ID: 1179239178

View in Genome Browser
Species Human (GRCh38)
Location 21:39573847-39573869
Sequence ATTGTATCTTGGAGGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179239178 Original CRISPR ATTGTATCTTGGAGGCTCAG AGG Intronic
901197929 1:7450587-7450609 ATTGAATCTTGCAGGCAGAGCGG - Intronic
907653765 1:56321660-56321682 ATGGAAACTTTGAGGCTCAGAGG - Intergenic
907952073 1:59193329-59193351 ATTGTATCTTGGAGGTTCTGTGG + Intergenic
911710956 1:101072432-101072454 ATTGTATCTGGCAGACTGAGAGG + Intergenic
913494218 1:119413095-119413117 AGTGTCTCTTGGAGTCTGAGTGG - Intergenic
922018565 1:221678526-221678548 ATTGCTTATTGGAGGCTCTGGGG - Intergenic
922372253 1:224923271-224923293 ATTCTATCTTGGAAGCACTGTGG - Intronic
922789400 1:228302765-228302787 ATGGTAGATTGGAGGTTCAGAGG + Intronic
923320375 1:232826642-232826664 AATGGATTTTGGAGACTCAGGGG - Intergenic
1062837422 10:644832-644854 ATTGTATGTCTGAGGCCCAGGGG - Intronic
1063795349 10:9508121-9508143 ATTGGAGGTTGGAGGCTGAGAGG + Intergenic
1069131942 10:64715881-64715903 AATGTATTTATGAGGCTCAGTGG + Intergenic
1069660797 10:70122245-70122267 AGGGCATCTTGGAGGTTCAGGGG - Intronic
1070224087 10:74482627-74482649 ACTGTATTTTACAGGCTCAGAGG - Intronic
1071889949 10:89993496-89993518 ATTGGATTTTGGGGACTCAGGGG - Intergenic
1072485007 10:95846615-95846637 AGTGGAGCTTTGAGGCTCAGTGG - Intronic
1074704631 10:116120020-116120042 ATTGTATCTTGGAGGCCTGGGGG - Intronic
1076450159 10:130551648-130551670 ATTGTGCTTTGGAGCCTCAGGGG + Intergenic
1076658149 10:132037718-132037740 AGTGTCTCCAGGAGGCTCAGCGG + Intergenic
1079355186 11:19724706-19724728 ATTCTATGTATGAGGCTCAGAGG + Intronic
1079536142 11:21517586-21517608 ATTGAATCATAGAGGCACAGAGG - Intronic
1080228910 11:29994114-29994136 ATGGTATCTTGGGGTCTTAGGGG - Intergenic
1081831732 11:46120776-46120798 TTTGTCTCTGGGAGGATCAGGGG - Intronic
1085080903 11:73633438-73633460 AATGTTTCTGGGAGGCTCACTGG + Intergenic
1087403781 11:97703071-97703093 ATTGTATATTTGAGGCCCTGAGG - Intergenic
1088196456 11:107279373-107279395 ATTTTATGATGGAGCCTCAGTGG - Intergenic
1090543674 11:127737555-127737577 ATTGTAACTTGGAGGCTTTCTGG - Intergenic
1094350000 12:29514065-29514087 ACTGTATCTTGGTGGATGAGTGG + Intronic
1098772675 12:74574289-74574311 ATTGGGTCTTGGTGTCTCAGGGG - Intergenic
1098802351 12:74977287-74977309 AATGTATCATGGACGTTCAGAGG - Intergenic
1098898387 12:76087612-76087634 ATTGTAGCCTGGAGGCTTAGAGG + Intergenic
1100210690 12:92395539-92395561 ATTTCTTCTTGGAGTCTCAGAGG + Intergenic
1100233597 12:92634909-92634931 ATGCTCTCTTGAAGGCTCAGGGG + Intergenic
1101302255 12:103495087-103495109 ATTGAATCTTGGAAGACCAGAGG - Intronic
1101937189 12:109067950-109067972 ACTTTACCTTGGAGGCCCAGAGG + Intronic
1102939478 12:116926611-116926633 ATTGTAATTAGAAGGCTCAGGGG - Intronic
1103405990 12:120675786-120675808 ATTGTATCAGGCAGGCACAGTGG + Intergenic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1105258009 13:18757635-18757657 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1105262960 13:18793345-18793367 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1106032424 13:26015398-26015420 ATTGTATGTTGGTGGCTCACAGG - Intronic
1107372965 13:39772281-39772303 AATATATTCTGGAGGCTCAGAGG - Intronic
1108298226 13:49047015-49047037 ATTGGATTTTGGGGACTCAGGGG - Intronic
1108498608 13:51048377-51048399 ATTATATCTTGCTGGGTCAGTGG - Intergenic
1111730499 13:92070274-92070296 ATTTTTTATTGGAGGCTCTGAGG - Intronic
1114874195 14:26695323-26695345 AATGTATCTTGGATGCTCACTGG - Intergenic
1115900658 14:38143845-38143867 ATTTTTTCTTGGTGACTCAGAGG - Intergenic
1119685130 14:76625242-76625264 ATTTTACCTTTGAGGCTCAGTGG + Intergenic
1121659663 14:95625335-95625357 ATTTTATCTTCAAGGCACAGAGG + Intergenic
1124525081 15:30443395-30443417 ATTTTTTATTGGAGGCTCTGAGG - Intergenic
1124773573 15:32564318-32564340 ATTTTTTATTGGAGGCTCTGAGG + Intergenic
1127629041 15:60808999-60809021 ATTGGACTTTGGAGACTCAGAGG + Intronic
1128567343 15:68710232-68710254 ACTGCATCTGGGAGGCTGAGGGG - Intronic
1129101066 15:73264421-73264443 ATTCTATCTTTCAAGCTCAGGGG - Intronic
1132460958 16:54291-54313 ATTGTATTTAGGGGGCTCGGGGG + Intronic
1138697709 16:58830998-58831020 AATGTCTCTTGGAATCTCAGAGG + Intergenic
1139493467 16:67299663-67299685 ATTGTACCGAGGAGGCTCAGAGG + Intronic
1139946833 16:70647570-70647592 ACTGGATCTTGGAGACTGAGGGG - Intronic
1141496367 16:84413157-84413179 AATGGGTCTTGGAGACTCAGAGG - Intronic
1141887553 16:86902980-86903002 ATTGTATTTTGAAGGACCAGAGG - Intergenic
1142425884 16:90002078-90002100 ATTATATTTTTGAGGCTCCGAGG - Intergenic
1142788713 17:2246089-2246111 ATTGTAAATTGGTGGCTCATGGG - Intronic
1143926077 17:10371738-10371760 ATTGCAGCTTGGATGCTTAGGGG + Intronic
1151052817 17:70997968-70997990 TTTGTTTCTTTGAAGCTCAGTGG + Intergenic
1152366249 17:79858269-79858291 ATTGTATCTTGCACGTTCAGGGG - Intergenic
1154224744 18:12493143-12493165 ATTCTTTCATGGAGGCTCCGTGG + Exonic
1154411152 18:14142934-14142956 AATGGCTCTTGGAGGCTCAAGGG + Intergenic
1157219503 18:45817093-45817115 AATGAATTTTGGAGACTCAGGGG + Intergenic
1157715240 18:49880794-49880816 ATTGGATCATGTAGCCTCAGTGG - Intronic
1158968040 18:62640268-62640290 ATTGGATTTTGGGGCCTCAGGGG + Intergenic
1159553068 18:69917197-69917219 ATTTTATCCTGGAGGCTTTGGGG - Intronic
1164871446 19:31647695-31647717 ATTGGATCATGGAGGGTGAGGGG - Intergenic
1164928147 19:32147349-32147371 ATTGGACTTTGGAGACTCAGGGG - Intergenic
1166990563 19:46690212-46690234 ATTGTAGCCAGGAGGCTGAGTGG - Intronic
925779834 2:7372080-7372102 ATTGGTTCTTTGTGGCTCAGAGG - Intergenic
926045870 2:9709186-9709208 ATTGTATATTGAAGGCTCTCAGG - Intergenic
926860055 2:17300296-17300318 ACTGTATTTTGGAGGCTCTGTGG + Intergenic
930345348 2:50173092-50173114 ATTGTATCTTGTAGTCCAAGAGG + Intronic
931954184 2:67398863-67398885 ATTGAGTCTTGGAGGCTTTGGGG - Intronic
934493137 2:94775892-94775914 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
934493577 2:94779100-94779122 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
937531104 2:122828504-122828526 ATTGCATCTAGGAGTGTCAGGGG + Intergenic
942539628 2:177002202-177002224 ATTCCTTCCTGGAGGCTCAGGGG + Intergenic
943956545 2:194199206-194199228 ATTATCTTTTGGAGGCTCATAGG - Intergenic
945217100 2:207445323-207445345 ATTCTTTTTTGGAGGCTCTGGGG + Intergenic
1169057744 20:2637414-2637436 AATGGGTCTTTGAGGCTCAGAGG - Intronic
1170647655 20:18211343-18211365 AATGGATCTTGGAGGATCTGTGG - Intergenic
1171883816 20:30637083-30637105 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1175386180 20:58596854-58596876 AATGTATATTGAAGACTCAGAGG - Intergenic
1175397207 20:58674448-58674470 CTTGTATCTTTGAGACCCAGTGG + Intronic
1176844002 21:13862665-13862687 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1176846688 21:13881986-13882008 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1176861903 21:14015481-14015503 AATGGCTCTTGGAGGCTCAAGGG - Intergenic
1177870886 21:26572049-26572071 ATTTCGTATTGGAGGCTCAGGGG + Intronic
1177876459 21:26637920-26637942 ATTGGACTTTGGAGCCTCAGGGG - Intergenic
1177904947 21:26964369-26964391 AATGGATCTTTAAGGCTCAGAGG - Intronic
1178349186 21:31859647-31859669 AGTGGATTTTGGAGGCTCAGGGG - Intergenic
1179239178 21:39573847-39573869 ATTGTATCTTGGAGGCTCAGAGG + Intronic
1181425908 22:22838576-22838598 GTCCTATCTTGTAGGCTCAGTGG + Intronic
1183044039 22:35205493-35205515 ATTGGCTCCTGGAGGCTCAGGGG + Intergenic
949940157 3:9148623-9148645 ATTGTAAATTGGAGGCCCCGTGG - Intronic
950075941 3:10187347-10187369 GTTCTTTCCTGGAGGCTCAGAGG - Intronic
950151505 3:10691183-10691205 TTAGTTTCTTGGAGCCTCAGGGG + Intronic
950970407 3:17181082-17181104 AGTGCATAATGGAGGCTCAGTGG + Intronic
956846162 3:73185047-73185069 ATTGTAACTTGGAATTTCAGTGG - Intergenic
957011875 3:75015367-75015389 AATGTAATTTGGTGGCTCAGGGG - Intergenic
960729431 3:120709834-120709856 ATGGGATGTTGGAGGCTCTGTGG - Exonic
961352886 3:126315378-126315400 ACTGTGTCTTGGAAGCTAAGTGG + Intergenic
961633582 3:128318924-128318946 ATTGTACCATGAAGACTCAGAGG + Intronic
962034469 3:131636583-131636605 ATAGTCTCTTGGAAGCTCTGTGG + Intronic
962062187 3:131941033-131941055 ATAGTGTCTTGGAGGATCATAGG - Intronic
962658468 3:137574156-137574178 ATTGTAGCTGGGAGGCCGAGAGG + Intergenic
963091769 3:141488854-141488876 ATTGTCTATTGGAGACTCACTGG + Intronic
965022092 3:163243682-163243704 ACTGTATCTTGAGGCCTCAGTGG + Intergenic
968755231 4:2412259-2412281 AGTGTTTCTTGGAGTCTCAGAGG - Intronic
968971397 4:3797565-3797587 ACTGTCTCTTGGAGATTCAGTGG - Intergenic
971728605 4:30346921-30346943 AGTGTATCTTATAGGCTCTGAGG + Intergenic
976074227 4:81278559-81278581 ATTGTCTCCAGGAGGCGCAGTGG + Intergenic
977823481 4:101502932-101502954 ATTCTTTCTTGGGGGTTCAGGGG + Intronic
980440112 4:132831524-132831546 ATTATATCTGGGAGGATGAGGGG + Intergenic
982627457 4:157785707-157785729 TTTTTATTTTGGAGGCTCATAGG - Intergenic
982894384 4:160899459-160899481 ATTGTTTTTTTGAGGCTCACAGG + Intergenic
984101161 4:175488148-175488170 TTTGTATTTTGGGGGATCAGCGG - Intergenic
990288899 5:54328902-54328924 GTTCTTTCTTGGGGGCTCAGAGG + Intergenic
992907054 5:81356980-81357002 ATTGTGTCATGGAGGCTCCCTGG - Intronic
995933662 5:117482992-117483014 CTTTTATATTGTAGGCTCAGGGG - Intergenic
997794460 5:136794865-136794887 ATTGTATCTTAGAAGCCCATGGG + Intergenic
998293594 5:140942494-140942516 ATGGTATCTAGGAAACTCAGAGG + Intronic
998973258 5:147615543-147615565 ATTGGATCATGGAGGCTTTGAGG + Intronic
1001242748 5:170082548-170082570 ATTTTATATGGGAGGCTCACAGG + Intronic
1003723841 6:8736461-8736483 TTTGAATCTTGGAGGAGCAGAGG + Intergenic
1005277247 6:24232498-24232520 ATTATATTTTAGAGCCTCAGAGG + Intronic
1008358514 6:50586194-50586216 AGTGTATCTGGGAGGGTCACTGG + Intergenic
1008455193 6:51702408-51702430 AGTGTATTTTGGCGACTCAGGGG + Intronic
1008917847 6:56809175-56809197 GTAGTATCTTGGAGGCTTAAGGG - Intronic
1008930150 6:56931164-56931186 AGGGTATTTTGGAAGCTCAGGGG + Intronic
1009487935 6:64248972-64248994 CTTGAATCTTGGAGGCTTGGAGG + Intronic
1012650343 6:101744284-101744306 ATTGGACTTTGGAGACTCAGAGG - Intronic
1013160676 6:107541550-107541572 ACTATATTTTGGAGGCTCAATGG + Intronic
1014003234 6:116388137-116388159 TTTGTAATTTGGAGGCTGAGAGG + Intronic
1016080225 6:139846526-139846548 ATTTTATCTTGTAGGCTTTGTGG + Intergenic
1018540549 6:164874961-164874983 ATTGTATTCTGGAGGGACAGTGG + Intergenic
1021300079 7:18961864-18961886 AGTGTAACTTAGAGGCTAAGAGG - Intronic
1021620223 7:22543884-22543906 ATTGGACTTTGGGGGCTCAGGGG + Intronic
1024943078 7:54782412-54782434 ATTGTATGTCAAAGGCTCAGAGG + Intergenic
1026362589 7:69616407-69616429 ATTGCAGCCTAGAGGCTCAGTGG + Intronic
1026396710 7:69962612-69962634 ATTCTTTCTTTGAGGGTCAGGGG + Intronic
1027736270 7:81936513-81936535 ATTCTCTCTTAGAGGCTCAGAGG + Intergenic
1027834722 7:83226233-83226255 TTTGTATTTTGGAGTCTCAGAGG + Intergenic
1030819702 7:114081512-114081534 ATGGAATCTTGCAGGCTAAGTGG - Intergenic
1033349641 7:140551644-140551666 ATTGAATCTTGAAGCCTCTGTGG + Intronic
1033592907 7:142828811-142828833 ATGGTATCTTGGAAGTTCAGAGG + Intergenic
1033828190 7:145218387-145218409 ATTGGATGCTGCAGGCTCAGAGG - Intergenic
1034502293 7:151458675-151458697 GTTTCTTCTTGGAGGCTCAGAGG + Intergenic
1035852188 8:2931652-2931674 ATTGGATTTTGGGGGCTCAGGGG + Intergenic
1036637487 8:10561732-10561754 ACTGTGTCTTGGAGGCTGAGGGG + Intergenic
1037663479 8:20946089-20946111 CTTATGTCTTGGAGGTTCAGAGG - Intergenic
1040958599 8:53006198-53006220 ATTCTGTCTTGAAGGCACAGAGG + Intergenic
1043451140 8:80367897-80367919 AGTGGATCTTTGAGGCTTAGTGG + Intergenic
1044873978 8:96645791-96645813 AAGGCATATTGGAGGCTCAGGGG - Intronic
1045761262 8:105610611-105610633 ATTGTATATTGGGGGCTCTGTGG + Intronic
1046041817 8:108914733-108914755 ATTGTATCATTGAGGCTCCCTGG - Intergenic
1046076485 8:109318621-109318643 ATTGTTTCTTGTTGGATCAGAGG - Intronic
1048529656 8:135235850-135235872 ATTTTATCTGGGAGGCTGTGTGG - Intergenic
1048834508 8:138505455-138505477 ATTGTCACTAGGAGCCTCAGAGG - Intergenic
1051311211 9:15774932-15774954 ATTGTACTTTGGGGACTCAGGGG + Intronic
1051983930 9:23059344-23059366 ATGGTATAGTGGAGGCTCTGAGG - Intergenic
1052878309 9:33583960-33583982 TTTGTATTTCAGAGGCTCAGGGG + Intergenic
1052879608 9:33593261-33593283 TTTGTATTTCAGAGGCTCAGAGG + Intergenic
1052968628 9:34362771-34362793 GTTATGTCTGGGAGGCTCAGTGG + Intergenic
1053496373 9:38550971-38550993 TTTGTATTTCAGAGGCTCAGAGG - Intronic
1053497221 9:38557021-38557043 ATTGTATCTTGCAGTGTGAGAGG - Intronic
1053497672 9:38560249-38560271 TTTGTATTTCAGAGGCTCAGGGG - Intronic
1053663503 9:40300930-40300952 TTTGTATTTCAGAGGCTCAGGGG + Intronic
1053664009 9:40304830-40304852 TTTGTATTTCAGAGGCTCAGGGG + Intronic
1053664975 9:40311036-40311058 TTTGTATTTCAGAGGCTCAGGGG + Intronic
1053914555 9:42936086-42936108 TTTGTATTTCAGAGGCTCAGGGG + Intergenic
1054375626 9:64447164-64447186 TTTGTATTTCAGAGGCTCAGGGG + Intergenic
1054376137 9:64451064-64451086 TTTGTATTTCAGAGGCTCAGGGG + Intergenic
1054519640 9:66065248-66065270 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1054520605 9:66071455-66071477 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1054521111 9:66075355-66075377 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1057676289 9:97138510-97138532 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1057677141 9:97144730-97144752 TTTGTATTTCAGAGGCTCAGGGG - Intergenic
1057890723 9:98867798-98867820 ATTTCATCTTGGAGGCAAAGAGG + Intergenic
1187493774 X:19777126-19777148 ATTGTCATTTGGAGGCTCAAGGG - Intronic
1188457357 X:30381601-30381623 ATTGGACTTTGGGGGCTCAGGGG - Intergenic
1188832566 X:34917998-34918020 ATTGTGTATTGGAGGATCACTGG + Intergenic
1188909637 X:35830662-35830684 ATTGGACTTTGGAGACTCAGAGG - Intergenic
1189783570 X:44539569-44539591 GTTCCTTCTTGGAGGCTCAGAGG - Intronic
1193006935 X:76630163-76630185 ATTGAACTTGGGAGGCTCAGTGG - Intergenic
1193451170 X:81669807-81669829 AATGGATTTTGGAGGCTCAGGGG - Intergenic
1197184428 X:123570577-123570599 ATAATGTCTTGGAAGCTCAGTGG + Intergenic
1198587398 X:138137658-138137680 ATTAAAGCTTGGAGTCTCAGGGG - Intergenic
1198708410 X:139474968-139474990 AATGTATTTTGGCTGCTCAGAGG - Intergenic
1199081165 X:143578293-143578315 ATTTCAACTTGGAGACTCAGAGG - Intergenic
1201896771 Y:19000173-19000195 ATTGCATCTCTGAGGCTAAGAGG - Intergenic