACGGAGAAGCAGGTGGG - Intronic
911644776 1:100326550-100326572 AGGAAGGAGAAGAAGAAGGAAGG - Intergenic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
911732853 1:101308234-101308256 AGGAAACAGCAGAAGCAGGAAGG + Intergenic
911945747 1:104106615-104106637 TGGGAGAAAAAGAAGCAGGATGG - Intergenic
912100995 1:106204533-106204555 AGGAACAAGAAGAAGCATTTTGG + Intergenic
912103275 1:106238757-106238779 AGGGAAAAGAAGAAGGAACAAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912449668 1:109761214-109761236 AGGAAGAAGTAGCAGCAGGATGG - Intronic
912560101 1:110545005-110545027 AGGGAAAAGAGGAAGAAGGGGGG - Intergenic
912609974 1:111033044-111033066 GGTGACAAGAAGAAGAAGGCAGG - Intergenic
912723139 1:112036735-112036757 GGAGAAAAGAAGAAGCAGTATGG + Intergenic
913695796 1:121324269-121324291 AAGGACAAGAAGGAGAGGGAGGG - Intronic
914141770 1:144955788-144955810 AAGGACAAGAAGGAGAGGGAGGG + Intronic
914409555 1:147413093-147413115 AGGCATACAAAGAAGCAGGAAGG - Intergenic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
914964025 1:152237076-152237098 AGGTAGAAGAAAAGGCAGGAAGG - Intergenic
915319564 1:155048863-155048885 AGGGACAGGAGGAGGCAGGTGGG + Intronic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916384393 1:164251017-164251039 AGGGGCAAGAAGATGAAGGAAGG + Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
916738649 1:167629935-167629957 AGGGACAGGAAAAAGAAAGAAGG + Intergenic
916946838 1:169737808-169737830 AGGGGAAAGAGCAAGCAGGAGGG - Intronic
916967804 1:169970201-169970223 AGGTACAAAGAGGAGCAGGAAGG - Intronic
917105259 1:171485531-171485553 AGCGAGAAAAAGAAGCAAGATGG - Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917410661 1:174757010-174757032 ATGGACAAGAAGCTGGAGGAAGG - Intronic
917896421 1:179492630-179492652 AGGGTCAAGAATAAGAGGGATGG + Intronic
918070672 1:181131542-181131564 GGGGACGGGAAGAAGAAGGAGGG + Intergenic
919145886 1:193634371-193634393 AGGGAAGAGGAGAAGAAGGAAGG - Intergenic
919267303 1:195286342-195286364 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919535545 1:198783122-198783144 AGGGAGAGGAAGCAGCAGAAGGG + Intergenic
919835872 1:201572936-201572958 AGGGGCAAGATGGAGTAGGAAGG - Intergenic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920220155 1:204391276-204391298 AGGGACACGAGGCAGGAGGACGG + Intergenic
920224050 1:204425079-204425101 AGGAACAAGAAGAATCCAGAGGG + Intronic
920278607 1:204826998-204827020 GGGAAGAAAAAGAAGCAGGAAGG + Intergenic
920483121 1:206342637-206342659 AAGGACAAGAAGGAGAGGGAGGG - Intronic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
920859434 1:209693373-209693395 AGGGCCAGGAAGAAGAAGGTGGG - Intronic
920899795 1:210097041-210097063 AGACACAAAAATAAGCAGGACGG - Intronic
920984754 1:210876362-210876384 AGAGACAAGTAGATGTAGGATGG - Intronic
921112507 1:212052698-212052720 AGGTAACAGAAGAAGCAGGGAGG - Intronic
921219230 1:212961468-212961490 AGGGAGAAAGAGAAGCAGAAGGG - Intronic
921280049 1:213557466-213557488 AGAGGGAAGAAGAGGCAGGATGG + Intergenic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921705080 1:218313319-218313341 AGGGAAAAGAAGAATCAGATTGG + Intronic
922022864 1:221721748-221721770 AGGGAAAAGAAGGCTCAGGAGGG + Intronic
922036800 1:221856686-221856708 ATGGGCAAGAGGGAGCAGGATGG - Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922416347 1:225426863-225426885 AGGGAGAAGAACGAGCAGGAGGG - Intronic
922722687 1:227906646-227906668 AGGGAGAGGGAGGAGCAGGAAGG - Intergenic
922793112 1:228321509-228321531 AAGGAGATGAAGCAGCAGGAAGG + Exonic
922820781 1:228484031-228484053 AGGGAAAAGAAAAAGAAGAAAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923306371 1:232692538-232692560 AGAGGAAAGAGGAAGCAGGAGGG + Intergenic
923380432 1:233411917-233411939 AGGGAACTGCAGAAGCAGGAAGG + Intergenic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
924307611 1:242707507-242707529 AGGGAAAAGACGGAGGAGGATGG - Intergenic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1063057218 10:2518958-2518980 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1063071373 10:2669810-2669832 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1063161157 10:3420055-3420077 AGGGACAGGAAGGGACAGGAAGG + Intergenic
1063497890 10:6527009-6527031 AGGGAAAAGGAGGAGCAGGGCGG + Intronic
1063874752 10:10462453-10462475 AAGGCAAAGAAGAAGCAGGGTGG - Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1064165131 10:12979342-12979364 AAGGGAAAGAACAAGCAGGAGGG - Intronic
1064322233 10:14316339-14316361 AGGGGCAAGAAAGAGCAAGAGGG - Intronic
1064426425 10:15233601-15233623 AGGGGCAAAAAGAACCACGATGG + Intronic
1064575751 10:16744870-16744892 AGGGAAAAGAAGGGGCAAGAGGG - Intronic
1064584839 10:16829687-16829709 TGGGACAGGAAGAAGCTGGCTGG + Intronic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1064959731 10:20950459-20950481 AGGGAGAAGAGGCAGAAGGAAGG - Intronic
1065173843 10:23057898-23057920 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065485542 10:26233444-26233466 GGGTTCAAGAAGATGCAGGACGG - Intronic
1065516908 10:26532850-26532872 AAGGACAGAAAGAAGCAGAAAGG - Intronic
1065929827 10:30469752-30469774 AGGAAAGAGAAGAAGCACGAGGG - Intergenic
1065952361 10:30663829-30663851 AAGGGCAAGAAGGAGCAGAAAGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067128149 10:43537792-43537814 AAAGAAAAGAAGAAGAAGGAAGG - Intergenic
1067239740 10:44480455-44480477 AAGGGCAAGCCGAAGCAGGAGGG + Intergenic
1067251861 10:44593358-44593380 AGGGAGGGAAAGAAGCAGGAAGG + Intergenic
1067269696 10:44779735-44779757 AGGGACAAGAAGAAGAGGGCTGG - Intergenic
1067902326 10:50255232-50255254 AGAAAGAAGAAGAAGTAGGAAGG + Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068394226 10:56440836-56440858 TTGGACAAGAAGAAGCAATATGG - Intergenic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069040156 10:63687444-63687466 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1069529845 10:69208996-69209018 AGGGACGAGAAGAAAGAAGAAGG + Exonic
1069625709 10:69866584-69866606 AGGGCCCAGAACAAGCGGGAGGG - Intronic
1069745070 10:70709908-70709930 AGAGACAAGGAAGAGCAGGAGGG + Intronic
1069762974 10:70827796-70827818 AGGGACATTAAGAAGCTGGCTGG - Intronic
1069913648 10:71774354-71774376 AGGGATGAGAAGAATTAGGAGGG - Intronic
1069987488 10:72294299-72294321 AGGGAGAAGAGGAAGAATGAAGG + Intergenic
1070043757 10:72809392-72809414 AGGAACAAAAAGAAGCAAAAAGG + Intronic
1070243330 10:74705528-74705550 GGGGATGAGAAGGAGCAGGAAGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1070917900 10:80166767-80166789 ATGGACAGTAAGGAGCAGGAGGG - Intronic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071141245 10:82511641-82511663 ATAGTCAATAAGAAGCAGGAAGG + Intronic
1071347928 10:84711015-84711037 AGGAAGAAGAAGAAGAATGAGGG - Intergenic
1071689864 10:87805681-87805703 AGGTCCCAGAAGAATCAGGAGGG - Intronic
1072538561 10:96381314-96381336 AGGGACCCGATGAAACAGGAAGG - Intronic
1072800148 10:98387112-98387134 AGGGACAAGATAAAGCAGAGAGG + Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1074372926 10:112914878-112914900 AGGGATAAGAAAAAGCAGGGAGG + Intergenic
1074387249 10:113026475-113026497 AGGGTCTAGAAAAAGCAGCATGG - Intronic
1074544619 10:114393072-114393094 AAGGAGAGGAGGAAGCAGGAAGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075210744 10:120489044-120489066 AGGGACAAAAGGAAGTAGGGAGG - Intronic
1075245432 10:120818128-120818150 AGAGAAGAGAAGAAGAAGGAAGG - Intergenic
1075311472 10:121417484-121417506 AGAGACAAGCAAAAGCTGGAAGG + Intergenic
1075591503 10:123694687-123694709 AAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1075602601 10:123781379-123781401 AGGAGCAAGAACAAGAAGGAGGG + Intronic
1075656312 10:124163391-124163413 AGGGAAGAGAGGAAGCAGGGAGG + Intergenic
1075824303 10:125341428-125341450 AGAGACTAGAAAAAGCAGAAAGG - Intergenic
1076055408 10:127368376-127368398 CAGGACAGGAAGAAGCAGCAGGG - Intronic
1076302307 10:129437467-129437489 AGGGCCAAGAAGAAGCTGTGGGG + Intergenic
1076425004 10:130361480-130361502 AGGGAGGGGAAGGAGCAGGAGGG + Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077426419 11:2480913-2480935 AGGGACAGGATGGAGCAGGACGG + Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1078398995 11:11007725-11007747 GAGAACAAGAGGAAGCAGGAGGG - Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078850966 11:15163320-15163342 AGGGAAAAGAATGAGAAGGAAGG - Intronic
1079673112 11:23192344-23192366 AGGGAGATGAAGAAGAAGTATGG + Intergenic
1079675004 11:23215981-23216003 AGGGACAAGATAAAGGAGAAAGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1080219605 11:29886077-29886099 AGGAAAAAGACCAAGCAGGAGGG - Intergenic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080922770 11:36725328-36725350 AGAGACCAAAAGCAGCAGGATGG - Intergenic
1081540209 11:44029279-44029301 AGGAACAGCAAGAAGCTGGATGG - Intergenic
1081645837 11:44789856-44789878 AGAGACAAGAATTAGGAGGAGGG - Intronic
1082784942 11:57311596-57311618 GGGGAGAAGGAGGAGCAGGAAGG - Intronic
1083001800 11:59299046-59299068 AAGAACAAGAAGAAGAAAGAAGG + Intergenic
1083001808 11:59299109-59299131 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1083902867 11:65652180-65652202 AGGGAAAAGGAGAGGCAGGCTGG + Intergenic
1084032506 11:66489214-66489236 GGGGACAAGGAGAGGCTGGAGGG - Intronic
1084563673 11:69918026-69918048 TGTGACAAGAAGAAGCGGGGGGG - Intergenic
1084924015 11:72497092-72497114 AGGGACAGGGAGCAGCAGAAAGG + Intergenic
1084964351 11:72736664-72736686 AGAGAGAAGGAGAGGCAGGATGG - Intronic
1084978944 11:72818383-72818405 AGGGACAGGAATAGGGAGGAGGG - Intronic
1085047949 11:73364143-73364165 AGGGAAAAGAGGAAGCAGTAAGG - Intronic
1085107362 11:73857005-73857027 AGGGACAAGAAGGGGCGGAAAGG - Intronic
1085308026 11:75499374-75499396 AAGGAAAAGAAGAAGAAAGAAGG - Intronic
1085371498 11:76010915-76010937 AGGGACTTCAAGAAGCAGGATGG + Intronic
1085694327 11:78691080-78691102 AGGGACAGGAAAAACCAGGGAGG - Intronic
1085807669 11:79651112-79651134 AGGAAGAAGAAGAAGAAAGAAGG - Intergenic
1086129117 11:83382836-83382858 GAGGGCAAGAAGAAGCAGGGTGG + Intergenic
1087365802 11:97217400-97217422 AGGGGAAAGTGGAAGCAGGATGG - Intergenic
1087539186 11:99493059-99493081 AGGTAGCAGTAGAAGCAGGAAGG - Intronic
1087819413 11:102694934-102694956 AGGGAGAAGAGGAATCGGGATGG + Intronic
1088617607 11:111646593-111646615 GGGGATAAGAAGGAGCAGGCAGG - Intronic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1089295192 11:117463157-117463179 AGGCACAAGGTGAAGCAGGAAGG + Intronic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089560606 11:119341356-119341378 AGGGACAGGAAGGAGCAGGGAGG + Exonic
1089788082 11:120922394-120922416 AGGGAGCAAAAGCAGCAGGATGG - Intronic
1089836232 11:121373003-121373025 AGGCACAAAAACAACCAGGATGG - Intergenic
1090172638 11:124618149-124618171 TGGGGCAAGAGGAAGCTGGAGGG + Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090884684 11:130865410-130865432 AGGGACAGGAAGACACAGGCTGG - Intergenic
1091038115 11:132252093-132252115 AGGGAAAAGGAGAGGTAGGAGGG - Intronic
1091391578 12:129406-129428 AGGGAGAACAGGAAGCTGGAGGG - Intronic
1091537747 12:1428845-1428867 AGGATCAGGAAGAAGAAGGAAGG - Intronic
1091689795 12:2588187-2588209 CGGGAGAACAAGAAGCAGGAAGG - Intronic
1091858338 12:3756778-3756800 TGGTATAAGAAGAGGCAGGAAGG + Intronic
1092092267 12:5812699-5812721 AAAGAAAAGAAGAAGAAGGAAGG + Intronic
1092127724 12:6086617-6086639 AGAGGCAAGGAGAAGAAGGAGGG + Intronic
1092161284 12:6316769-6316791 AGTGACAAGAGAAAGCAAGAGGG + Intronic
1092314826 12:7399474-7399496 AGGAAGAGGAAGAAGAAGGAAGG - Intronic
1092317588 12:7434628-7434650 AGGGACAAAGAGAAGCAATAAGG + Intronic
1092394987 12:8118033-8118055 AGGGAAAAGAGCAAGCAGGAGGG + Intergenic
1093106016 12:15088035-15088057 AAGGAAAAGAGAAAGCAGGAGGG + Intergenic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094183455 12:27616114-27616136 AGGGAAAAGAGGAGGGAGGAAGG - Intronic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094444590 12:30515972-30515994 ACGGACAAGAAAATACAGGATGG + Intergenic
1094476387 12:30843888-30843910 GGTGACAAGAAGAAGAAGGTGGG - Intergenic
1094613107 12:32012526-32012548 CGGGACAACAAGAAGAGGGAAGG - Intergenic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1095360500 12:41332774-41332796 AGTGACAATAAGTAGAAGGAGGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096657239 12:53099219-53099241 AGGGACAGGAAAAGGCAGAAAGG - Intronic
1096665888 12:53164566-53164588 GGGGACTATAAGAAGCGGGAGGG + Intronic
1096725829 12:53561589-53561611 AGGGAAAGGGAGAAGAAGGAAGG + Intronic
1097098261 12:56567465-56567487 AGGAAGAAGAAGAAGAAGAAAGG + Intronic
1097152945 12:56993161-56993183 AGGGACAGGAAGCAGAAGGTTGG + Intergenic
1097195122 12:57238856-57238878 AGGGACCAGAAGCAGGAGAAGGG - Intronic
1097268965 12:57762539-57762561 AGGGGCAAGACAAAGAAGGAAGG + Exonic
1097336604 12:58390656-58390678 AGGGAAATGATGAAGCATGAAGG - Intergenic
1097472791 12:60016563-60016585 AGGGAAAGAAAGAAGAAGGAAGG - Intergenic
1097790678 12:63812031-63812053 AGGAGGAAGAAGAAGAAGGAGGG + Intergenic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098290254 12:68951417-68951439 AAGGAAAAGAAGGAGTAGGATGG + Intronic
1098306398 12:69107017-69107039 CATGGCAAGAAGAAGCAGGAAGG - Intergenic
1098427875 12:70386372-70386394 AAAGACAAGAAAAATCAGGAGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098880144 12:75908975-75908997 AGGGACAAGAAGAAACCAGCAGG + Intergenic
1099044855 12:77705005-77705027 AGAGACAGAGAGAAGCAGGATGG + Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1100198219 12:92271410-92271432 AGGGACAACAGGAAGAAGCATGG + Intergenic
1100211450 12:92402583-92402605 AAGAACATGAAGAAGAAGGAGGG - Intergenic
1100522538 12:95389121-95389143 AGGGACAACTCGAAGCAGGGAGG - Intergenic
1100550727 12:95644333-95644355 AGGAAGGAGAAGAAGGAGGAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100702084 12:97159867-97159889 AGAGAAAAGAAGAAGAAGGATGG + Intergenic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1101405065 12:104421293-104421315 AGGGGAGAGAACAAGCAGGAGGG - Intergenic
1101779744 12:107824595-107824617 GGGGCCAAGAGGAAGCAGAATGG + Intergenic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102297842 12:111750630-111750652 AGGGACAAAAACAAGCAACATGG - Intronic
1103115811 12:118330721-118330743 AGGGAAAAGAAAAAGAAAGAAGG + Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103245755 12:119455824-119455846 AGGAAGGAGAAGAAGAAGGAAGG + Intronic
1103351627 12:120287666-120287688 AGGGAGGGGAAGAAGCGGGAGGG - Intergenic
1103628997 12:122244064-122244086 ACGGGCAAGAGGAGGCAGGAAGG + Intronic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1103862931 12:124028595-124028617 AGGGCCAAGCAAAAGCAGGAGGG + Intronic
1104006147 12:124893940-124893962 AAGAAAAAGAAAAAGCAGGAAGG + Intergenic
1104039248 12:125118795-125118817 AGGGACAGGCAGCACCAGGAAGG + Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104169162 12:126263122-126263144 AGGGATAAGAAGAGGCTGGCAGG - Intergenic
1104467188 12:129000023-129000045 AGGAGCTAGAAGAGGCAGGAGGG - Intergenic
1104731727 12:131108914-131108936 AGGGACAGGAAGAGACAGGTGGG + Intronic
1105285519 13:19000249-19000271 AGGGACAGGGAGAGGCAAGAGGG + Intergenic
1105442962 13:20430485-20430507 AGGGACAACCAAAAGCAGGGTGG + Intronic
1105746324 13:23379908-23379930 AGGTATAAGACCAAGCAGGAAGG - Intronic
1105762717 13:23528727-23528749 AAATACCAGAAGAAGCAGGATGG + Intergenic
1105778139 13:23681688-23681710 AGGGGAAAGAGCAAGCAGGAGGG - Intergenic
1105784545 13:23735318-23735340 ATAGGCAAGAAGAAGCAAGAGGG - Intronic
1105820216 13:24074199-24074221 AGAGACAGGAAGTAGAAGGATGG - Intronic
1105984370 13:25550716-25550738 AGGACCAAGAAGAGTCAGGAAGG - Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106112979 13:26793064-26793086 AGGAAACAGCAGAAGCAGGAGGG + Intergenic
1106195622 13:27491718-27491740 AGGAAGAGGAAGAAACAGGAGGG + Intergenic
1106311977 13:28562756-28562778 GGGGACAGAAAGAAGCTGGATGG - Intergenic
1106322515 13:28655283-28655305 AGGGAAGAGAAGCAGCAAGAAGG - Intergenic
1106345304 13:28871301-28871323 AGGGGAAAGAAAAAGCTGGAAGG + Intronic
1106621377 13:31374196-31374218 TGGGAAAAGAAGCAGGAGGAGGG - Intergenic
1107188835 13:37555660-37555682 TGGGGCACGAAGAAGTAGGAAGG + Intergenic
1107196806 13:37662007-37662029 AGGATCAAGAAGGAGCTGGAAGG + Intronic
1108084352 13:46769673-46769695 AGGGACAGGCACAAGCAGGACGG - Intergenic
1108120030 13:47175509-47175531 AGAGAAAAGAAGGAGCTGGAGGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108386654 13:49905206-49905228 AGGGAAAAGAGAAAGCAAGATGG - Intergenic
1108514678 13:51189254-51189276 AAGGACAAGAAGTATCTGGAAGG - Intergenic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1108794814 13:54017974-54017996 AGGGAGAAGAAAAGGAAGGAAGG + Intergenic
1109268248 13:60225287-60225309 AGGTCCAGGGAGAAGCAGGAAGG - Intergenic
1110661296 13:78061466-78061488 AGGTAGAAGAAGCAGCAGAAAGG - Intergenic
1110764468 13:79266983-79267005 AGGGATAAGAAGAATTAGAAAGG - Intergenic
1111119774 13:83831554-83831576 AGGGAAGAAAAGAAGGAGGAAGG + Intergenic
1111425582 13:88076495-88076517 AGGAACAAGGAGTAGCAAGAGGG - Intergenic
1112104308 13:96223969-96223991 AGGGAAAGGAAGAAGAGGGAAGG - Intronic
1112714708 13:102170315-102170337 AGGGAGAAGAAGAGGCAAAAAGG - Intronic
1112851203 13:103708694-103708716 AGAGACAAGAAGAACCAGGATGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113258607 13:108534782-108534804 AGGAAGAAGAAGAAGAAAGAAGG - Intergenic
1113557403 13:111249428-111249450 AGGGGAAAGAACAAGCAGGAGGG + Intronic
1113931979 13:113973529-113973551 AGGGACAGCCTGAAGCAGGAGGG - Intergenic
1114529399 14:23386409-23386431 AGGGTGAAGAAGAAGATGGAAGG - Exonic
1114534800 14:23416098-23416120 AGGGTGAAGAAGAAGATGGAAGG - Exonic
1114537881 14:23434307-23434329 AGAGCCAGGGAGAAGCAGGAAGG - Intronic
1114551281 14:23534174-23534196 AGGGGCAAGAAGAGGATGGAGGG - Exonic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1114689961 14:24572335-24572357 AGGGGAAAGAGCAAGCAGGAAGG + Intergenic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116625449 14:47256978-47257000 GGGGACAAGATGAAAAAGGAAGG + Intronic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1118162213 14:63301892-63301914 GGGTACAGGAAGAAGCAGAAAGG + Intergenic
1118375320 14:65171777-65171799 AAGAAGAAGAAGAAGCTGGAAGG + Intergenic
1118468763 14:66055672-66055694 AGGGACAAGAACAAGAAACAAGG + Intergenic
1118489956 14:66249309-66249331 AGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1118631983 14:67713839-67713861 AGGGACAACTCGAAGCAGGGAGG + Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118765943 14:68909407-68909429 AGAGAGAAGAAGGAGCAGGCTGG + Intronic
1118931002 14:70240352-70240374 TGGGACAAGAAGATGGAGGGTGG - Intergenic
1119186888 14:72649471-72649493 AGTGAGAAGAGGAAGAAGGAAGG + Intronic
1119276509 14:73361734-73361756 AGGTACTAGAAGAGCCAGGATGG + Intronic
1119448336 14:74685516-74685538 AGGGAAAAGAATAGGCAGAAAGG + Intronic
1119648814 14:76368628-76368650 AAGGACAAGACAAAGCAGCAAGG - Intronic
1119877192 14:78071021-78071043 AGGGTCAGGAAGATGCTGGAAGG - Intergenic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120893963 14:89513240-89513262 AGGGAAGAAAAGAAACAGGATGG - Intronic
1120904923 14:89611946-89611968 GGGGGGAAGAAAAAGCAGGATGG - Intronic
1121096871 14:91223480-91223502 AGGAAGAAGAAGAAGAGGGAAGG + Intronic
1121120247 14:91371856-91371878 AGGCACAAGTCGGAGCAGGATGG + Intronic
1121697948 14:95928289-95928311 AGGGAGAGGGAGAAGCAGGGAGG - Intergenic
1121960231 14:98252964-98252986 TGGGACAGAGAGAAGCAGGAGGG + Intergenic
1122424307 14:101596808-101596830 AGGAAGAGGAGGAAGCAGGATGG - Intergenic
1122501309 14:102201985-102202007 AGAGACAGGCAGAGGCAGGAAGG - Intronic
1124601950 15:31140589-31140611 ATGGAAGAGAAGAAGCAAGAAGG - Intronic
1124637440 15:31374036-31374058 AGGGCTGAGTAGAAGCAGGATGG - Exonic
1124649626 15:31465206-31465228 AGGGACAATAAGAGCCAGGGCGG - Intergenic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125252558 15:37722426-37722448 AGGGATATGAAAAAGCAGGGAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125684668 15:41556849-41556871 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1125761964 15:42103021-42103043 AGGGGCAGGAAGGAGCAGGCTGG - Intergenic
1125767523 15:42145495-42145517 AGAGACAAGAAGAATGAGGGAGG - Intronic
1126123616 15:45275417-45275439 AGGGACCAGAAAAAGAAGGAGGG - Exonic
1126361073 15:47846609-47846631 GGGGAGAAGAAGAAGGAGTAGGG + Intergenic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1126950320 15:53873502-53873524 AGGGAAAGGAAGAAGCAGTGTGG - Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127164316 15:56229045-56229067 AAGGACAGGATGGAGCAGGATGG + Intronic
1127363369 15:58264663-58264685 AGGGAGAAGAGGGAGAAGGAGGG - Intronic
1127374475 15:58370444-58370466 AGGCAAAAGAGCAAGCAGGAGGG + Intronic
1127522060 15:59752957-59752979 AGGGGAAACAAGAACCAGGAGGG - Intergenic
1128091510 15:64922123-64922145 AGGGACAGGCAGAGGCAGGTTGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1128671379 15:69576896-69576918 AGGGATAGGAAGGAGGAGGAAGG + Intergenic
1129147278 15:73660023-73660045 AGGAACAAGAAGAAGAACAAAGG - Intergenic
1129360622 15:75021703-75021725 AGGAAGTAGAAGAAGCAGGCTGG + Intergenic
1129570883 15:76682492-76682514 TGGCACAAGCACAAGCAGGAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130042540 15:80417512-80417534 AGGGAGGAGAAGAAGCAGAGGGG - Intronic
1130685026 15:86029757-86029779 AGGAAAATGAAGAGGCAGGAGGG + Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131085449 15:89572215-89572237 AGGGACAGGAAAGAGCAGGGAGG - Intergenic
1131262957 15:90898249-90898271 AGGAACAAGGACAACCAGGAGGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131438630 15:92442232-92442254 AGACACAAGAAGAGGCAGGCAGG - Intronic
1131744725 15:95434853-95434875 AGGAAGAAGAAAAAGAAGGAAGG - Intergenic
1131931950 15:97452485-97452507 AGGGACAATAAGAAAAAGAAAGG + Intergenic
1132613831 16:830718-830740 AGGGGCTGGAAGAGGCAGGAAGG - Intergenic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1134455295 16:14390898-14390920 AGGGACACTGAGAAGCAGGGAGG + Intergenic
1134598013 16:15511270-15511292 AGTGTCAAAGAGAAGCAGGAAGG - Intronic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1135061805 16:19277411-19277433 AGGGAAAAGAGGGGGCAGGAGGG + Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135427635 16:22352841-22352863 AAGGACCAGAAGAAGCTGGTGGG - Intronic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136047050 16:27623192-27623214 AGAGGCAAGAAACAGCAGGAAGG + Intronic
1136526939 16:30837257-30837279 TGAGACAAGAAAAATCAGGATGG + Intronic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137409193 16:48213588-48213610 AGGGAATGGAGGAAGCAGGAAGG - Intronic
1137773982 16:51040766-51040788 AGGGAAGAAAAGAAGAAGGAAGG + Intergenic
1137821527 16:51449922-51449944 AGTGAGAAGAGAAAGCAGGAAGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138078182 16:54063280-54063302 AGGGACAAGCGGAAGCAGGGGGG + Intronic
1138201789 16:55094118-55094140 AGGTCCAAGAAGAAGAAGCATGG - Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1140375380 16:74441344-74441366 ACTGTCAAGAAGAAGGAGGAAGG - Intergenic
1140382630 16:74504235-74504257 AGGGCCAAGGAGAGACAGGAGGG + Intronic
1140916730 16:79500513-79500535 AGAGAGAAGAAGGAGTAGGATGG - Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141645914 16:85367511-85367533 AGGGCCACGAAGAAACAGGCAGG + Intergenic
1141685125 16:85565790-85565812 AGGTGTGAGAAGAAGCAGGAGGG + Intergenic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775807 16:86121912-86121934 AGGGACAGGGAGGAGGAGGATGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1142005447 16:87687622-87687644 AGGCACAGGAAGAAGCTGCAGGG + Intronic
1142066503 16:88065918-88065940 AGGGACAGGAAGGAGGTGGAAGG - Intronic
1142114262 16:88348219-88348241 AGGAGCCAGAAGAGGCAGGAAGG - Intergenic
1142230481 16:88897903-88897925 AGGGAGAAGAGGGCGCAGGAGGG - Intronic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143374428 17:6458902-6458924 AAGGACAGGAAGAAGATGGAAGG - Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1143919583 17:10320426-10320448 AGGGCGAAGAGGAAGCTGGAAGG - Exonic
1143932799 17:10447912-10447934 AGGATCAAGAAGAAGATGGAGGG - Exonic
1143937012 17:10496335-10496357 AGGCTCAAGAAGAAGATGGAGGG - Exonic
1143939468 17:10524851-10524873 AGGCTCAAGAAGAAGATGGAGGG - Exonic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144287044 17:13786733-13786755 AGAGACACAGAGAAGCAGGAAGG + Intergenic
1144725593 17:17500454-17500476 AACTTCAAGAAGAAGCAGGAGGG - Intergenic
1144852067 17:18248884-18248906 CTGGACAAGAAGGGGCAGGAAGG + Intronic
1145018093 17:19411814-19411836 AGGGACAGGAAGAAGCAGGTGGG + Intronic
1145280597 17:21464331-21464353 AGGAGCAGGAAGGAGCAGGAGGG + Intergenic
1145833600 17:27937200-27937222 AAGGGCAAGAAGAAAAAGGAGGG - Intergenic
1145888609 17:28399300-28399322 AGGGACCAGAGGCAGCACGAGGG - Exonic
1145968334 17:28937676-28937698 AGGGAAAAAAGGAAGCAGGGAGG + Intronic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1146978251 17:37134974-37134996 AGGGACAAAAGAAAGAAGGAAGG + Intronic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147527066 17:41235800-41235822 AGGGAAAAGAGGGAGCAGGGAGG + Intronic
1147584705 17:41647642-41647664 AGGGACAGGAAGCAGGAGCAAGG + Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1148320955 17:46752300-46752322 AAGGACAAGAAGACACAGCATGG - Intronic
1148352392 17:46950382-46950404 AGGGAAAAGAAGGAGATGGAGGG + Intronic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149439759 17:56664359-56664381 TGGGACAAGTAGAGGCAGGTGGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150442439 17:65202476-65202498 AGAGAGAAGAAGCAGCAAGATGG + Intronic
1151197369 17:72441207-72441229 AGAGACAGGAAGGAGGAGGAAGG - Intergenic
1151480813 17:74369225-74369247 AGTGAGGAGAAGAGGCAGGATGG - Intronic
1151746023 17:76012193-76012215 AGGGACAAGAAAGGGCAGGGAGG + Intronic
1151895322 17:76976574-76976596 AGGGACAAGAAGAAGCAAGATGG + Intergenic
1152008478 17:77696724-77696746 ATGGACAGGAAAAAGCAGGGGGG + Intergenic
1152084072 17:78206692-78206714 AGGAAGAAGAAGAAGAAGGGGGG - Intronic
1152239394 17:79153619-79153641 AGGAAAAAGAAAAAGCCGGATGG - Intronic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152629159 17:81402053-81402075 GGGATCAAGAAGAAGCAGGGAGG - Intronic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153463276 18:5361180-5361202 AGGGAGAAGAAGCAGGAGTATGG + Intergenic
1153509453 18:5835926-5835948 AGGGAGTAGAAGAAGAGGGAAGG + Intergenic
1153562880 18:6388980-6389002 AGGGACAAGGAAAGTCAGGAAGG + Intronic
1153682663 18:7515190-7515212 AGGGAAAAGAAGAAGAGGAAGGG - Intergenic
1154177366 18:12094219-12094241 AGGGACAAGAAGAACAGGTAAGG + Exonic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155030284 18:21978349-21978371 AGGAACCAGAAAAAGGAGGAGGG - Intergenic
1155062927 18:22244609-22244631 AGGAACAAGAGGAAGAAGGTAGG + Intergenic
1155063228 18:22247039-22247061 AGGGAGGAGGAGGAGCAGGAGGG + Intergenic
1155144067 18:23069082-23069104 AGGGGAAAGAGGAAGCAGGAGGG + Intergenic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1155416069 18:25601236-25601258 AGGAAAGAGTAGAAGCAGGAAGG - Intergenic
1155527139 18:26728801-26728823 AAGGACAAGTTGAAGCAGCATGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155865799 18:30963426-30963448 AGGAACCAGCAGAAGCAGGAAGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156036706 18:32772465-32772487 AGGGAGAAGAACAAGAAGGAAGG - Intronic
1156050802 18:32931361-32931383 GGGGAAAAAAAGGAGCAGGAAGG - Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156159478 18:34342521-34342543 AGAGAAAGAAAGAAGCAGGAAGG + Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156511337 18:37639465-37639487 AGGAAGAAGAGGAAGAAGGAAGG - Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156670029 18:39457528-39457550 AGGAACAAAAAGAGGAAGGAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156843738 18:41639086-41639108 AGGGACAGGAAAAAGAAGGAAGG + Intergenic
1156950472 18:42890578-42890600 AGAGAGAAGGAGAAGCAGGGAGG + Intronic
1157103757 18:44753844-44753866 AGAGACAAGGTGAAGAAGGATGG + Intronic
1157237598 18:45979151-45979173 AGGGAGAAGAAGAAGAAGAGAGG - Intergenic
1157283052 18:46358714-46358736 AGGGACAAGAAGGAGAGGAAGGG - Intronic
1157357741 18:46951060-46951082 AGGGACAGGGAGAAGTAGAAGGG - Intronic
1157392515 18:47314669-47314691 AGGGAGAGGAAGAAACAGAAAGG - Intergenic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1157524897 18:48373289-48373311 AGGCACAAGCAGGAGCAAGAGGG - Intronic
1157750796 18:50176318-50176340 AGGGACAAGAGTGAGAAGGAAGG - Intronic
1158040408 18:53086228-53086250 AGGAAGAAGAAGAAGAAGAACGG - Intronic
1158279790 18:55811732-55811754 AGGGACCAGAAAAAGAAGAAGGG + Intergenic
1158317879 18:56231656-56231678 AAAGACAATAATAAGCAGGAAGG + Intergenic
1158866887 18:61646525-61646547 AGGCAGAAGAAACAGCAGGAGGG + Intergenic
1159039631 18:63311662-63311684 AGGCAAAACAAGAAGCAGAATGG + Intronic
1159744220 18:72211211-72211233 AGGCAAGAGGAGAAGCAGGAAGG + Intergenic
1159933080 18:74334293-74334315 AGGGGAAAGAACAAGCAGAAGGG + Intronic
1160200886 18:76794298-76794320 GGGGACAGGAAGAAGCAGCATGG - Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160832078 19:1108778-1108800 AAGGACAGGAAGAAGCAAGTGGG - Exonic
1160980602 19:1815008-1815030 AGGCACTAGAAGCTGCAGGATGG + Intergenic
1161028227 19:2046402-2046424 AGGGGCAAGAAGAAGAAGCGCGG - Exonic
1161397411 19:4052046-4052068 GGGGAAAAGAGGAAGCAGGTGGG + Intronic
1161404042 19:4081925-4081947 AGGAGCAAGAAGGAGGAGGAGGG - Intergenic
1161517985 19:4707355-4707377 AGGGAATGGCAGAAGCAGGATGG + Intronic
1161795093 19:6381778-6381800 AGGAAAAAGAAGAAGAAGAAGGG - Exonic
1161994230 19:7702646-7702668 AGGGAGAAGGAGGAGTAGGAGGG + Intergenic
1162337635 19:10071431-10071453 AGGGACAAGGAGGGGCAGGAGGG + Intergenic
1162451009 19:10754972-10754994 ATGGACTAGAAGGGGCAGGAGGG - Intronic
1162470504 19:10870029-10870051 AGGGACATGAAGGAGAATGAGGG + Intergenic
1162723089 19:12674006-12674028 AGAGAGAAGATGAGGCAGGAAGG + Intronic
1162846062 19:13393564-13393586 AGGAAGAAGAAGAAGAAGGGGGG - Intronic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163235657 19:16029087-16029109 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1163764204 19:19153360-19153382 AGGGACAAGAAACAGCGGGAGGG + Intronic
1163779540 19:19239351-19239373 AGGGAAAGGAAGGAGGAGGAGGG - Intronic
1164474169 19:28562470-28562492 AAGGACATGAGGTAGCAGGAGGG - Intergenic
1164623825 19:29714030-29714052 AGCAACAACAAAAAGCAGGAAGG - Intronic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1164780831 19:30890701-30890723 AGGGTCAAGAAGTAGCATGTAGG - Intergenic
1165361669 19:35340802-35340824 CGGGAGAAGAGGAAGCAGGAGGG + Intronic
1165373748 19:35426864-35426886 AGGGAAAGCAAGAAGCAGGATGG - Intergenic
1165435503 19:35792721-35792743 AGGGACAAAAAGGGGCAGGATGG + Intergenic
1165882987 19:39056644-39056666 AGGGATAAGAACAAGCAGCCAGG - Intergenic
1166179393 19:41096069-41096091 AGGGAACAGAAGAAACAGAAGGG + Exonic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166353296 19:42211390-42211412 AGGGAGAAGAAAAGGAAGGAAGG + Intronic
1166518323 19:43463451-43463473 GGGGCCAAGAGGCAGCAGGAGGG - Intronic
1166524290 19:43501567-43501589 AGGGAGAAGGAAAACCAGGAGGG + Intronic
1166569317 19:43783763-43783785 AGGGACACGAAGATGGAGAAAGG - Intergenic
1167262515 19:48467197-48467219 AGGGAGATGGAGAAGCTGGAGGG - Intronic
1167845913 19:52164018-52164040 AAGGAAAAGAAAAAGAAGGAAGG + Intronic
1167924919 19:52813579-52813601 AGGGACAGGAGCAGGCAGGAGGG - Intronic
1168349308 19:55667043-55667065 AGGGACAAGTAGCAGCAGCCCGG - Intronic
925466478 2:4110936-4110958 AGGGAAAAAAAGAAGAAGAAAGG - Intergenic
925476355 2:4221069-4221091 AGGTGCAAGGAGAGGCAGGAGGG - Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925847929 2:8050662-8050684 AGGGAAAAGAAAATGCAGGCAGG + Intergenic
925983883 2:9199346-9199368 AGGGAAATGAAGCAGAAGGATGG - Intergenic
926394847 2:12430403-12430425 AGGAAGGAGAAGAAGGAGGAAGG + Intergenic
926435831 2:12836562-12836584 AGGGAAGAGAGCAAGCAGGAAGG + Intergenic
926508513 2:13745018-13745040 AAGGGCAAGATGAAGCAGGGTGG + Intergenic
927083979 2:19656326-19656348 AGGGCCAACAAGAAAAAGGAAGG + Intergenic
927085295 2:19669256-19669278 AGGAATAAGATGCAGCAGGATGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927827340 2:26317814-26317836 AGGGACAGGTAAACGCAGGAAGG - Intronic
928127058 2:28624204-28624226 AGGGACAGGAAGGAGCAGGAGGG - Intronic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929764661 2:44834054-44834076 AGAGACAAGAAAGGGCAGGAAGG + Intergenic
929794079 2:45045435-45045457 AGGGAGGAGAGGAAGAAGGAAGG - Intergenic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
931250001 2:60521788-60521810 AGGGTCAGGAAGAAGCAGCTGGG - Intronic
931482516 2:62656150-62656172 AGAGTGAAGAAGAAGAAGGAAGG - Intergenic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
931675355 2:64689499-64689521 AGGAATAAGAAGAAGAAAGAGGG + Intronic
931981370 2:67696775-67696797 AGGGACGAGAAGGGGGAGGAAGG + Intergenic
932354695 2:71059107-71059129 TGGGACAAGCAGCAGCAGCAGGG - Intergenic
932408753 2:71532448-71532470 AGGAAGAGGAAGAAGCAGCATGG + Intronic
932451497 2:71813484-71813506 AGGAACAAGAAGGAGCAGGTGGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933496240 2:83053597-83053619 AGGAAGAAGAAGAGGCAGAAGGG + Intergenic
933698489 2:85237758-85237780 AGGGGCATGAAGAAGGAGGGAGG + Intronic
934080147 2:88460664-88460686 AGGCACAAGAGGAGGCAGGGAGG - Intergenic
934115345 2:88785380-88785402 AGGAACCAGTGGAAGCAGGAAGG + Intergenic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934832191 2:97539422-97539444 AGGAACCAGTGGAAGCAGGAAGG - Intronic
934864189 2:97791388-97791410 AGGGCAAGGAGGAAGCAGGACGG - Intronic
935084851 2:99835150-99835172 CGGGAAAAGGAGAAGCAAGAGGG - Intronic
935109312 2:100077320-100077342 AAGCAAAAGAAGGAGCAGGAAGG + Intronic
935248155 2:101237253-101237275 AGGAAAAAGAAGAAGGAAGAAGG + Intronic
935276451 2:101479890-101479912 AGGAACAAGCAGAGGCAGGTGGG - Intergenic
935333954 2:101997875-101997897 AGGTACAAGAGGAATCAGGCAGG - Intronic
936122493 2:109758923-109758945 AGGGAAAAGAGCAAGCAGGAGGG + Intergenic
936222200 2:110612549-110612571 AGGGAAAAGAGCAAGCAGGAGGG - Intergenic
936502494 2:113077416-113077438 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
936590342 2:113797749-113797771 AGGGAAAAGAAGAAACATAATGG - Intergenic
936650461 2:114420809-114420831 AGGGACAGGGAGAAGCAGAAAGG - Intergenic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
937256225 2:120557752-120557774 AGGGGCAAGATGGGGCAGGAAGG - Intergenic
937310561 2:120900219-120900241 AGGAACAAGAAAGAGCCGGAAGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937371254 2:121299076-121299098 AGCAACATGAGGAAGCAGGATGG + Intergenic
937552319 2:123108925-123108947 AGGGAGAGGGAGGAGCAGGATGG - Intergenic
937958525 2:127437640-127437662 AAGGAAAAGAAGGTGCAGGAGGG - Intronic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938615061 2:132989076-132989098 AGGAACAAGAGGAAGCATGGCGG + Intronic
939014181 2:136882376-136882398 AGAAAGAAGAAGAAGAAGGATGG - Intronic
939125305 2:138171142-138171164 GGGGACTACAAGAAGGAGGAAGG + Intergenic
939490850 2:142874444-142874466 AGGGGAAAGGAGAGGCAGGAGGG + Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940015778 2:149102540-149102562 TGGGACCAGAAGATGTAGGAGGG + Intronic
940057318 2:149526566-149526588 AGGTACAGGAAGAAGCTAGAAGG + Intergenic
940097408 2:149993294-149993316 AGGAAATAGCAGAAGCAGGAAGG - Intergenic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940239977 2:151552029-151552051 AGGCACAAGAAGAGGAAGGGTGG + Intronic
940255619 2:151725162-151725184 AAGGCCAAGAAGCAGCAGGCTGG - Intronic
941012902 2:160321332-160321354 AGGGAGAAGAGGAAGCTGAATGG - Intronic
941167728 2:162101366-162101388 AGGTAGAAGAAAAGGCAGGAAGG + Intergenic
942017771 2:171833748-171833770 AGGGAGAAGAAGATGGAGGGAGG - Intronic
942466738 2:176215974-176215996 AGGGAAAAGAAGAAACTAGAAGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943214707 2:185015665-185015687 AGGGACAAGAAGAAAGATGCTGG + Intergenic
944149008 2:196537518-196537540 AGGGACAGCATGAACCAGGACGG + Intronic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944591828 2:201225097-201225119 AGGTCCTAGAAGAAGCAAGATGG - Intronic
944678482 2:202054294-202054316 AGGGAAAAGAGAAAGAAGGAAGG + Intergenic
944837741 2:203596901-203596923 AGGGATGAGAAGGAACAGGATGG - Intergenic
945239265 2:207661172-207661194 AGGCTCAGGGAGAAGCAGGAAGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
946047982 2:216837098-216837120 TGGCACAAGATGAGGCAGGAAGG + Intergenic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946731861 2:222717514-222717536 AGGGAGAGGATGAGGCAGGAAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947359937 2:229336328-229336350 AGGGACAGGCAGACACAGGATGG + Intergenic
947581082 2:231319021-231319043 GGGAACAGGAAGAAGCAGGGAGG + Intronic
947649330 2:231771552-231771574 AGCCACAAGAAGAAACAGCATGG - Intronic
947986787 2:234454958-234454980 AGGAACAACTAGAAGCACGAGGG + Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948221238 2:236271396-236271418 AGGGACAACTTGAAGCAGGGAGG - Intergenic
948232133 2:236356325-236356347 GGATACAGGAAGAAGCAGGATGG + Intronic
948232311 2:236358995-236359017 GGATACAGGAAGAAGCAGGATGG - Intronic
948454293 2:238097591-238097613 AGGGAAAAGGAGGGGCAGGATGG + Intronic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948570879 2:238916472-238916494 AGGGAAAGAAAGAAGGAGGAGGG + Intergenic
1168829321 20:835920-835942 AGGGAAAGAAAGAAGCAGGTGGG + Intronic
1169040469 20:2490324-2490346 AGAGAAAAGAAAAAGAAGGAAGG + Intronic
1169693306 20:8358072-8358094 AGGGACAAGAGGCAGCAGGCTGG - Intronic
1169971748 20:11275896-11275918 AGGGACAAAGAGAAGAAGGAAGG - Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1169984653 20:11430507-11430529 AGGGAGAAGAAGGAGCAGAGAGG - Intergenic
1170047503 20:12100917-12100939 AGGGACTAAGAGAAGCAAGATGG + Intergenic
1170137822 20:13094557-13094579 AGTGACAAGAAGAAGGCTGACGG + Intronic
1170360330 20:15539289-15539311 AGTGACAAGAAGGAGCATGTGGG + Intronic
1170624629 20:18021805-18021827 AGGGGAAAGAGGAAGCAGGGAGG + Intronic
1170715783 20:18829687-18829709 AGGGACAAGAAAGAGGAGAAGGG - Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1172471154 20:35197430-35197452 AGGGCCAAGAAGAGGGAGAAAGG - Intergenic
1172855167 20:37996131-37996153 AGGGTCAAGAAGCAGAAAGACGG - Intronic
1172889043 20:38250869-38250891 AAGGGCAAGAAGAAGAAGGTAGG + Intronic
1173216853 20:41093415-41093437 AGGGGAAAGAAGAAGAGGGACGG - Intronic
1173355753 20:42288231-42288253 AGTGACCAGAAGAAGCATGAGGG - Intronic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173802665 20:45904609-45904631 TGGGGCAGGAAGGAGCAGGAAGG + Intronic
1174333169 20:49837177-49837199 TGGGACAACTAGAAGCAGGGAGG - Intronic
1174461829 20:50688784-50688806 AGAGGAAAGAGGAAGCAGGAAGG + Intronic
1174504237 20:51006443-51006465 AGGGTCAAGAAGAAAAAGAAAGG - Intronic
1174718171 20:52782901-52782923 TGGGACAAGATGAAGAAGGATGG - Intergenic
1175296327 20:57911259-57911281 AGAGAGAAGAAGAGGAAGGAAGG + Intergenic
1175298903 20:57928861-57928883 GGAGACAAGAAGGAGGAGGAGGG - Intergenic
1175319937 20:58078485-58078507 AGTGATGAGAACAAGCAGGAGGG + Intergenic
1175571526 20:60026425-60026447 AGGGAGAAGAGGAGGCAGAAGGG + Intronic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1176671555 21:9739510-9739532 TGGGAGAAGAAGAAGAAAGAAGG + Intergenic
1176918982 21:14663630-14663652 AAGGACCAGAAGGAGGAGGAAGG + Intergenic
1177057119 21:16319636-16319658 AGGAAGAAGAAGAAGAAGAAAGG - Intergenic
1177118874 21:17118050-17118072 AGGGAGAAGATGATGCAGGAAGG - Intergenic
1177301892 21:19257383-19257405 AGGGACAGGAGGCAGGAGGAGGG + Intergenic
1177905492 21:26967267-26967289 AGGGAGACGAAGTAGGAGGAAGG + Intergenic
1178002337 21:28176392-28176414 AATGAAAAGAAGAAGAAGGAAGG + Intergenic
1178258332 21:31075611-31075633 GTGGCCAAGAAGAAGCAAGATGG - Intergenic
1178940009 21:36897734-36897756 AGGTACAAGGAGGAGAAGGAAGG + Intronic
1179049335 21:37875382-37875404 AGGGGGAGGAGGAAGCAGGATGG - Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179207240 21:39293064-39293086 AGGTACAAGATGAAGCAGTTAGG + Intronic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179569748 21:42271437-42271459 AGGGACAGGAGGAAGTAGGAAGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180013087 21:45064252-45064274 AGGGAGAGGAAGAAGAAGGGTGG - Intergenic
1180990108 22:19930588-19930610 AAGGACAGGGACAAGCAGGAGGG + Intronic
1181116377 22:20634696-20634718 GGAGACAGGCAGAAGCAGGAGGG + Intergenic
1181319577 22:21994222-21994244 TGGGAGAAGAAGTAGCTGGAGGG + Intergenic
1181550544 22:23636731-23636753 AGGGAAAGGAGGAGGCAGGAGGG + Intergenic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181720228 22:24768582-24768604 AAGGAAAACAAGAAGCAGGAAGG + Intronic
1181797735 22:25321961-25321983 AGGGAAAGGAGGAGGCAGGAGGG - Intergenic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182102970 22:27670692-27670714 AGGGGCAGAAAGAAGCAGGCTGG - Intergenic
1182143473 22:27982447-27982469 CGGCACAATAAGAAGGAGGAGGG - Exonic
1182466783 22:30521859-30521881 AAGGAAAAGAAAAAGAAGGAAGG - Intergenic
1182573495 22:31256852-31256874 AGGGAAAAGAAGGAGCTAGAAGG + Intronic
1182598053 22:31437461-31437483 AAGGACTAGAGGAAGCGGGAGGG - Intronic
1182615480 22:31586169-31586191 AGGTACAAAGAGAAGCAGGAGGG - Intronic
1182618437 22:31604472-31604494 ACGGACAGGAAGAACAAGGAAGG - Intronic
1182768211 22:32774134-32774156 GGGGACAAGAAAAACCATGAGGG + Intronic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1183091100 22:35522770-35522792 AGGGAGAGAAAGAAGAAGGAAGG - Intergenic
1183268569 22:36846610-36846632 TGGCTCAAGATGAAGCAGGAGGG - Intergenic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183628693 22:39020536-39020558 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183632172 22:39040295-39040317 GGGAAGAAGGAGAAGCAGGAAGG + Intergenic
1183637401 22:39072697-39072719 AGGGGCATGAGGAGGCAGGAGGG - Intronic
1183637993 22:39076696-39076718 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1184821132 22:46909922-46909944 AGGGAGATGAAGAAGCAGGGCGG - Intronic
1184935167 22:47715946-47715968 TGAGACAAGGAGAAGCAGCAGGG + Intergenic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184986562 22:48140072-48140094 CTGGACTAGAAGAAGCCGGAAGG + Intergenic
1185136674 22:49077381-49077403 ATGCCCAAGAAGCAGCAGGAAGG - Intergenic
1185301232 22:50082142-50082164 CGGGACCAGCTGAAGCAGGAGGG + Intronic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949725988 3:7045404-7045426 AAGGATAAGAAGAGGCAAGAGGG + Intronic
949748236 3:7320599-7320621 AGGAAACAGAAGAAGCAGGAAGG - Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950261461 3:11545531-11545553 ATGGACAAGAAGAGACAGGGAGG - Intronic
950565459 3:13767289-13767311 CGGGATTAGAGGAAGCAGGAGGG - Intergenic
950808855 3:15632379-15632401 AGGGAACAGCAGAACCAGGAAGG - Intronic
951387406 3:22059262-22059284 AGGGAAAAGAAGAAGAAGACAGG + Intronic
951803469 3:26622726-26622748 GGGGACTAGAAAAAGCAGCAGGG - Intergenic
951962886 3:28348823-28348845 AGGGACGAGCCGAGGCAGGAGGG + Exonic
952266014 3:31787106-31787128 AGGGACATGAAGAAGTAAGGAGG - Intronic
952574285 3:34755919-34755941 AAGGGCAAAAAGAACCAGGAAGG - Intergenic
953140556 3:40225753-40225775 AGGGAAGAGAAGAAGCAAGGAGG - Intronic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
953683467 3:45057851-45057873 GGGGACAACTGGAAGCAGGAAGG + Intergenic
953896642 3:46808304-46808326 AGCAGCAAGGAGAAGCAGGAAGG + Intronic
954003379 3:47575093-47575115 ACGAACAAGAACAAGAAGGATGG + Intronic
954189247 3:48944789-48944811 AGGGACAAGAGGAAGAAAGAAGG - Intronic
954486143 3:50853465-50853487 GGGGACTCCAAGAAGCAGGAAGG - Intronic
954600442 3:51863475-51863497 AGGGAGAAGAGGAGGCAGCAAGG - Intergenic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
954950232 3:54465978-54466000 AGGGACAAGGACAACCAGCAAGG - Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955658607 3:61271864-61271886 AAGCTCAAGAAGAGGCAGGAAGG + Intergenic
955898055 3:63721868-63721890 ATGGACAGGAAGAATCAGTATGG + Intergenic
956017488 3:64898817-64898839 AGGAACAAGATCAAACAGGAGGG + Intergenic
956768155 3:72501967-72501989 ATGGACAAGAAAAAGCAGGCTGG + Intergenic
956957842 3:74361405-74361427 ACTGAGATGAAGAAGCAGGATGG - Intronic
956960387 3:74392399-74392421 AAGAAAAAGAAGAAGCAGGGTGG - Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957595778 3:82263800-82263822 GGGGACTAGAAGGAGGAGGAGGG + Intergenic
957640781 3:82850403-82850425 AGGGATAAGAAGAAAGAAGAAGG - Intergenic
957822853 3:85400769-85400791 AGGGACAAGACGCAGGCGGAGGG + Intronic
957856816 3:85890161-85890183 AGGGGAAAGAGCAAGCAGGAGGG + Intronic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
958657451 3:97020496-97020518 AGAGTCAAGAAAATGCAGGATGG + Intronic
958687155 3:97413380-97413402 AGGGGAAAGAGCAAGCAGGAGGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959256833 3:104025797-104025819 GGGGGAAAGAAGAAGAAGGAAGG + Intergenic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960549542 3:118959389-118959411 AGGGAGAAGAATAAACAGCAAGG + Intronic
960680170 3:120239394-120239416 AGGAAGAAGAAGAAGAAGAAGGG - Intronic
960822895 3:121753003-121753025 AGGGGAAAGAAGAAGAGGGATGG + Intergenic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
960854884 3:122092665-122092687 GGAGACAAGGAGCAGCAGGAAGG - Intronic
961416554 3:126763180-126763202 GGGGAAAGGAAGAAGCAGAAAGG - Intronic
961517399 3:127446512-127446534 AGGCTGCAGAAGAAGCAGGATGG + Intergenic
963638748 3:147832992-147833014 AGTGATAAGAGAAAGCAGGAGGG - Intergenic
963762273 3:149295784-149295806 ATGCACAAGGAGCAGCAGGAAGG - Intergenic
964397737 3:156265329-156265351 AGGGAGAAGAAGTAGCTGGATGG - Intronic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
964774512 3:160261151-160261173 AGGAATGAGAAGAAGAAGGATGG - Intronic
965117362 3:164508454-164508476 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
965819029 3:172666216-172666238 CGGGACAGGAAGAAGAAGGCAGG - Intronic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966668695 3:182502178-182502200 AGGGACTTGGAGAAGGAGGAAGG + Intergenic
966739342 3:183217711-183217733 AGGGACAAGTGGAGGAAGGAAGG - Intronic
967147036 3:186615138-186615160 AGGGAAAAGAAAACGGAGGAAGG + Intronic
967882487 3:194311731-194311753 AGGTAGAAGAAGAAGCACCAGGG + Intergenic
967894698 3:194386416-194386438 AGGGACAGAAGGAGGCAGGAGGG - Intergenic
968938364 4:3625125-3625147 AAGGACAAGGAGAAGCAGTGTGG + Intergenic
969107882 4:4821609-4821631 AGGGCTCAGAAGAAGAAGGAAGG + Intergenic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969239799 4:5890677-5890699 AGGGAGAAGAGGAAGGAGTAGGG + Intronic
969407283 4:7001952-7001974 AGGCCCAAGAAAGAGCAGGAAGG - Intronic
969701119 4:8768408-8768430 TGGGACAGAAAGAAACAGGAAGG - Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
969848881 4:9941528-9941550 AGGGAGAAGAAGTGGAAGGAGGG + Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970092090 4:12421249-12421271 AGGGACAAGTTGAAGCAGGGAGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971193603 4:24450863-24450885 AGGGACAACAAGAGGCAGAGAGG - Intergenic
971221080 4:24706475-24706497 AGAGAGAAGAAGAAGGAGAAGGG - Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971425638 4:26512452-26512474 AGGGAACAGGAGGAGCAGGAGGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
972397128 4:38666970-38666992 AGGGACAAAAGAAATCAGGAGGG + Intronic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974546047 4:63308206-63308228 AGGAAACAGAAGAAACAGGAAGG + Intergenic
974771048 4:66414084-66414106 GGGGACATGAAGAAATAGGAAGG + Intergenic
974924305 4:68278329-68278351 AGGGAAAAGAGCAAGCAGGAGGG - Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975391464 4:73822884-73822906 AGGGAGAAGAAGAGGGAGAAAGG + Intergenic
975505541 4:75132928-75132950 AGGGACTAGAAGGAGCTAGAAGG - Intergenic
975631437 4:76407815-76407837 AGAGAAAAGAAGAAAGAGGAAGG + Intronic
975768944 4:77699951-77699973 AGGGAAAGGAAAAAGCAGAAAGG - Intergenic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
978131141 4:105199464-105199486 AGGGACTTGAAGAAACAAGATGG - Intronic
978518689 4:109596381-109596403 AGGGAGAAGAGGAGGCAGCAAGG + Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978652785 4:111027296-111027318 AGTGACAACAGGAAGAAGGAGGG - Intergenic
978914452 4:114106719-114106741 AAAGACTAGAAGAAGCAGAAAGG + Intergenic
979441958 4:120760637-120760659 AGGAACAAACAGAAGCATGATGG + Intronic
979481094 4:121218593-121218615 AGGGACGGGGAGAAGGAGGAAGG - Intronic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979670719 4:123357546-123357568 AGGAAGAAGGAAAAGCAGGAGGG - Intergenic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
980394094 4:132186162-132186184 AGGGAAAAAAAGAGGGAGGAAGG + Intergenic
980689893 4:136281524-136281546 AAGGACAAGAAGAAGAAGGTGGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980867137 4:138565075-138565097 AGGGACCAGAGGCAGCATGAGGG + Intergenic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
981637963 4:146902152-146902174 AGGGAAAAGAGGAAGGGGGATGG - Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982374387 4:154673594-154673616 GGGGACAAGAGGAAGGAAGAAGG + Intronic
982612321 4:157591084-157591106 TGGAACAAGAAGAAGGAGTATGG + Intergenic
982777153 4:159453568-159453590 AGGTTGAAGAAGAGGCAGGAAGG - Intergenic
982915096 4:161198001-161198023 AGGGGAAAGAACAAGCATGAGGG + Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
985033393 4:185814615-185814637 AGATACAAGAAGAAGGATGAAGG - Intronic
985666444 5:1183781-1183803 AGGGGCAAGAAGGGGCATGAGGG + Intergenic
985707850 5:1411650-1411672 AGAAACAAGGAGGAGCAGGAGGG + Intronic
985993816 5:3585083-3585105 AGGGACAAGAGGAAGGAAGGAGG + Intergenic
986240355 5:5954899-5954921 AGGGGAAAGAAGGAGAAGGAGGG - Intergenic
986258150 5:6119060-6119082 AGGGACCACAAGAAGAATGATGG + Intergenic
986415768 5:7526297-7526319 AAGGACAAGAAGAAAAGGGAAGG + Intronic
986710860 5:10486966-10486988 AGGGCCAAGGAGGAGCAGGGAGG + Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987619899 5:20327474-20327496 AGGAGCAAGAGCAAGCAGGAGGG - Intronic
987936604 5:24474733-24474755 AGGGAAAAGAGTAAACAGGAGGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988247543 5:28706859-28706881 AGGGGAAAGAGTAAGCAGGAGGG + Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989981922 5:50655684-50655706 AGAGAGAAAAAGAAGAAGGAAGG - Intergenic
989994195 5:50808248-50808270 AGGGGAAAGAGCAAGCAGGAGGG + Intronic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990837073 5:60034106-60034128 GGAGATAGGAAGAAGCAGGAAGG + Intronic
991564026 5:67985887-67985909 AGGAACAAGAAGCAGAAGCAAGG - Intergenic
991691926 5:69233806-69233828 AGGGACAAGAAAAAGAAAGAAGG - Intergenic
993044935 5:82856277-82856299 AGGGGGAAGAAGACGCAGGTGGG + Intergenic
993193926 5:84715871-84715893 ATGAACAAGATGAGGCAGGAAGG - Intergenic
993247130 5:85465420-85465442 AAGGACAAGAAGAAGGTGGTAGG - Intergenic
994175872 5:96710443-96710465 AAGGGCAAGAAGAAGAGGGAAGG - Intronic
994176254 5:96714575-96714597 AGGGACAAGAAGCAGAAAGTAGG + Intronic
994810273 5:104508590-104508612 AGGGACAAAGAGAAGGAGGGAGG + Intergenic
994913197 5:105940235-105940257 AGGGAAAACAAGAAGCAGTTAGG - Intergenic
995907442 5:117142504-117142526 AGGAAGAGGAAGAAGAAGGAGGG - Intergenic
996289832 5:121839689-121839711 ATGGAAAAGAAGAAGCAGCATGG + Intergenic
996522067 5:124438300-124438322 ATAAACAAGAAAAAGCAGGAAGG + Intergenic
997041497 5:130261128-130261150 AGGGACAAGTGGAAGCAGCTTGG - Intergenic
997160021 5:131598334-131598356 TGGGACAAAATAAAGCAGGAAGG + Intronic
997820806 5:137063990-137064012 AGGGCCAAGAAGAAGCTGAGAGG + Intronic
998208034 5:140173475-140173497 AGGGGGAGGAAGAAGCAGGTGGG - Intergenic
998940746 5:147280080-147280102 GGGGAGAAGAAGCAGCAGAAAGG + Intronic
999384630 5:151145472-151145494 AAAGACATGAAGAAGTAGGATGG - Intronic
999545681 5:152626018-152626040 TGGGACAACTCGAAGCAGGAAGG - Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1000357658 5:160416192-160416214 AGGTACAAGAAAAACCAAGAGGG - Intronic
1000978927 5:167795627-167795649 AGCCACAAGAAGCACCAGGAAGG + Intronic
1001438155 5:171716539-171716561 GGGAACAAGAAGAAGAAGAATGG + Intergenic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001568911 5:172717588-172717610 AGAGACAAGAGGAAGCAGTCGGG + Intergenic
1001737804 5:174021087-174021109 AGAAAGAAGAAGAAGAAGGAAGG + Intergenic
1001743818 5:174074667-174074689 AGGGACAGGAATCAGCAGCAAGG - Intronic
1001941244 5:175741180-175741202 AGTGACAAGAGGAGGTAGGATGG - Intergenic
1002017917 5:176340556-176340578 GGGGAAAAGCAGAAGCAGGTAGG + Intronic
1002314399 5:178333847-178333869 TGAGACAGGAAGAAGCAGGGTGG - Intronic
1002330844 5:178439466-178439488 AGGGAAAGGAAGAGGCAGGAGGG - Intronic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003051637 6:2786103-2786125 AGGGAGAGGAAGTAGCAGTAGGG - Intronic
1003255434 6:4471017-4471039 AAGGGCAAGAAGAAGATGGAAGG + Intergenic
1003487850 6:6595236-6595258 AGGGAAGAGAACAAGAAGGAGGG + Intronic
1003493132 6:6641396-6641418 AGGGACTGGAGGAAGCAGGAGGG - Intronic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1004131177 6:12921538-12921560 AGGGAAAGGAGGAAGGAGGAAGG + Intronic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004420614 6:15466235-15466257 AGGAAACAGGAGAAGCAGGAGGG - Intronic
1004743583 6:18487900-18487922 AGGGACAAGAAAAAGCATTCAGG - Intergenic
1004892680 6:20116497-20116519 AGGGACAGAAGGAAGGAGGAAGG + Intronic
1004933010 6:20479786-20479808 ATGGACAAGAACAAGAAGGGAGG - Intronic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005255374 6:23997257-23997279 AGGGGGAAGGGGAAGCAGGAGGG - Intergenic
1005738379 6:28769717-28769739 AGGGCCAATAAAAATCAGGAAGG - Intergenic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1006741012 6:36309040-36309062 TGGGACAAGAACAACCAGGAAGG - Intergenic
1006752956 6:36390726-36390748 AGGTAAAAGAAGAAGCATGCAGG + Exonic
1007171022 6:39863608-39863630 AGGAACAGGAATGAGCAGGATGG + Intronic
1007234363 6:40379642-40379664 AGGGAAAAGAAGAGGGATGAAGG - Intergenic
1007239323 6:40413812-40413834 AGGAACAAGAGGAAACAGGTGGG - Intronic
1007595011 6:43045915-43045937 AGGGCCAGATAGAAGCAGGAGGG + Intronic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008800492 6:55362978-55363000 AGGAAGAAGAGGAAACAGGAAGG + Intronic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009675541 6:66814971-66814993 AGTAACAAGAAGAATCAGGCAGG - Intergenic
1009803984 6:68578702-68578724 AGGAAAAAGAAAAAGAAGGAAGG + Intergenic
1010485665 6:76410430-76410452 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
1010833736 6:80561597-80561619 AGGGACAGGGAAAGGCAGGAAGG - Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1011551216 6:88532690-88532712 AGGGAAGTAAAGAAGCAGGAGGG - Intergenic
1011657360 6:89563949-89563971 AGGTGCAGGAAGAAGCAGAAAGG + Intronic
1011821832 6:91262113-91262135 GGGGACAAGAGGGAGTAGGAAGG + Intergenic
1012382636 6:98638662-98638684 CAGGAAAAGAAGAACCAGGAGGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013325238 6:109039097-109039119 AGGGAGGAGAAGGAGAAGGAAGG + Intronic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014294198 6:119598401-119598423 AGGCACAAGGAGAAGGAGAAGGG + Intergenic
1014304916 6:119727990-119728012 GGGTAGAAGAAGCAGCAGGAAGG - Intergenic
1014391045 6:120864845-120864867 TGGGAAAAGTAGTAGCAGGATGG + Intergenic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1015121128 6:129702697-129702719 AGAATCAAGAAGAGGCAGGAGGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015522476 6:134145638-134145660 AGGGACAAGAAGCAGAGGGGAGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015697277 6:135995039-135995061 GGGGACATGAAGAAGCAGGATGG - Intronic
1015824834 6:137300625-137300647 AGAGAACAGCAGAAGCAGGAAGG - Intergenic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016640150 6:146338870-146338892 AGAGAAGAGAAGAAGGAGGAAGG - Intronic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016817272 6:148314686-148314708 AGGGACAAGAACGAGAAGGTGGG + Intronic
1017334085 6:153234559-153234581 AGGGAAAAGAAAAGGAAGGAAGG + Intergenic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1017560560 6:155623889-155623911 AGGGGAAAGAGCAAGCAGGAGGG + Intergenic
1017581806 6:155873074-155873096 GGAGACAAGAAGCAGCAGGAGGG - Intergenic
1017652951 6:156599659-156599681 AAGGACATGAAGAGCCAGGAAGG + Intergenic
1018028415 6:159823118-159823140 AGGGAGAAGAGGAGGCAGGCAGG - Intergenic
1018131368 6:160735037-160735059 AGGGACACCAAGAGGGAGGAAGG + Intronic
1018432184 6:163730985-163731007 AGGCACAGCAGGAAGCAGGAGGG + Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019208764 6:170386710-170386732 AGAGAGCAGAAGAAGAAGGAAGG + Intronic
1019272340 7:157214-157236 AGGAAAAAGAAGAATCAGAAAGG - Intergenic
1019395090 7:813832-813854 AGGAACAAGAACAAGCAGGTAGG - Intergenic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1019477895 7:1252756-1252778 AGGGACAAGAAGCAGGTGGCCGG + Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019772250 7:2891054-2891076 AGAGACTGGAAGAGGCAGGAAGG - Intergenic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020173357 7:5863206-5863228 AGGGGAAAGAGCAAGCAGGAGGG - Intergenic
1020259938 7:6525675-6525697 AGGAACAAGAAGGAGCAAGCAGG + Intronic
1021622563 7:22563132-22563154 AGGGTCAGGAAGCAGCAGGCTGG + Intronic
1021906456 7:25338837-25338859 AGGGAAAAGAAGAAAAAGAAAGG + Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022458799 7:30584728-30584750 TGGGACAACATGAAGCAGGGAGG - Intergenic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023154374 7:37233345-37233367 AGTGACATGAAGGGGCAGGACGG + Intronic
1023214548 7:37847802-37847824 AGGAAGAAGAAGAAGAAAGAAGG + Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023783330 7:43679768-43679790 AGGAATAAGAAGCAGCAGAAAGG + Intronic
1023802636 7:43848208-43848230 AGGGAACAGATGAAGCAGGGGGG + Intergenic
1023909261 7:44541954-44541976 AGGGACAAGAGGGAGAAGGTCGG - Intergenic
1023991549 7:45131902-45131924 AGGGACAAGAAACAGGAGGGAGG - Intergenic
1024018728 7:45345851-45345873 AGGGGCAAGAAAACGCAGAAAGG - Intergenic
1024032257 7:45471409-45471431 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1024684418 7:51729860-51729882 AGGGAAAAAAAGACCCAGGAAGG + Intergenic
1025235512 7:57232203-57232225 GGGGACATGACAAAGCAGGAGGG - Intergenic
1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026143838 7:67728598-67728620 AGGGAAAAAGACAAGCAGGAAGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1027538653 7:79439467-79439489 AGGGACAGGAAGAAGCAGAGGGG - Intronic
1028128438 7:87142662-87142684 AGGTACAAGAATGTGCAGGAGGG - Intergenic
1028237332 7:88378354-88378376 AGGGAAAGGAGCAAGCAGGAGGG + Intergenic
1028813135 7:95111862-95111884 AGGGAGAAGAGGGAGCAGAAAGG + Intronic
1029025009 7:97407186-97407208 GGGGAAAAGAAGAAGAAAGAGGG + Intergenic
1029085385 7:98007238-98007260 AGGGGAAAGAGCAAGCAGGAGGG + Intergenic
1029364839 7:100110088-100110110 AAGGACAAGCAAAAGCCGGAGGG + Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029447194 7:100620366-100620388 AGGGTGAGGAAGAAGCATGAAGG + Intergenic
1029723550 7:102386898-102386920 AGGGCAAAGAAGATGCAGCATGG - Intronic
1030060997 7:105621219-105621241 ATTGACAAAAAGAAGAAGGAAGG - Intronic
1030108750 7:106008821-106008843 AGGAACAAGGAAGAGCAGGAGGG - Intronic
1030182307 7:106722696-106722718 AGGGAAAAGAAGCAGGATGAGGG - Intergenic
1030476783 7:110044097-110044119 AGGGAGAAGATGGAGCAAGATGG - Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032246504 7:130218067-130218089 AAGGACAAGATGAAGCAGCAGGG + Intergenic
1032640369 7:133759754-133759776 AGGGAAAAGAAGAAGGAGAAAGG + Intronic
1032974495 7:137206772-137206794 AGAGAAAAGAAAAAGAAGGAAGG - Intergenic
1033062047 7:138118839-138118861 AGGGGAAAGAAAAAGAAGGAGGG + Intergenic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033649875 7:143332700-143332722 TGGGAGAGGAAGAAGCAGAAAGG - Intronic
1033832587 7:145271469-145271491 AGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1033863098 7:145653691-145653713 AGGAAAAAGAAGTAGGAGGAAGG - Intergenic
1033899414 7:146116740-146116762 GGGGAGAAGAGGAAGCGGGAGGG + Exonic
1034109190 7:148520022-148520044 AGGGACAACTCGAAGCAGGGAGG - Intergenic
1034453272 7:151149287-151149309 AGGGACAGGAGGCAGAAGGATGG + Intronic
1034688209 7:152992621-152992643 AGGGGAAAGAATGAGCAGGAGGG - Intergenic
1034864789 7:154631845-154631867 AAGTTCAACAAGAAGCAGGAGGG + Intronic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035745291 8:1958118-1958140 AGGGGCAAGAAGCTGCACGAAGG - Exonic
1036497628 8:9283839-9283861 AGGGAGAGGAAGAAGCTGGAAGG - Intergenic
1037094803 8:14972977-14972999 AGGCACACAAAGAAGGAGGAAGG - Intronic
1037514114 8:19612511-19612533 AGGCCCAAGAAAAAGGAGGAGGG + Intronic
1037568836 8:20141556-20141578 AAGGGGAAGAAGAAGCAGGGAGG + Intergenic
1037704548 8:21308193-21308215 ATTGACAGGAAAAAGCAGGAAGG + Intergenic
1038022311 8:23560889-23560911 AGGGGAAAGAGCAAGCAGGAGGG + Intronic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038413832 8:27378757-27378779 GGGGATAAGATGAAGCAGGTGGG - Intronic
1038795226 8:30703747-30703769 AGGAGAAAGAAGAAGAAGGAAGG + Intronic
1039108229 8:34012838-34012860 AGGGAAAAGAGCAAGCAGAAGGG + Intergenic
1039294400 8:36133534-36133556 TAGGAAAAGAAGAAGCATGAAGG - Intergenic
1040292527 8:46132750-46132772 AGAGAAGAGAAGAAGCAGGAAGG - Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041386835 8:57313153-57313175 GGGGTCAAGAGGAGGCAGGAAGG - Intergenic
1042069470 8:64915018-64915040 AGGGAAAGAAAGAGGCAGGAGGG + Intergenic
1042120399 8:65481259-65481281 AGGAAGAAGAAGAAACAGGTGGG - Intergenic
1042205975 8:66330040-66330062 AGGGACATCGAGAAGCAGGTTGG - Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042949804 8:74189211-74189233 AGGAAAAAGAAGAAGAAAGAAGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1044405189 8:91818602-91818624 GGAGGCAAGCAGAAGCAGGATGG + Intergenic
1044714270 8:95086561-95086583 AGAGACAAGAGGAAGGAGGGAGG - Intronic
1044717338 8:95112696-95112718 AGGGACAGGAGGGAGCAGGATGG - Intronic
1044785691 8:95789873-95789895 AGGAAAAGGAGGAAGCAGGAGGG - Intergenic
1045174841 8:99711323-99711345 AGGGACAAAAAGGACCAGGCAGG + Intronic
1045554423 8:103201675-103201697 AGAGACAGGGAGAAGCAGCAAGG + Intronic
1046025766 8:108721793-108721815 AGGGGCAAGGAGAAACAGAAAGG - Intronic
1046221252 8:111218429-111218451 AGGGAAAGGAAAAAGAAGGAAGG - Intergenic
1046339049 8:112827426-112827448 ATGGACAAGAAAAGGCAGGCTGG - Intronic
1046389887 8:113556828-113556850 AGGGCCAAGAAAGAGCAAGAGGG + Intergenic
1046476367 8:114749892-114749914 AGGGAAAAGTGTAAGCAGGAGGG - Intergenic
1046558452 8:115806845-115806867 AGGAAGAAGAATAAGAAGGAAGG + Intronic
1046644781 8:116774265-116774287 AGGGATAAGAAGTAGCTGTAGGG - Exonic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1046897396 8:119487699-119487721 AGGTAGAAGAAAAACCAGGAGGG - Intergenic
1047127082 8:121974513-121974535 AGGAAAAAGAAGAAGAAGGAAGG - Intergenic
1047248814 8:123166517-123166539 AGGACCCAGAAGAAGAAGGAAGG + Intergenic
1047574334 8:126136312-126136334 AGTGACAACAGCAAGCAGGAAGG + Intergenic
1047688680 8:127328612-127328634 AGGGACAAGAATAATCAGAAAGG - Intergenic
1047690888 8:127353439-127353461 AAGGAAAGGAAGACGCAGGAAGG + Intergenic
1048068363 8:130995675-130995697 AAGGATAAGAAGAATCAGCAAGG - Intronic
1048165928 8:132061386-132061408 AGGGACAGAGAGAAGGAGGAAGG - Intronic
1048268221 8:133005942-133005964 AGGGAGAAGATGGAGTAGGAGGG - Intronic
1048590914 8:135820140-135820162 AGGGAAAAGAAAAAGAAGCAAGG - Intergenic
1048597685 8:135883631-135883653 AGACAGAAGAAGAAGCTGGAAGG - Intergenic
1048895112 8:138985207-138985229 AGGAACTAGAAAAAGCAGGCAGG + Intergenic
1048994674 8:139786895-139786917 AGGGTCAGAAAGGAGCAGGAGGG + Intronic
1049346333 8:142141082-142141104 AGGAGGAAGAGGAAGCAGGAGGG - Intergenic
1049632431 8:143665798-143665820 AGGGACAGGAAGAAGGTGGGTGG + Intergenic
1049825789 8:144666932-144666954 AGGGACAGGACCAAGGAGGAGGG - Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050092721 9:2031711-2031733 GGGGCCAAGGAGAAGCAGGATGG - Intronic
1050367977 9:4890112-4890134 TGGGAAAAAAAGAAGCAGGGAGG - Intergenic
1050475918 9:6040989-6041011 AAGGAAAAGAGGAAGAAGGAAGG - Intergenic
1050785643 9:9398106-9398128 AGGGAGAAAGAGAAGCAGGGAGG - Intronic
1051014828 9:12462012-12462034 AAGGAAAAGAGCAAGCAGGAGGG - Intergenic
1051497703 9:17743522-17743544 AGGGAAAGGAAGAAGGAGGGAGG - Intronic
1051564322 9:18479819-18479841 AGGGAAAAGTACAAGTAGGAAGG + Intronic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052462211 9:28779891-28779913 AGGGATAGTAAGAAGCAGGGAGG - Intergenic
1052968447 9:34361154-34361176 AGGGAAGAAAAGAGGCAGGAGGG + Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053174086 9:35909893-35909915 AGGGACATGAGGAGGGAGGAAGG - Intergenic
1053190732 9:36064763-36064785 AGGGAGAACAAGAAGAAGAATGG - Intronic
1053210137 9:36220590-36220612 GGTGACCACAAGAAGCAGGAGGG - Intronic
1053306530 9:36988016-36988038 AGCGAGAAGATGAAGAAGGAGGG + Intronic
1054452851 9:65412685-65412707 AAGGACAAGGAGAAGCAGTGTGG - Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1054747362 9:68868245-68868267 AGGATAAAGAAGAAGGAGGATGG + Intronic
1054792043 9:69265536-69265558 AGGGAAAAGGACAAGCAGGAGGG + Intergenic
1054965622 9:71023826-71023848 AGGGAAGGGAAGATGCAGGAGGG + Intronic
1055080256 9:72261704-72261726 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
1055269741 9:74544567-74544589 AGGGAGAAGAATAGGCAAGAAGG - Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055903549 9:81267863-81267885 AGAGACAAGAACAAGGAGGTGGG - Intergenic
1056662340 9:88553464-88553486 AGAGACAAGGAGAAGGAGGGTGG - Intronic
1057169088 9:92950114-92950136 AAGGATAAAAAGAAGCAGGTGGG + Intronic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1059266114 9:113032613-113032635 AGGGAGCAGAAGATGAAGGAAGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059484945 9:114619662-114619684 AGTGAGAACAAGAAGCAAGAAGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061242443 9:129382496-129382518 AGGCACCAGGAGAAGCAGGGAGG - Intergenic
1061264007 9:129495335-129495357 AGGGACAGGAAGAAGGGTGAGGG - Intergenic
1061278942 9:129586096-129586118 TGGGACCCAAAGAAGCAGGAGGG - Intergenic
1061368274 9:130183770-130183792 AGGGAAAAGAAAAGGAAGGAAGG - Intronic
1061409738 9:130413643-130413665 AGGGACAAAAAGAAACACCAGGG - Intronic
1061865742 9:133491023-133491045 AGTGAGAAGGAGAAGCTGGAGGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062097919 9:134712292-134712314 GGGGACAGGAAGAAGGGGGAAGG - Intronic
1062291766 9:135798512-135798534 GGGGACAGGAGGAGGCAGGAGGG - Intergenic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203363548 Un_KI270442v1:238053-238075 AGGGACAAGGGGAAGAGGGAAGG + Intergenic
1185642917 X:1598343-1598365 GGGGACAAGGAGGAGCAGGCCGG - Intronic
1185702977 X:2245272-2245294 AGGGACAACTGGAAGCAGGGAGG - Intronic
1185714582 X:2330715-2330737 AGGGGAAGGAAGAAGTAGGAGGG + Intronic
1185803618 X:3035813-3035835 AGGGATAAGAAATAGCAGAATGG - Intergenic
1185862523 X:3592438-3592460 AAGGGCAAGAAGAAGAGGGAGGG + Intergenic
1185868063 X:3640165-3640187 AGGGGCAAGCAGAAGAAAGAAGG + Intronic
1186225585 X:7395867-7395889 AGCAAGAAGAAGAAGGAGGAAGG - Intergenic
1186236179 X:7513421-7513443 ATGGACAAGAGGAAACATGACGG + Intergenic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186530291 X:10288360-10288382 AGGAGCAAGAAGAAAAAGGATGG - Intergenic
1186539557 X:10386610-10386632 ATGGACAAGAAGAAGAAGAAGGG + Intergenic
1186594858 X:10970007-10970029 AGGTATAAGAAGAACAAGGAGGG - Intergenic
1187337826 X:18396160-18396182 AGGGACTAGCAGCATCAGGAAGG - Intergenic
1187783871 X:22862157-22862179 AGGGAAAAGAGGAAGGGGGAAGG + Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188103240 X:26116792-26116814 TGTGACAAGAAGAAACTGGATGG - Intergenic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189052935 X:37665385-37665407 AGGCCCAAGATGAAGCAGGGAGG - Intronic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189204780 X:39228325-39228347 AGGGACAGGAAGGAAAAGGAAGG + Intergenic
1189216660 X:39330930-39330952 AAAGAGAAGAAGAAGCAGGGAGG + Intergenic
1189363481 X:40370660-40370682 AGGAGCAACCAGAAGCAGGAAGG + Intergenic
1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG + Intergenic
1190100761 X:47521242-47521264 AGGGACAAGATGAAAGAGAAAGG - Intergenic
1190966498 X:55305993-55306015 AAGGGCTAGAAGAAGCAGGGTGG - Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1192057637 X:67788425-67788447 AAGCACAACAAGAAGCAGGTAGG + Intergenic
1192121137 X:68457099-68457121 AAGTAAAAAAAGAAGCAGGATGG + Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1194256221 X:91638236-91638258 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1194624701 X:96214352-96214374 GAGGGCAAGATGAAGCAGGATGG + Intergenic
1194975593 X:100393433-100393455 AGAGAGAGAAAGAAGCAGGAGGG - Intronic
1195128568 X:101832462-101832484 AGGGCCAAGAAGATGGAGGCGGG - Intronic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195317726 X:103695101-103695123 AGAGGCAAGAAGGACCAGGAAGG - Intergenic
1195336230 X:103857513-103857535 GGTGACAAGAAGAAGAAGGCGGG + Intergenic
1195829172 X:109036628-109036650 AGGTGCAAGAAGAAGCATGTAGG + Intergenic
1196313858 X:114199645-114199667 AGGAAAAAGAAAAAGAAGGAGGG + Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196939454 X:120761048-120761070 AGGGAAGGGAAGAAGAAGGAAGG - Intergenic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198557762 X:137813976-137813998 AGAGATAAGAACAAGCAGGATGG + Intergenic
1199299868 X:146200521-146200543 AGATTCAGGAAGAAGCAGGAAGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199751592 X:150824495-150824517 AGAAAGAAGAAGAAGAAGGAAGG + Intronic
1200088606 X:153624024-153624046 AGGAGCTGGAAGAAGCAGGAAGG + Intergenic
1200296824 X:154928385-154928407 AGGGACAAGAAGGAGCAATGGGG - Intronic
1200395047 X:155980724-155980746 AGGGACAACTTGAAGCAGGGAGG - Intergenic
1200574950 Y:4877520-4877542 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1201344333 Y:12966578-12966600 AGGCACCAGAAGAAGCAATAAGG - Intergenic