ID: 1179240697

View in Genome Browser
Species Human (GRCh38)
Location 21:39588613-39588635
Sequence GCAACTAATCCTATTCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1319
Summary {0: 1, 1: 0, 2: 11, 3: 184, 4: 1123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179240692_1179240697 25 Left 1179240692 21:39588565-39588587 CCCATCTTTTATAGTCTCCAATG 0: 1
1: 5
2: 27
3: 141
4: 453
Right 1179240697 21:39588613-39588635 GCAACTAATCCTATTCAAGAGGG 0: 1
1: 0
2: 11
3: 184
4: 1123
1179240690_1179240697 29 Left 1179240690 21:39588561-39588583 CCCTCCCATCTTTTATAGTCTCC 0: 1
1: 3
2: 45
3: 141
4: 470
Right 1179240697 21:39588613-39588635 GCAACTAATCCTATTCAAGAGGG 0: 1
1: 0
2: 11
3: 184
4: 1123
1179240691_1179240697 28 Left 1179240691 21:39588562-39588584 CCTCCCATCTTTTATAGTCTCCA 0: 1
1: 2
2: 34
3: 153
4: 498
Right 1179240697 21:39588613-39588635 GCAACTAATCCTATTCAAGAGGG 0: 1
1: 0
2: 11
3: 184
4: 1123
1179240693_1179240697 24 Left 1179240693 21:39588566-39588588 CCATCTTTTATAGTCTCCAATGT 0: 1
1: 3
2: 32
3: 185
4: 662
Right 1179240697 21:39588613-39588635 GCAACTAATCCTATTCAAGAGGG 0: 1
1: 0
2: 11
3: 184
4: 1123
1179240694_1179240697 8 Left 1179240694 21:39588582-39588604 CCAATGTTTATTAAAGAATATCT 0: 1
1: 0
2: 1
3: 34
4: 514
Right 1179240697 21:39588613-39588635 GCAACTAATCCTATTCAAGAGGG 0: 1
1: 0
2: 11
3: 184
4: 1123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179240697 Original CRISPR GCAACTAATCCTATTCAAGA GGG Intronic
900874181 1:5329851-5329873 GGCACTAATCCCATTCACGAGGG + Intergenic
901941227 1:12663457-12663479 GGCACTAATCCCATTCATGAGGG + Intronic
902154354 1:14472135-14472157 GACACTAATCCCATTCATGAGGG + Intergenic
902605183 1:17565191-17565213 GATACTAATCCCATTCACGAGGG + Intronic
902652897 1:17848228-17848250 GGCACTAATCCCATTCATGAGGG + Intergenic
903558866 1:24212791-24212813 GGCACTAATCCCATTCATGAGGG - Intergenic
903794256 1:25916736-25916758 GGCACTAATCCCATTCATGAGGG + Intergenic
904677041 1:32205114-32205136 GGAACTAAACCTGTGCAAGATGG + Intronic
904868165 1:33599004-33599026 GGCACTAATCCCATTCATGAGGG + Intronic
904869867 1:33609949-33609971 GGAACTAATCCCATTTAGGAGGG - Intronic
905017669 1:34788635-34788657 GGCACTAATCCCATTCAGGAGGG - Intronic
905424266 1:37870550-37870572 GCCACTAATCCCATTCATCAGGG - Intronic
906224420 1:44109582-44109604 CAAACTAATCCTATTCCAGCAGG - Intergenic
906625702 1:47323607-47323629 GGTACTAATCCCATTCATGAAGG - Intergenic
906651848 1:47518325-47518347 GGCACTAATCCCATTCATGAGGG - Intergenic
906672993 1:47671580-47671602 GCACATACTCCTATTCATGAAGG + Intergenic
906830059 1:49021464-49021486 GGCACTAATCCCATTCATGAGGG - Intronic
907082931 1:51641290-51641312 GGAATTAATCCCATTCATGAGGG + Intronic
907617044 1:55936197-55936219 GGCACTAATCCCATTCATGAGGG + Intergenic
907821574 1:57975103-57975125 GGCACTAATCCTATTCATGAGGG - Intronic
907869437 1:58430037-58430059 GGCACTAATCCCATTCAAGAGGG + Intronic
907877126 1:58501861-58501883 GCTACTAATCCTATTCGATCAGG - Intronic
907945394 1:59131389-59131411 GGGACTAATCCTATTCACAAGGG - Intergenic
908158938 1:61387003-61387025 AGCACTAATCCTATTCATGAGGG + Intronic
908176360 1:61559076-61559098 GACGCTAATCCTATTCATGAGGG + Intergenic
908211514 1:61905307-61905329 GCCACTAATCCTATTCTTGAGGG + Intronic
908262016 1:62346390-62346412 GACACTAATCCTATTCATGAGGG - Intergenic
908345312 1:63226441-63226463 GTCACTAATCCTATTCACCAGGG - Intergenic
908584809 1:65556084-65556106 GGCACTAATCCCATTCATGAGGG - Intronic
908810250 1:67974962-67974984 GGCACTAATCCCATTCATGAAGG + Intergenic
908900529 1:68951273-68951295 GGCACTAATCCCATTCATGAGGG - Intergenic
908900826 1:68954583-68954605 GGGACTAATCCCATTCATGAGGG + Intergenic
908949740 1:69545750-69545772 GGCACTAATCCCATTCATGAGGG + Intergenic
908969998 1:69816298-69816320 GGCACTTATCCTATTCATGAAGG + Intronic
909027406 1:70498839-70498861 GCACCTAATCCCAATCATGAGGG - Intergenic
909103437 1:71379389-71379411 GGAGCAAATCCTATTCATGAGGG - Intergenic
909366415 1:74828541-74828563 GGCACTAATCCCATTCATGAGGG + Intergenic
909523660 1:76598163-76598185 GGCACTAATCCTATTCATGAGGG + Intronic
909658318 1:78055226-78055248 GGCACTAATCCTATTCCTGAAGG + Intronic
909714548 1:78692134-78692156 GCACCTAATCCCATTCATGAAGG + Intergenic
909757306 1:79242583-79242605 GCCACTAATTCTATTCAGGAGGG - Intergenic
909758978 1:79265993-79266015 GGTACTAATTCTATTCATGAGGG - Intergenic
909781726 1:79557268-79557290 AGAACTAATCCTATTAACGAGGG + Intergenic
909933671 1:81527390-81527412 GACACTAATCCCATTCATGAGGG - Intronic
910259516 1:85282238-85282260 GCAACAAATACTATTCCAGGTGG + Intergenic
910568094 1:88667856-88667878 GGCACTAATCTTATTCATGAGGG + Intergenic
910676032 1:89817890-89817912 GCCACTAATCCCATTCATGAAGG - Intronic
910984223 1:92989905-92989927 GCACCCAATCTTATTCATGAGGG + Intergenic
911020794 1:93385869-93385891 GTCACTAATCCTATTCATGAGGG - Intergenic
911377544 1:97069578-97069600 GGCACTAATCCCATTCACGAGGG + Intergenic
911431980 1:97801138-97801160 GACACTAATCCTATTCATGTTGG - Intronic
911687286 1:100792074-100792096 TCAACTAATCCCATTCATAAGGG + Intergenic
911885443 1:103291811-103291833 GGCACTAATCCCATTCACGAGGG + Intergenic
912126085 1:106539941-106539963 GCAAATAATCCAATTGAAAATGG - Intergenic
912774369 1:112495985-112496007 GCATCTAATCCCATTCAGGAGGG + Intronic
912841261 1:113041569-113041591 GCCACTAATCCCATTCATGGGGG + Intergenic
913065997 1:115255529-115255551 GGCACTAATCCTGTTCATGAGGG - Intergenic
913144093 1:115972338-115972360 GCACCTAATCCCATTTATGAGGG + Intergenic
913492822 1:119397501-119397523 GTCACTAATCCCATTCATGAGGG + Intergenic
913503350 1:119492244-119492266 GTCACTAATCCCATTCATGAGGG + Intergenic
914017616 1:143834762-143834784 GATACTAATCCTATGCATGAAGG + Intergenic
914077501 1:144369122-144369144 GGCACTAATCCCATTCATGAGGG + Intergenic
914101678 1:144597383-144597405 GGCACTAATCCCATTCATGAGGG - Intergenic
914172408 1:145237662-145237684 GGCACTAATCCCATTCATGAGGG + Intergenic
914297286 1:146340128-146340150 GGCACTAATCCCATTCATGAGGG + Intergenic
914639345 1:149588470-149588492 GGCACTAATCCCATTCATGAGGG - Intergenic
914656226 1:149743294-149743316 GATACTAATCCTATGCATGAAGG + Intergenic
914979065 1:152396731-152396753 ACAAATAATCCTATTAAAAATGG + Intergenic
915012780 1:152704638-152704660 GGCACTAATCCCATTCATGAAGG + Intergenic
915718668 1:157967414-157967436 GGCACTAATCCCATTCATGAGGG - Intergenic
915739444 1:158107377-158107399 AGCACTAATCCTATTCACGAGGG + Intergenic
915923368 1:159995695-159995717 GGAACCAATCCTGTTCATGAGGG - Intergenic
916105301 1:161425537-161425559 GACACTAATCCTATTAATGAAGG - Intergenic
916142850 1:161714149-161714171 GGCACTAATCCTAATCATGAGGG - Exonic
916297440 1:163235383-163235405 GCAAACACTCCTATTCAAAAGGG + Intronic
916490010 1:165293803-165293825 GGCTCTAATCCCATTCAAGAGGG + Intronic
916523235 1:165584714-165584736 GGCACTAATCCTATTAATGAGGG - Intergenic
917141183 1:171837693-171837715 GCCACTAATCCTATTGAATCAGG + Intergenic
917159897 1:172045467-172045489 GGCACTAATCCCATTCATGAGGG + Intronic
917292857 1:173489432-173489454 GTCACTAATCCCATTCACGAAGG + Intergenic
917481211 1:175413808-175413830 GGCACTAATCCCATTCATGAGGG - Intronic
917724558 1:177816359-177816381 GGCACTAATCCCATTCATGAGGG - Intergenic
918041957 1:180919029-180919051 GGCACTAATCCCATTCATGAGGG + Intronic
918192318 1:182187576-182187598 GGTACTAATCCCATTCATGAGGG - Intergenic
918482152 1:184990501-184990523 GACACTAATCCTATTCATGAGGG - Intergenic
918798173 1:188933095-188933117 GGCACTAATCCCATTCATGAGGG + Intergenic
918901149 1:190420099-190420121 AAAACTAAAGCTATTCAAGAAGG + Intronic
919208821 1:194453547-194453569 GCATCTATTCCCATTCATGAGGG + Intergenic
919481359 1:198093886-198093908 GGCACTAATCCCATTCATGAAGG + Intergenic
919569133 1:199223814-199223836 GGCACTAATCCCATTCATGAGGG + Intergenic
919583510 1:199407221-199407243 GGCACTAATCCTATTCATGAGGG - Intergenic
919630650 1:199957181-199957203 GGCACTAATCCCATTCATGAGGG - Intergenic
919814386 1:201428438-201428460 GAAACTAATCATTTTCAAGCTGG + Intronic
920582572 1:207125520-207125542 GGCACTAATCCCATTCATGAGGG - Intronic
920670567 1:208000982-208001004 GACACTAATCCCATTCATGAAGG - Intergenic
920725010 1:208426804-208426826 GACACTAATCCCATTCATGAGGG + Intergenic
920831200 1:209467226-209467248 GACACTAATCCCATTCATGAGGG - Intergenic
920834369 1:209495223-209495245 GGAACTAATCCCATTCATAAAGG + Intergenic
920867090 1:209762279-209762301 GGCACTAATCCCATTCATGAGGG + Intronic
920918355 1:210276898-210276920 GGAACTAATTCCATTCACGAGGG - Intergenic
921033131 1:211351348-211351370 GGCACTAATCCCATTCATGAGGG + Intronic
921108264 1:212006019-212006041 GCAAATAATGCTATTTAAAATGG - Intronic
921113005 1:212056631-212056653 GCAACAAATCCCAATCAAAAAGG + Intronic
921130744 1:212217509-212217531 GACACTAATCCCATTCATGAGGG + Intergenic
921324619 1:213978637-213978659 GAAACTAATCCTATTAAACGTGG - Intergenic
921344966 1:214174190-214174212 GCAAATAATTGTTTTCAAGAGGG - Intergenic
921681791 1:218042175-218042197 GGCACTAATCCCATTCACGAGGG - Intergenic
921892506 1:220367271-220367293 GGCACTAATCCTATCCAGGAGGG + Intergenic
922094751 1:222433800-222433822 AGCACTAATCCTATTCATGAGGG + Intergenic
922346589 1:224701472-224701494 GACACTAATCCCATTCACGAGGG + Intronic
922348574 1:224717357-224717379 GGCACTAATCCCATTCATGAGGG + Intronic
922811814 1:228420163-228420185 GGCACCAATCCTATTCATGAAGG - Intergenic
923517316 1:234708675-234708697 GGTGCTAATCCCATTCAAGAAGG - Intergenic
923767015 1:236901752-236901774 GGCACTAATCCCATTCATGAGGG + Exonic
923961381 1:239088098-239088120 GCAACTAATCCCCTTCATGAGGG + Intergenic
924070153 1:240268876-240268898 GCAAATAACCCTATTGAAAATGG - Intronic
924209334 1:241748541-241748563 GGCACTAATCCCATTCATGAGGG + Intronic
924260343 1:242223199-242223221 GGGACTAATCCCATTCATGAGGG + Intronic
924721652 1:246628669-246628691 GGCACTAATCCCATTCATGAGGG + Intronic
924810191 1:247394207-247394229 GACACTAATACCATTCAAGAGGG + Intergenic
924863506 1:247952421-247952443 GGCATTAATCTTATTCAAGAAGG - Intronic
924872523 1:248064241-248064263 GGCATTAATCTTATTCAAGAGGG - Intronic
1063023541 10:2154967-2154989 GCCACTGATCCTATTCATGGGGG - Intergenic
1063345027 10:5303696-5303718 GGCACTAATCCCATTCATGAGGG - Intergenic
1063728881 10:8672552-8672574 GGCACTAATCCCATTCATGAGGG + Intergenic
1064253623 10:13725875-13725897 ACAAGTAAACTTATTCAAGATGG + Intronic
1064352205 10:14586518-14586540 GGCACTAATCCCATTCATGAGGG - Intronic
1064541206 10:16406792-16406814 GGCACTAATCCCATTCATGAAGG - Intergenic
1064742120 10:18444201-18444223 GGCACTAATCCCATTCATGAGGG - Intronic
1064829874 10:19450904-19450926 GGCACTAATCCCATTCATGAGGG + Intronic
1064856471 10:19773813-19773835 GGCACTAATCCCATTCATGAGGG + Intronic
1064880099 10:20041903-20041925 GACACTAATCCTATTGAATAAGG + Intronic
1064914883 10:20445782-20445804 GGAACTAATCCTGTTCATAAGGG - Intergenic
1064922321 10:20532440-20532462 GGCACTAATCCTATTCATGGGGG - Intergenic
1065711133 10:28519195-28519217 GCACCTAATCTCATTCATGAGGG - Intergenic
1065966841 10:30777606-30777628 GGAACTAATCCCATTCATGCAGG + Intergenic
1065993820 10:31037609-31037631 GCACCTAATCCCATTCACAAGGG - Intergenic
1066177670 10:32926329-32926351 GTTACTAATCCCATTCATGAGGG - Intronic
1066533675 10:36366935-36366957 GGCACTAATCCCATTCATGAAGG - Intergenic
1066551510 10:36563526-36563548 GCACCTAAACCTACTCATGAAGG - Intergenic
1067018540 10:42775508-42775530 GGTACTAATCCCATTCATGAAGG - Intergenic
1067259459 10:44675540-44675562 GACACTAATCCCATTCATGAGGG - Intergenic
1067291886 10:44949753-44949775 AGCACTAATCCTATGCAAGAGGG + Intergenic
1068314853 10:55327126-55327148 GGCACTAATTCTATTCATGAGGG - Intronic
1068386250 10:56331415-56331437 GGTACTAATCCCATTCATGAGGG + Intergenic
1068412077 10:56669205-56669227 GACACTAATCCTTTTCATGAGGG + Intergenic
1068528533 10:58158710-58158732 GGAACTAATCCCATTCATGAGGG - Intergenic
1068660067 10:59614503-59614525 GACACTAATCCCATTCATGAGGG + Intergenic
1069105881 10:64382935-64382957 GGCACTAATCTTATTCATGAGGG - Intergenic
1069109678 10:64430834-64430856 GCAACTAATCCCATTTACAAGGG - Intergenic
1069183155 10:65388797-65388819 GGCACTAATCCTATTCATGAGGG + Intergenic
1069281444 10:66659655-66659677 GCCACTAATCCCATTCATGAGGG - Intronic
1069552934 10:69376976-69376998 TCGACTGATCCTAGTCAAGATGG + Exonic
1069730264 10:70606957-70606979 GGCACTAATCCCATTCATGAAGG - Intergenic
1069747562 10:70725616-70725638 GACACTAATCCCATTCAGGAGGG + Intronic
1070577197 10:77688045-77688067 GTAATTAATCCCATTCATGAAGG - Intergenic
1070654085 10:78259150-78259172 GACACTAATCCCATTCATGAGGG - Intergenic
1070944116 10:80374631-80374653 GGCACTAATCCCATTCATGAGGG + Intergenic
1071401940 10:85281544-85281566 AGCACTAATCCTATTCATGAGGG + Intergenic
1071746767 10:88428883-88428905 GAATCTATTTCTATTCAAGATGG + Intronic
1071804477 10:89102189-89102211 GTCACTAATCCCATTCATGAAGG - Intergenic
1071966932 10:90860777-90860799 GGTACTAATCCCATTCAGGAGGG + Intergenic
1072716387 10:97755553-97755575 GGCACTAATCCCATTCACGAGGG + Intronic
1073078856 10:100843852-100843874 GTAACTAATCATTTTCAAAAAGG + Intergenic
1073640731 10:105250171-105250193 GGCACTAATCCCATTCATGAGGG + Intronic
1074105288 10:110384728-110384750 GGAACTAATCCCATTCACAAGGG + Intergenic
1074142915 10:110691059-110691081 GATACTAATCCCATTCAAGAGGG - Intronic
1074252253 10:111762777-111762799 GACACTAATCTCATTCAAGAGGG - Intergenic
1074614078 10:115048840-115048862 GGCACTAATCCCATTCATGAGGG - Intergenic
1074682307 10:115919889-115919911 GGCACAAATCCTATTCATGAGGG + Intronic
1075003542 10:118814895-118814917 GTCACTAATCCCATTCATGAGGG + Intergenic
1075072834 10:119330432-119330454 AGCACTAATCCTATTCATGATGG + Intronic
1075163199 10:120042346-120042368 GGAACTAATCCCATTCATGAGGG + Intergenic
1075196392 10:120362954-120362976 GGCACTAATCCCATTCACGAGGG - Intergenic
1075272763 10:121067711-121067733 GGCACTAATCCCATTCATGAGGG + Intergenic
1075488035 10:122842773-122842795 GCAAATAATCCAATTTAAAATGG + Intronic
1075943771 10:126414058-126414080 GACACTAATCCCATTCATGAAGG + Intergenic
1075987451 10:126799982-126800004 GATACTAATCCCATTCATGAGGG + Intergenic
1076058570 10:127395377-127395399 GCCACTCATCCCATTCATGAGGG + Intronic
1076130965 10:128013646-128013668 GGCACTAATCCCATTCAAGAGGG - Intronic
1077646785 11:3932337-3932359 GGCACTAATTCCATTCAAGAGGG - Intronic
1077862329 11:6194185-6194207 GACACTAATCCCATTCATGAGGG + Intergenic
1077993587 11:7433638-7433660 GGCACTAATCCCATTCATGAAGG - Intronic
1078540339 11:12208036-12208058 ACAGCTCATCCTATTCAAGGTGG + Exonic
1078815729 11:14820691-14820713 GGAACTAATCCCATTCATGAAGG - Intronic
1078931629 11:15916623-15916645 GGTACTAATCCCATTCATGATGG - Intergenic
1078972544 11:16430522-16430544 AGCACTAATCCCATTCAAGAGGG - Intronic
1079018887 11:16892998-16893020 GACACTAATCCCATTCATGAGGG + Intronic
1079819146 11:25103399-25103421 ACACCTAATCCCATTCACGACGG - Intergenic
1079907137 11:26262687-26262709 GATACTAATCCTATTAATGAGGG - Intergenic
1079938647 11:26649930-26649952 GCAAATAATGCTATGGAAGAGGG - Intronic
1080062857 11:27975362-27975384 GGCACTAATCCCATTCATGAGGG - Intergenic
1080260533 11:30344985-30345007 GGCACTAATCCCATTCATGAAGG + Intergenic
1080406123 11:31980920-31980942 GGCACTAATCCCACTCAAGAGGG + Intronic
1080412100 11:32035366-32035388 GGCACTAATCCCATTCATGAGGG + Intronic
1080420926 11:32109856-32109878 GGCACTAATCCTATTCATGAGGG - Intergenic
1080663271 11:34314427-34314449 GCAACAAATACTATTGAACATGG - Intronic
1080743945 11:35091018-35091040 GACACTAATCCTATTGATGAGGG - Intergenic
1080823937 11:35832246-35832268 GGCACTAATCCCATTCATGAGGG - Intergenic
1080878062 11:36294720-36294742 GGCACTAATCCCATTCATGAGGG + Intergenic
1080942379 11:36934017-36934039 ATCACTAATCCTATTCATGAGGG + Intergenic
1080961583 11:37167380-37167402 GACACTAATCCCATTCATGAGGG + Intergenic
1081301971 11:41463558-41463580 GGCACTAATCCTACTTAAGAGGG - Intergenic
1081418259 11:42841252-42841274 GGCACTAATCCCATTCATGAGGG - Intergenic
1081658154 11:44871356-44871378 GGCACTAATCTTATTCATGAGGG + Intronic
1082782167 11:57296129-57296151 GACACTAATCCCATTCATGAGGG - Intergenic
1083085390 11:60137819-60137841 ACAAATAATCCAATTAAAGATGG + Intergenic
1083128298 11:60595882-60595904 GAAACATATCATATTCAAGAGGG + Intergenic
1083541962 11:63517721-63517743 GGCACTAATCCCATTCATGAAGG - Intergenic
1084080923 11:66824213-66824235 GGCACTAATCCCATTCATGAAGG - Intronic
1084092856 11:66890149-66890171 GCTTCTAATCCCATTCAGGAAGG - Intronic
1084654962 11:70509749-70509771 GGCACTAATCCCATTCACGAAGG - Intronic
1084736847 11:71110921-71110943 GACACTAATCCCATTCACGAGGG - Intronic
1085636813 11:78165407-78165429 GGAACAAATCCCATTCATGAGGG + Intergenic
1086937510 11:92761307-92761329 GGCACTAATCCCATTCATGAGGG + Intronic
1086975344 11:93125949-93125971 GGCACTAATCCCATTCATGAGGG + Intergenic
1087092306 11:94286251-94286273 GGCACTACTCCTATTCATGAGGG + Intergenic
1087160780 11:94946170-94946192 GCATCTAATTCCATTCATGAGGG + Intergenic
1087426622 11:97995829-97995851 GGAACTAATCCCATTCATAAAGG + Intergenic
1087477713 11:98657921-98657943 GGAACTAATCCTATTCATGAAGG - Intergenic
1087629834 11:100637029-100637051 GGCACTAATCCCATTCATGAAGG - Intergenic
1087726451 11:101723059-101723081 GGTACTAATCCCATTCATGAGGG - Intronic
1087883932 11:103454977-103454999 GCAAGGAATCGTATTTAAGATGG + Intronic
1088427748 11:109723497-109723519 GGCACTAATCCCATTCATGAAGG + Intergenic
1088748988 11:112827996-112828018 GCACCTAATCCCATTCATGAGGG - Intergenic
1088840682 11:113625055-113625077 GTCACTAATCCCATTCATGAGGG + Intergenic
1089001592 11:115056415-115056437 GAAACTAATCCCATTTATGATGG - Intergenic
1089658786 11:119972132-119972154 GGCACTAATCCCATTCAGGAGGG - Intergenic
1089859529 11:121576407-121576429 GACACTAATCCTATTCATGAGGG + Intronic
1089878360 11:121747629-121747651 GCACCGAATCCCATTCATGAGGG - Intergenic
1090181202 11:124701574-124701596 GCAAATAATCCAATTAAAAATGG - Intergenic
1090346444 11:126075445-126075467 GCCTCTACTCCTATTCATGAGGG - Intergenic
1090877984 11:130807941-130807963 GTCACTAATCCTATTCACGAGGG + Intergenic
1090899988 11:131020968-131020990 GGCACTAATCCTATTCATGAGGG - Intergenic
1091060293 11:132454635-132454657 GCCACAAACCCTATTCAACATGG - Intronic
1091756071 12:3052654-3052676 GGCACTAATCCTGTTCATGAGGG - Intergenic
1091924542 12:4334352-4334374 GACACTAATCCTGTTCATGAGGG + Intronic
1092046975 12:5438371-5438393 CCAATTAATCCTATTTGAGAAGG - Intronic
1092311122 12:7354810-7354832 GGCACTAATCCCATTCATGAGGG + Intronic
1092646780 12:10583155-10583177 GACACTAATCCCATTCATGAGGG - Intergenic
1092696343 12:11175816-11175838 GGCACTAATCCCATTCACGAGGG - Intergenic
1092932724 12:13332105-13332127 GGCACTAATCCCATTCATGAAGG + Intergenic
1093149341 12:15603052-15603074 GGCACTGATCCTATTCATGAAGG + Intergenic
1093207576 12:16268959-16268981 GGAACTAATCCCATTCAGAAGGG - Intronic
1093241948 12:16687479-16687501 GGTACTAATCCCATTCAGGAGGG + Intergenic
1093473856 12:19533776-19533798 GACACTAATCCTATTCATGAGGG + Intronic
1093480331 12:19597859-19597881 AGAACTAATCCCATTCATGAGGG - Intronic
1093641641 12:21533983-21534005 GGCAGTAATCCTATTCATGAGGG + Intronic
1093730068 12:22557031-22557053 GGTACTAATCCCATTCATGAGGG - Intergenic
1093794677 12:23297348-23297370 GTCACTAATCCAATTCATGAGGG + Intergenic
1093939043 12:25032763-25032785 GACACTAATCCCATTCATGAGGG + Intronic
1094123670 12:27000107-27000129 GCCACTAATCCCATTCATGAGGG + Intronic
1094396668 12:30014145-30014167 GAAACTAATTCCATTCATGAGGG - Intergenic
1094442865 12:30498616-30498638 GACACTAATCCTATTCATGTGGG - Intergenic
1094628565 12:32149844-32149866 GGCACTAATCCCATTCATGAAGG + Intronic
1095527329 12:43142798-43142820 GCCACTAATCCCATTCATGAGGG - Intergenic
1095563408 12:43592056-43592078 GGCACTAATCCCATTCATGAGGG + Intergenic
1095643439 12:44512140-44512162 GCAAGTAATCCAATTAAAAATGG + Intronic
1095717298 12:45360404-45360426 GCACCTAATCCCATTCATGAAGG + Intronic
1095924889 12:47568608-47568630 GGTACTAATCCCATTCATGAGGG + Intergenic
1096055360 12:48646255-48646277 GGCACTAATCCCATTCATGAAGG - Intergenic
1097299824 12:58006297-58006319 GGGACCAATCCTATTCATGAGGG + Intergenic
1097325568 12:58272490-58272512 GTACCTAATCCCATTCATGAGGG + Intergenic
1097644879 12:62224498-62224520 GGCACTAATCTTATTCATGAGGG + Intronic
1097724781 12:63063051-63063073 GGCACTAATCCCATTCATGAGGG + Intergenic
1097849557 12:64398103-64398125 GGCACTAATCCTATTCATGAGGG + Intergenic
1098269389 12:68755147-68755169 GGGACTAATCCCATTCATGAAGG + Intronic
1098300440 12:69048586-69048608 GGCACTAATCCCATTCATGAGGG + Intergenic
1098316409 12:69198067-69198089 GTTACTAATCCCATTCATGAGGG - Intergenic
1098599792 12:72317581-72317603 GACACTAATCCCATTCATGAAGG + Intronic
1099054387 12:77820455-77820477 GCACCTAATCCCATTCATGAGGG + Intergenic
1099231808 12:80035386-80035408 GGCACTAATCCTATTCGTGAGGG + Intergenic
1099438477 12:82671055-82671077 GGCACTAATCATATTCATGAGGG - Intergenic
1099482316 12:83183302-83183324 GGCACTAATCCAATTCATGAGGG + Intergenic
1099643502 12:85320827-85320849 GCCACTAATCTCATTCATGAGGG + Intergenic
1099753865 12:86814727-86814749 GGCACTCATCCCATTCAAGAGGG - Intronic
1099918582 12:88927827-88927849 GGCACTAATCCTATTTATGAAGG + Intergenic
1100122917 12:91390049-91390071 CACACTAATCCTATTTAAGAAGG + Intergenic
1100245520 12:92752961-92752983 GACACTAATCCCATTCAAGAGGG + Intronic
1101159859 12:101962444-101962466 GTAATTAATCCCATTCATGAGGG + Intronic
1101178403 12:102181956-102181978 GGCACTAATCCTGTTCATGAAGG + Intronic
1101294864 12:103411583-103411605 GGAACTAATCCTATTCATGAGGG - Intronic
1101412029 12:104477566-104477588 GGCACTAATCCCATTCATGAGGG - Intronic
1101919908 12:108924050-108924072 GACACTAATCCCATTCATGATGG - Intronic
1102598296 12:114009893-114009915 GCCACTAATACCATTCATGAGGG + Intergenic
1103093314 12:118113057-118113079 GGCACTAATCCCATTCATGAGGG - Intronic
1103222134 12:119254781-119254803 GGCACTAATCCCATTCATGAAGG + Intergenic
1103392946 12:120587416-120587438 GGCACTAATACTATTCATGAGGG - Intergenic
1104327725 12:127815949-127815971 GTTGCTAATCTTATTCAAGAGGG - Intergenic
1104371795 12:128229962-128229984 CCCACTAATCCCATTCACGAGGG + Intergenic
1104695700 12:130862161-130862183 GGCACTAATCCTATTCGTGAGGG + Intergenic
1105627309 13:22125368-22125390 GCCACTAATCCCATTCATGAGGG + Intergenic
1105716845 13:23074950-23074972 GGCACTAATCCCATTCATGAGGG + Intergenic
1106109559 13:26764772-26764794 GGCACTCATCCTATTCAAGAGGG + Intergenic
1106580773 13:31016620-31016642 GCCACTAATCTCATTCATGAGGG + Intergenic
1106749478 13:32745731-32745753 GACACTAATCCCATTCATGAGGG + Intronic
1106839463 13:33671361-33671383 AAACATAATCCTATTCAAGAAGG - Intergenic
1107006145 13:35614179-35614201 ACAAATAATCCTATTAAAAATGG - Intronic
1107043151 13:35969859-35969881 GTCACTAATCCCATTCATGAGGG - Intronic
1107095162 13:36527891-36527913 GGCACTAATCCCATTCATGAGGG + Intergenic
1107134927 13:36933377-36933399 GACACTAATCCTATTCATGAAGG - Intergenic
1107172270 13:37357163-37357185 GGCACTCATCCTATTCATGAGGG - Intergenic
1107176517 13:37405814-37405836 GGCACTAATCTTATTCATGAGGG + Intergenic
1107349180 13:39496313-39496335 GGAACTAATCCCATTCATAAGGG + Intronic
1107455411 13:40550229-40550251 GGCACTAATCCCATTCATGAGGG + Intergenic
1107542474 13:41403933-41403955 GGCACTAATCCCATCCAAGAGGG + Intergenic
1107555367 13:41513103-41513125 GGCACTAATCCCATTCATGAGGG + Intergenic
1107930354 13:45301957-45301979 GGCACTAATCCCATTCATGAGGG + Intergenic
1107983055 13:45751820-45751842 GACACTAATCCCATTCATGAGGG + Intergenic
1108531692 13:51332674-51332696 GGCACTAATCCCATTCATGAGGG - Intergenic
1108601682 13:52000372-52000394 GGCACTAATCCCATTCGAGAAGG + Intronic
1109310454 13:60686733-60686755 GCCACTAATCCTGTTTATGAGGG - Intergenic
1109682782 13:65774499-65774521 GTAACTAATCCCATTCATAAGGG - Intergenic
1110058281 13:71006082-71006104 GTCACTAATCCTATTCAGGAGGG + Intergenic
1110178349 13:72584930-72584952 GGAACTAATCCATTTCAAGAGGG - Intergenic
1110186496 13:72681145-72681167 GGCATTAATCCTATTCATGAAGG + Intergenic
1110381900 13:74861965-74861987 GACACTAATCCCATTCATGAGGG - Intergenic
1110459045 13:75724020-75724042 GGACCTAATCCCATTCATGAGGG + Intronic
1110670872 13:78175980-78176002 GCACCGAATCCCATTCATGAGGG + Intergenic
1110753017 13:79137553-79137575 GACACTAATCCCATTCATGAGGG - Intergenic
1110823728 13:79947201-79947223 GCACCTAATCCCATTCATGAGGG - Intergenic
1110844234 13:80175684-80175706 GGCACTAATCCCATTCATGAGGG + Intergenic
1110975858 13:81833150-81833172 TCAACAAATCATGTTCAAGATGG - Intergenic
1111008811 13:82285450-82285472 GGCACTAATCCTACTCATGAGGG - Intergenic
1111080650 13:83302364-83302386 GGAACTAATCCCATTCATGAGGG - Intergenic
1111151324 13:84257041-84257063 GGCACTAATCCCATTCATGAGGG + Intergenic
1111276276 13:85951612-85951634 GATACTAATCCTATTCATGAAGG + Intergenic
1111473321 13:88715083-88715105 GGCACTAATCCCATTCATGAGGG - Intergenic
1111732225 13:92090393-92090415 TCTACTAATCCCATTCATGAGGG - Intronic
1111816662 13:93162550-93162572 GACACTAATCCCATTCATGAGGG + Intergenic
1111910178 13:94302375-94302397 GGCACTAATCCTATTCTTGAGGG + Intronic
1111966707 13:94868792-94868814 GACACTAATCCCATTCATGAAGG - Intergenic
1112028969 13:95439654-95439676 AGCACTAATCCTATTCATGAGGG + Intronic
1112057369 13:95702547-95702569 GCCACTAATCCCAGTCATGAGGG - Intronic
1112102384 13:96203376-96203398 GTCACTAATCCCATTCATGAAGG + Intronic
1112169133 13:96951380-96951402 GACACTAATCCCATTCATGAGGG - Intergenic
1112169909 13:96960533-96960555 GGCACTAATCCCATTCAAGAGGG - Intergenic
1112217193 13:97445061-97445083 GGCACTAATCCCATTCATGAGGG + Intronic
1112266962 13:97933047-97933069 ATAAATAATCCTATTCAAAAGGG + Intergenic
1112906585 13:104429817-104429839 GCAACTGATCCCATTCAGGAAGG + Intergenic
1113038710 13:106080878-106080900 GGCGCTAATCCTATTCATGAGGG + Intergenic
1113085989 13:106570033-106570055 GATACTATTCCCATTCAAGAGGG + Intergenic
1113086029 13:106570401-106570423 GGAACTAATCCAATTCATGAGGG + Intergenic
1113139437 13:107130698-107130720 GGCACTAATCCTATTCATGAGGG - Intergenic
1113559340 13:111265747-111265769 GCTGCTGATCCTATTCATGAGGG - Intronic
1113754192 13:112798116-112798138 GCACCTAATCCCATTCATGAGGG + Intronic
1114168451 14:20246380-20246402 GGCACTAATCCCATTCAGGAGGG - Intergenic
1114381231 14:22206511-22206533 GGAACTAATCCCATTCAAGATGG - Intergenic
1114936127 14:27539378-27539400 GACACTAATTCTATTCATGAGGG - Intergenic
1115106655 14:29769994-29770016 GGCACTAATCCCATTCATGAGGG - Intronic
1115229141 14:31139334-31139356 GACACTAATCCCATTCATGAGGG - Intronic
1115499926 14:34040319-34040341 GGCTCTAATCCCATTCAAGAGGG - Intronic
1115649438 14:35392311-35392333 GGAACTAATCCCATTCAGGAGGG - Intergenic
1115705576 14:35994676-35994698 GGTACTAATCCCATTCATGAGGG - Intergenic
1115977038 14:39008192-39008214 GCCACTAATCTCATTCACGAGGG + Intergenic
1116095918 14:40367213-40367235 GGCACTAATCCTATTTATGAAGG + Intergenic
1116274686 14:42817267-42817289 TCAAATAATCCTATTAAAAATGG + Intergenic
1116403904 14:44544618-44544640 CCAAATAATCCTATTAAAAATGG - Intergenic
1116465501 14:45227688-45227710 GTAAATAATACTATTCAAAATGG - Exonic
1116650162 14:47580351-47580373 GCTGCTAATCCCATTCATGAGGG + Intronic
1116753141 14:48911696-48911718 GACACTAATCCCATTGAAGAGGG + Intergenic
1116786045 14:49289790-49289812 GGCACTAATCCCATTCATGAAGG - Intergenic
1117224371 14:53639453-53639475 GGCACTAATCCCATTCACGAGGG - Intergenic
1117397451 14:55324994-55325016 GGCACTAATCCTATTCACAAAGG + Intronic
1117549824 14:56823893-56823915 GACACTAATCCCATTCACGAGGG - Intergenic
1118072522 14:62261364-62261386 GTCGCTAATCCTATTCAAGAGGG - Intergenic
1118097452 14:62553639-62553661 GCTACTAATCCAATTCAAATGGG + Intergenic
1118148044 14:63162048-63162070 GGCACTAATCCCATTCATGAGGG - Intergenic
1118244469 14:64095907-64095929 GCACCTAATCCCATTCATGAGGG - Intronic
1119547668 14:75484198-75484220 GCATTTAATCCCATTCATGAGGG + Intergenic
1119866353 14:77978382-77978404 GGCACTAATCCCATTCATGAAGG + Intergenic
1119894724 14:78210324-78210346 GGCACTAATCCCATTCATGAAGG + Intergenic
1120382840 14:83804150-83804172 GACACTAATTCTATTCATGAGGG - Intergenic
1120415913 14:84217581-84217603 GGCACTAATCCCATTCATGAAGG - Intergenic
1120455772 14:84728749-84728771 GGCACTAATCCTATTAATGAGGG - Intergenic
1120915504 14:89706645-89706667 GGCACTAATCCTAGTCATGAAGG + Intergenic
1121141494 14:91546493-91546515 GGCACTAATCCTATTCATGAGGG - Intergenic
1121264186 14:92588547-92588569 GGCACTAATCCCATTCATGAGGG + Intronic
1121356072 14:93216147-93216169 GGCACTAATCCCATTCACGAGGG - Intronic
1121369618 14:93345078-93345100 GGTACTAATCCTATTCATGAGGG - Intronic
1121694222 14:95899741-95899763 GACACTAATTCTATTCATGAGGG + Intergenic
1121835087 14:97085111-97085133 GGCACTAATCCCATTCATGAGGG + Intergenic
1121873398 14:97429880-97429902 GCAACTAATCCTACTCATTATGG + Intergenic
1121946129 14:98124219-98124241 GGCACTAATCCCATTCATGAGGG - Intergenic
1122438518 14:101714592-101714614 GGCACTAATCCCATTCATGAGGG + Intergenic
1122478795 14:102032089-102032111 GCTACTTACCCTATTCCAGAGGG + Intronic
1202937344 14_KI270725v1_random:102958-102980 GGCACTAATCCCATTCAAAAGGG - Intergenic
1124060885 15:26292833-26292855 GGCACTAATCCCATTCATGAGGG - Intergenic
1124149979 15:27168636-27168658 GGAAATAATCCCATTCACGAAGG - Intronic
1124465912 15:29939732-29939754 GGCACTAATCCCATTCATGAGGG - Intronic
1125085510 15:35724926-35724948 GTAACTAATCCCATTCATGAGGG - Intergenic
1125408800 15:39383371-39383393 GGCACTAATCCCATTCATGAGGG + Intergenic
1125910531 15:43434565-43434587 GGCACTAACCCTATTCATGAGGG - Intronic
1126363459 15:47870135-47870157 GGCACTAATCCTATTCACGAGGG - Intergenic
1126541155 15:49825514-49825536 ACCACTAATCCTATTCATGAGGG - Intergenic
1126573893 15:50179657-50179679 GGCACTAATCCCATTCATGAGGG - Intronic
1126982421 15:54259099-54259121 GCCACTAATCCCATTCTTGAGGG + Intronic
1127103825 15:55592386-55592408 GCACCTAATCCCATTCATGAGGG + Intergenic
1127174573 15:56339769-56339791 GGCACTAATCCCATTCATGAAGG - Intronic
1127303986 15:57684112-57684134 GCCACTAATCCCATTCATGAGGG + Intronic
1128012907 15:64315548-64315570 GCAATTATTCCTTTTCAAAAAGG + Intronic
1128251900 15:66169704-66169726 GCAGCTAATCCTTGTGAAGAAGG + Intronic
1128320210 15:66688170-66688192 GTCACTAATCCCATTCAAGAGGG + Intergenic
1128469844 15:67943058-67943080 GGAACTAATCCCATTCATGAGGG - Intergenic
1129404486 15:75306381-75306403 GTCACTAATCCCATTCACGAGGG + Intergenic
1129478096 15:75800887-75800909 GTCACTAATCCCATTCACGAGGG + Intergenic
1129592226 15:76926965-76926987 GCATCTGATCCTTTTCATGAAGG - Intergenic
1129812585 15:78522954-78522976 AGGACTAATCCTATTCCAGATGG + Intronic
1130114858 15:80997929-80997951 GCCACTAACCCCATTCAAGAGGG + Intergenic
1130162489 15:81415133-81415155 GGAACTAATCCCATTCATGAGGG - Intergenic
1130511125 15:84590121-84590143 GTCACTAATCCCATTCATGAGGG - Intergenic
1130554629 15:84914256-84914278 GGCACTAATCCCATTCATGAGGG + Intronic
1131095453 15:89651849-89651871 GGAACTAATCCCATTTATGAGGG - Intronic
1131372372 15:91893534-91893556 GGCACTAATCCCATTCATGAGGG + Intronic
1131454043 15:92569540-92569562 GGCACTAATCCCATTCATGAGGG - Intergenic
1131788137 15:95934980-95935002 GGAACTAATCCTATTCATAAGGG - Intergenic
1132119402 15:99163709-99163731 GACACTAATCCCATTCATGAGGG - Intronic
1132165666 15:99586504-99586526 GCAAATAACCCTATTAAAAATGG - Intronic
1132368554 15:101276945-101276967 GCAACTAATCTGAATCAGGAAGG + Intronic
1133366701 16:5216051-5216073 GCAGCTAATCCTATTTATGAAGG + Intergenic
1133549518 16:6840567-6840589 GGCACTAATCCCATTCATGAGGG - Intronic
1133679744 16:8109729-8109751 GCAACTAGACATGTTCAAGATGG - Intergenic
1133760023 16:8791164-8791186 GGCACTAATCCCATTCATGAGGG - Intronic
1134083170 16:11338482-11338504 GACACTAATCCCATTCATGAGGG + Intronic
1134503939 16:14790449-14790471 GGCACTAATCCCATTCATGAAGG - Intronic
1134557475 16:15177891-15177913 GGCACTAATCCCATTCATGAGGG + Intergenic
1134559299 16:15194130-15194152 GTCACTAATCCGATTCATGAGGG - Intergenic
1134569459 16:15279088-15279110 GGCACTAATCCTATTCATGAGGG + Intergenic
1134576633 16:15338459-15338481 GGCACTAATCCCATTCATGAAGG + Intergenic
1134725806 16:16418040-16418062 GGCACTAATCCCATTCATGAAGG - Intergenic
1134732918 16:16476961-16476983 GGCACTAATCCTATTCATGAGGG - Intergenic
1134903495 16:17959668-17959690 GGCACTAATCCCATTCATGAGGG + Intergenic
1134918044 16:18089570-18089592 GGCACTAATCCCATTCATGAGGG + Intergenic
1134934521 16:18235010-18235032 GGCACTAATCCTATTCATGAGGG + Intergenic
1134941627 16:18293819-18293841 GGCACTAATCCCATTCATGAAGG + Intergenic
1135097624 16:19577732-19577754 GGCACTAATCCCATTCATGAGGG - Intronic
1135358584 16:21791687-21791709 GTTACTAATCCCATTCATGAGGG + Intergenic
1135457140 16:22608123-22608145 GTTACTAATCCCATTCATGAGGG + Intergenic
1135666079 16:24336701-24336723 GACACTAATCCCATTCATGAGGG + Intronic
1135974307 16:27097346-27097368 GCACCTAATCCCATTCAAGAGGG + Intergenic
1136603821 16:31317428-31317450 GGCACTAATCCTATTAATGATGG - Intronic
1137805503 16:51301145-51301167 GGCACTAATCCGATTCACGAGGG + Intergenic
1138230694 16:55333641-55333663 GTCACTAATCCCATTCACGAAGG + Intergenic
1138694358 16:58797914-58797936 GGCACTAATCCCATTCATGAGGG + Intergenic
1139194652 16:64905123-64905145 GGCACTAATCCTATTCAGGAGGG - Intergenic
1139320038 16:66106965-66106987 GACACTAATCCCATTCATGAGGG + Intergenic
1139401833 16:66688167-66688189 GGCACTAATCCCATTCATGAGGG + Intronic
1139415446 16:66804757-66804779 GGCACTAATCCTATTCATGAAGG - Intronic
1139779837 16:69341350-69341372 TCAAGTACTCTTATTCAAGAAGG + Intronic
1140521820 16:75588382-75588404 GACACTAATCCCATTCATGAGGG + Intergenic
1140654376 16:77124389-77124411 GCAACTGATCCCATTCTTGAAGG - Intergenic
1141085283 16:81089964-81089986 GAAACATGTCCTATTCAAGAAGG - Intronic
1142861790 17:2766627-2766649 GACACTAATCCCATTCATGAGGG - Intergenic
1143570922 17:7757895-7757917 GCCACTAATTCCATTCATGAGGG + Intronic
1143840324 17:9726593-9726615 GTCACTAATCCCATTCACGAGGG + Intronic
1143983368 17:10890207-10890229 GGAACTAATCCCATTTATGAAGG - Intergenic
1144001979 17:11063759-11063781 GGCACTAATCCTATTTATGAGGG + Intergenic
1144720772 17:17468405-17468427 GGCACTAATCCCATTCATGAGGG + Intergenic
1144938160 17:18916856-18916878 GGCACTAATCCTGTTCATGAAGG + Intronic
1145012116 17:19374980-19375002 GCAAATAATCCAATTAAAAATGG + Intronic
1145228697 17:21153752-21153774 GCATGTAATCCCATTCATGAGGG + Intronic
1145849333 17:28076414-28076436 GGCACTAATCCCATTCATGAGGG + Intronic
1145923998 17:28632530-28632552 GGCACTAATCCTATTCATGAAGG - Intronic
1146366764 17:32234914-32234936 GCAACTAATCCCATTCATGAGGG + Intronic
1146625528 17:34432219-34432241 GGCACTAATCCCATTCATGAGGG - Intergenic
1146684154 17:34829152-34829174 GACACTAATCCCATTCATGAGGG - Intergenic
1146993456 17:37296623-37296645 GGCACTAATCCCATTCATGAGGG + Intronic
1148977081 17:51538997-51539019 GGCACTAATCCTGTTCATGAGGG + Intergenic
1148981690 17:51581912-51581934 GGCACTAATCCTATTCACGTGGG - Intergenic
1149628744 17:58101815-58101837 GGTACTAATCCCATTCATGAGGG + Intergenic
1149888432 17:60364204-60364226 GGCACTAATCCCATTCATGAGGG + Intronic
1150369029 17:64619740-64619762 GGCACTAATCCTATTCATGAAGG + Intronic
1150560368 17:66289167-66289189 GGCACTAATCCCATTCAGGATGG - Intergenic
1150802693 17:68294292-68294314 GCAAATGACCCTATGCAAGAGGG - Intronic
1151290020 17:73142950-73142972 GGCACTAATCCCATTCATGAGGG - Intergenic
1151901661 17:77020017-77020039 GGCACTAATCCCATTCATGACGG + Intergenic
1153273031 18:3341986-3342008 GGCACTAATCCCATTCATGAGGG + Intergenic
1153275903 18:3367583-3367605 GGCACTAATCCCATTCATGAGGG + Intergenic
1153470318 18:5437224-5437246 GGCACTAATCCCATTCATGAGGG - Intronic
1153517759 18:5920067-5920089 GGCACTAATCCCATTCATGAGGG - Intergenic
1153658853 18:7308735-7308757 GGCACTAATCCCATTCATGAGGG - Intergenic
1153679949 18:7491192-7491214 GGCACTAATCCCATTCATGAAGG - Intergenic
1155159586 18:23184889-23184911 GGCACTAATCCCATTCATGAGGG + Intronic
1155187993 18:23404353-23404375 GACACTAATCCCATTCATGAAGG - Intronic
1155798192 18:30066387-30066409 GGCACTAATCCCATTCACGAGGG + Intergenic
1156007629 18:32462446-32462468 ACAAATAATCCTATTTAAAATGG - Intronic
1156507032 18:37603719-37603741 GCCACTAATCCCATTCATGAGGG - Intergenic
1156579978 18:38363600-38363622 GGAACAAATCCCATTCATGAAGG - Intergenic
1157023334 18:43813376-43813398 GGCACTAATCCTACTCATGAGGG + Intergenic
1157035103 18:43962211-43962233 GGCACTAATCCCATTCATGAGGG - Intergenic
1157423314 18:47563929-47563951 GGTACTAATCCCATTCATGAAGG - Intergenic
1157463188 18:47920214-47920236 GGCACTAATCCCATTCATGAGGG + Intronic
1157813592 18:50715575-50715597 GGCACTAATCCCATTCATGAGGG - Intronic
1158218524 18:55126156-55126178 GGAACTAATCCCATTCATGAGGG + Intergenic
1158484990 18:57858173-57858195 GGCACTAATACTATTCATGAGGG - Intergenic
1158494966 18:57946783-57946805 GGCACTAATCCCATTCATGAGGG + Intergenic
1158513599 18:58112925-58112947 GGCACTAATCCCATTCATGAGGG - Intronic
1158703162 18:59767248-59767270 GGCACTAATCCCATTCATGAGGG - Intergenic
1158812552 18:61054307-61054329 GGAACTAATCTCATTCATGAAGG + Intergenic
1158948078 18:62465028-62465050 GGCACTAATTCCATTCAAGAGGG + Intergenic
1158980448 18:62755516-62755538 GGCACTAATCCTATTCATGAAGG - Intronic
1158999251 18:62956357-62956379 GCCACTAATCCCATGCATGAGGG + Intronic
1159098043 18:63927579-63927601 GACACTAATCCTATTCATGAGGG + Intronic
1159176793 18:64846996-64847018 TGTACTAATCCTATTCACGAAGG - Intergenic
1159488007 18:69091611-69091633 GCACCTGATCCCATTCATGACGG + Intergenic
1159626769 18:70704120-70704142 GAAACTAATCCCATTCATGTGGG - Intergenic
1159949973 18:74475765-74475787 GGCACTAATCCCATTCATGAAGG - Intergenic
1160052414 18:75447306-75447328 GGCACTAATCCCATTCATGAGGG - Intergenic
1163408756 19:17140401-17140423 GGCACTAATCCCATTCATGAGGG + Intronic
1164122489 19:22279597-22279619 TCACCTAACCCTATTGAAGAAGG + Intergenic
1164511346 19:28899690-28899712 GCACCTAATCCCATCCATGAGGG - Intergenic
1164760847 19:30727237-30727259 GGCACTAATCCCATTCATGAGGG + Intergenic
1164946679 19:32300344-32300366 GGCACTAATCCTAATCATGAGGG - Intergenic
1165582514 19:36880026-36880048 GCAAATATTCTTATTCAACAAGG - Intronic
1166007950 19:39919929-39919951 GGCACTAATCCCATTCATGAGGG - Intronic
1166570840 19:43796105-43796127 GGCACTAATCCTATTCATGGGGG + Exonic
1167225907 19:48239974-48239996 GGAACTAATTCCATTCATGAGGG + Intronic
1167806675 19:51791515-51791537 GGCACTAATCCTATTTATGAGGG + Intronic
1167848648 19:52185139-52185161 GACACTAATCCCATTCATGAGGG - Intergenic
1168281745 19:55309620-55309642 GACACTAATCCCATTCATGAAGG + Intronic
1168413193 19:56152818-56152840 GGCACTAATCCCATTCATGAGGG + Intronic
1168490741 19:56806762-56806784 GGCACTAATCCCATTCATGAGGG - Intronic
925063097 2:908669-908691 AGAACTCATCCTATTCAGGAGGG - Intergenic
925392472 2:3505833-3505855 GACACTAATCCCATTCATGAGGG - Intronic
925393538 2:3516161-3516183 GCCACTAATCCTATAAATGAGGG - Intronic
925504421 2:4544765-4544787 GCCGCTAATCCCATTCATGAGGG + Intergenic
925637549 2:5955161-5955183 GCAAGTAACCCCATTCAAAATGG - Intergenic
925642473 2:5999210-5999232 GCCACTAATCCTTTTCATGAGGG + Intergenic
925833804 2:7923166-7923188 GGCACTAATCCCATTCATGAGGG + Intergenic
925954482 2:8949164-8949186 GCAAATAATCCCATTAAAAATGG - Intronic
926365245 2:12127173-12127195 GGCACTAATCCCATTCATGAGGG - Intergenic
926834771 2:17006316-17006338 GGCACTAATCCCATTCATGAGGG + Intergenic
926886478 2:17603390-17603412 GGCACTAATCCCATTCATGAGGG + Intronic
926940242 2:18128169-18128191 GCAAATAATCCAATTAAAAATGG + Intronic
927130937 2:20059890-20059912 GGCACTAATCCCATTCATGAGGG + Intergenic
927405966 2:22767138-22767160 GGCACTAATCCCATTCATGAGGG + Intergenic
927416574 2:22886575-22886597 AGAACTAATCCTATTCATGAAGG - Intergenic
927633529 2:24794165-24794187 GCAACTTATCCGTTTCAAAAGGG - Intronic
928004825 2:27554895-27554917 GACACTAATCCCATTCAAGAGGG + Intronic
928270784 2:29852781-29852803 GGCACTAATCCCATTCATGAGGG - Intronic
928474153 2:31607898-31607920 GGCACTAATGCTATTCATGAGGG - Intergenic
928719188 2:34099588-34099610 GGCACTAATCCCATTCATGAAGG - Intergenic
929100691 2:38310320-38310342 GCAACTAATCCTAGTTTTGATGG - Exonic
929129026 2:38547915-38547937 GGCACTAATCCCATTCATGAGGG - Intergenic
929345493 2:40878697-40878719 GCACCTAATCCTATTCACAAGGG - Intergenic
929448151 2:42016355-42016377 GGCACTAATCCTATTCATGAGGG + Intergenic
929584516 2:43105372-43105394 GGCACTAATCCTATTCATGAGGG - Intergenic
930203402 2:48565368-48565390 GGTACTAATCCTATTCATGAGGG + Intronic
930565464 2:53013878-53013900 GGCACTAAGCCTATTCATGAGGG + Intergenic
930605939 2:53493123-53493145 GGTACTAATCCTACTCATGAAGG - Intergenic
930989437 2:57633778-57633800 GCTACCAATTCTATTCAATATGG - Intergenic
931210209 2:60186539-60186561 GGAACTAATTCCATTCATGAGGG + Intergenic
931338753 2:61377526-61377548 GCCACTAATCCCATTCATGAAGG - Intronic
931627639 2:64271219-64271241 GGCACTAATCCCATTCATGAGGG - Intergenic
931703991 2:64931944-64931966 GACACTAATCCCATTCATGAGGG + Intergenic
931815870 2:65899987-65900009 GGCACTAATCCTATTCATGAGGG + Intergenic
932261950 2:70334372-70334394 GGCACTAATCCCATTCATGAGGG - Intergenic
932299153 2:70653163-70653185 GACACTAATCCGATTCATGAGGG - Intronic
932362258 2:71118654-71118676 GACACTAATCCCATTCATGAGGG + Intronic
932652316 2:73571520-73571542 GGCACTAATCCCATTCATGAAGG + Intronic
933472419 2:82742814-82742836 GGCACTAATCCCATTCATGAGGG - Intergenic
933588097 2:84201580-84201602 GCTGCTAATCCAATTCATGAGGG + Intergenic
934068297 2:88360310-88360332 GGCATTAATCCTATTCATGAGGG + Intergenic
934636633 2:95995299-95995321 ATATCTAATCCTATTCATGAAGG - Intergenic
934780501 2:96966754-96966776 GGTACCAATCCTATTCATGAAGG - Intronic
934836399 2:97593305-97593327 ATATCTAATCCTATTCATGAAGG - Intergenic
935176646 2:100654793-100654815 GGCACTAATCCTATTCATGAGGG + Intergenic
935262658 2:101368721-101368743 GACACTAATCCCATTCAGGAGGG - Intronic
935607046 2:104981808-104981830 GGCACTAATCCTATTCATGAGGG + Intergenic
935758122 2:106293449-106293471 GAAACTAATCCCATTCATGAGGG - Intergenic
935889309 2:107658402-107658424 ACAACTAATCCCATTCATGTGGG - Intergenic
936053905 2:109246394-109246416 GACACTAATCCCATTCATGAGGG + Intronic
936406817 2:112212218-112212240 GGCACTAATCCCATTCATGAGGG + Exonic
936411998 2:112268187-112268209 GGCACTAATCTCATTCAAGAGGG - Intergenic
936470824 2:112797353-112797375 GCTACTAATCCCATTCATGAGGG + Intergenic
936707131 2:115088139-115088161 GGCACTAATCCCATTCATGAGGG + Intronic
936896382 2:117432562-117432584 GGCACTAATCCCATTCATGAGGG + Intergenic
937139143 2:119583767-119583789 GACACTAATCCTGTTCATGAGGG - Intronic
937145742 2:119642859-119642881 GGCACTAATCCTATTCATGAGGG + Intronic
937282779 2:120731702-120731724 GATACTAATCCTATACATGAAGG - Intergenic
937441004 2:121916045-121916067 GGCACTAATCCCATTCATGAGGG + Intergenic
937496553 2:122426340-122426362 GCATCTAATCCTATGCATGAGGG - Intergenic
937651575 2:124325124-124325146 GGCACTAATCCCATTCATGAAGG - Intronic
937714123 2:125012189-125012211 GACACTAATTCTATTCATGAGGG - Intergenic
938208757 2:129446640-129446662 GCCATTAATCCCATTCATGAAGG + Intergenic
938228309 2:129636557-129636579 GGTACTAATCCCACTCAAGAGGG + Intergenic
938396896 2:130957705-130957727 GGAACTAATCCCATTCATGAAGG - Intronic
938687543 2:133754854-133754876 GGCACTAATCCTGTTCATGAAGG + Intergenic
938775529 2:134538201-134538223 GACACTAATCCCATTCATGAGGG - Intronic
938960170 2:136333552-136333574 GCACCTAATTCCATTCACGAGGG + Intergenic
939119578 2:138100435-138100457 GGCAATAATCCTATTCATGAGGG + Intergenic
939392973 2:141592438-141592460 GGCACTAATCCCATTCATGAAGG + Intronic
939495496 2:142923045-142923067 GGTACTAATCCCATTCATGAGGG + Intronic
939521119 2:143231904-143231926 GCCACTAATCCCATTCATGAGGG + Intronic
939552002 2:143626962-143626984 GCCACTAATCCCACTCATGAGGG - Intronic
939982911 2:148802179-148802201 GGCACTAATCCCATTCATGAGGG + Intergenic
940112299 2:150168248-150168270 ACCACTAATCCCATTCATGAGGG - Intergenic
940155702 2:150654004-150654026 GGCACTAATCCTATTCATGAGGG - Intergenic
940174418 2:150863020-150863042 GCACCTGATCCTATTCATGAGGG + Intergenic
940372786 2:152921456-152921478 GATACTAATCCCATTCATGAGGG + Intergenic
940521629 2:154757854-154757876 GGTACTAATCCCATTCATGAGGG + Intronic
940662148 2:156559622-156559644 GCAATTAATACTATACAATATGG - Intronic
941018798 2:160386597-160386619 GGCAGTAATCCTATTCATGAGGG - Intronic
941055941 2:160788151-160788173 GTTACTAATCCCATTCATGAGGG - Intergenic
941066963 2:160914309-160914331 GGCACTAATCCCATTCATGAGGG + Intergenic
941262374 2:163313897-163313919 GGCACTAATCCCATTCAGGAGGG - Intergenic
941277869 2:163513595-163513617 GGCACTAATCCCATTCATGAGGG + Intergenic
941686565 2:168454681-168454703 GGCACTAATCCCATTCATGAAGG - Intergenic
941687822 2:168465398-168465420 GTCACTAATCCTATTCATGAGGG + Intronic
941711095 2:168714162-168714184 GGCACTAACCCTATTCATGAGGG + Intronic
941791548 2:169557789-169557811 ACAACTAATCATAGTCAAAATGG - Intronic
942712059 2:178847828-178847850 GGCACTAATCCTATTCATGAGGG - Intronic
942752766 2:179306621-179306643 GGCACTAATCCCATTCATGAAGG - Intergenic
942906292 2:181184611-181184633 GCACCCAATCCCATTCATGAGGG - Intergenic
943195616 2:184744430-184744452 GGCACTAATCCTGTTCATGAGGG - Intronic
943800936 2:192056780-192056802 GGCACTAATCCCATTCATGAAGG - Intronic
943883484 2:193179981-193180003 CAAACTAATCCTCTTCAAAAGGG - Intergenic
944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG + Intergenic
944329250 2:198445720-198445742 GCCTCTAATCCCATTCATGAGGG - Intronic
944577773 2:201106192-201106214 GGCACTAATCCCATTCATGAGGG - Intergenic
944579923 2:201123552-201123574 GCATCTAATCCCATTCAGGAGGG + Intronic
944636491 2:201680448-201680470 GGCACTAATCCCATTCATGAGGG + Intronic
944814278 2:203359745-203359767 GGCACTAATCCCATTCATGAAGG + Intronic
944965478 2:204927298-204927320 GGCACTAATCCTATTCATGAGGG - Intronic
944995669 2:205290815-205290837 AGCACTAAACCTATTCAAGAGGG - Intronic
944995819 2:205292231-205292253 GAAACTAATCCCATTCATGAGGG - Intronic
946356660 2:219190334-219190356 CCAACTAATCCCATTTATGAGGG - Intergenic
946671856 2:222113673-222113695 GGAACTAATCCCATTCATGAGGG + Intergenic
946881260 2:224179512-224179534 GATATTAATCCCATTCAAGAGGG + Intergenic
947029268 2:225774555-225774577 GCCACTAATCTCATTCATGAGGG + Intergenic
947069828 2:226276238-226276260 GGCACTAATCCCATTCACGAAGG + Intergenic
947124423 2:226852446-226852468 GACACTAATCCAATTCATGAGGG - Intronic
947308931 2:228779000-228779022 GGAACTAATCCTATTAATGAGGG - Intergenic
947352382 2:229259808-229259830 GGCACTAATCCCATTCATGAAGG - Intronic
947361775 2:229352777-229352799 GCACCTAATCCCATTCATGAGGG - Intergenic
947383249 2:229565000-229565022 GACACTAATCCTATTAATGAGGG + Intronic
947801442 2:232930662-232930684 GGTACTAATCCCATTCATGAGGG + Intronic
948225302 2:236305171-236305193 GCACCTAATCCTGTTCATGTGGG + Intergenic
948286859 2:236792861-236792883 GGCACTAATCCCATTCACGAGGG + Intergenic
948782001 2:240327573-240327595 GGCACTAATCCCATTCATGAGGG - Intergenic
1168918027 20:1507403-1507425 GGTACTAATCCCATTCATGAGGG - Intergenic
1169446925 20:5679948-5679970 GACACTAATCCCATTCATGAGGG + Intergenic
1169451606 20:5716722-5716744 AGATCTAATCCTATTCATGAGGG - Intergenic
1169548276 20:6673578-6673600 GACACTAATCCCATTCATGAGGG + Intergenic
1169907167 20:10615900-10615922 ACACCTAATCCCATTCATGAGGG + Intronic
1170014039 20:11760740-11760762 ATAACTAATCCAATTCACGAGGG + Intergenic
1170456180 20:16535653-16535675 ATAACTAATCCTATTAAAAATGG + Intronic
1170471917 20:16676204-16676226 GGCACTAATCCTATTCATGAGGG - Intergenic
1170502264 20:16986963-16986985 GATACTAATTCTATTCAACATGG + Intergenic
1170562041 20:17566970-17566992 GGCACTAATCCTATTAAAGGGGG + Intronic
1171164901 20:22960998-22961020 GACACTAATCCTGTTCATGAGGG - Intergenic
1171777229 20:29380536-29380558 GTAAATAATCCTATTCTAAAAGG + Intergenic
1172168409 20:32913364-32913386 GGCACTAATCCCATTCATGAGGG + Intronic
1173039065 20:39443154-39443176 GCATCTAATCCCATTCACTAGGG + Intergenic
1173044098 20:39492879-39492901 GGCACTAATCCCATTCAAGAGGG - Intergenic
1173904798 20:46618545-46618567 GAAACTAATCCTATTAGTGAGGG - Intronic
1173991481 20:47307119-47307141 GGCACTAATCCCATTCATGAGGG - Intronic
1174662333 20:52224391-52224413 GGCACTAATCCCATTCATGAGGG + Intergenic
1174866312 20:54139449-54139471 GGCACTAATCCCATTCATGAGGG + Intergenic
1174880017 20:54268779-54268801 GCAACTAAATGTATTCAAGGCGG - Intergenic
1174941279 20:54931314-54931336 GACACTAATCCCATTCATGATGG - Intergenic
1175973588 20:62699258-62699280 GGCACTAATCCCATTCATGAGGG - Intergenic
1176006907 20:62870316-62870338 GGCACTAATCCCATTCATGATGG + Intergenic
1176049339 20:63108379-63108401 GGCACTAATCCCATTCAGGAGGG - Intergenic
1176950658 21:15042580-15042602 GGTACTAATCCTGTTCATGAGGG - Intronic
1177114127 21:17065092-17065114 GCCACTAATCCCATTAATGAGGG + Intergenic
1177169987 21:17644485-17644507 GTCACTAATCCCATTCATGAGGG + Intergenic
1177338430 21:19763730-19763752 GTTACTAATCCCATTCAGGAGGG - Intergenic
1177506701 21:22028516-22028538 GGCACTAATCCCATTCATGAAGG - Intergenic
1177530488 21:22352384-22352406 GGCACTAATCCCACTCAAGAGGG + Intergenic
1177576753 21:22966686-22966708 GGAAATAATCCCATTCATGAGGG + Intergenic
1177636275 21:23790657-23790679 GGCACTGATCCTATTCATGAGGG - Intergenic
1177675108 21:24287001-24287023 GGTACTAATCCCATTCATGAGGG + Intergenic
1177676257 21:24304727-24304749 GATACTAATTCTATTCATGAGGG + Intergenic
1177693416 21:24540096-24540118 GCACCTAATCCCATTCATGAAGG + Intergenic
1177849635 21:26331046-26331068 GGCACTAATCCAATTCATGAAGG + Intergenic
1177885361 21:26740180-26740202 AGCACTAATCCCATTCAAGAGGG + Intergenic
1178352701 21:31884235-31884257 GGCACTAATCCCATTCATGAGGG - Intronic
1178468181 21:32868137-32868159 TAAACTAATCATCTTCAAGATGG - Intergenic
1178475339 21:32932867-32932889 GCATCTAATCCTTTTTCAGAAGG - Intergenic
1178482070 21:32988110-32988132 GGCACTAATCCCATTCACGAGGG + Intergenic
1178483985 21:33005487-33005509 GGCACTAATCCCATTCAAGAGGG - Intergenic
1178608853 21:34062722-34062744 GCACCTAATTCCATTCTAGATGG + Intergenic
1178694492 21:34781206-34781228 GACACTAATCCCATTCATGAGGG + Intergenic
1178966739 21:37127174-37127196 GGCACTAATCCCATTCATGAGGG + Intronic
1179161150 21:38900464-38900486 GGCACTAATCCCATTCATGAGGG - Intergenic
1179236015 21:39546965-39546987 GGCACTAATCCCATTCATGAGGG + Intergenic
1179240697 21:39588613-39588635 GCAACTAATCCTATTCAAGAGGG + Intronic
1179269042 21:39834796-39834818 GACACTAGTCCTATTCATGAGGG + Intergenic
1179284869 21:39968612-39968634 GGCACTAATCCCATTCATGAGGG + Intergenic
1179523826 21:41962621-41962643 GGCACTAATCCTATTCACGGGGG + Intergenic
1180153525 21:45965499-45965521 GCAAATACTCCTATTCCAAAGGG - Intergenic
1181643290 22:24216080-24216102 GGCACTAATCCCATTCATGAGGG - Intergenic
1182376303 22:29850898-29850920 GCACCTAATCCTATTCATGAGGG + Intergenic
1182693836 22:32182937-32182959 GGCACTAATCCCATTCAAGAGGG + Intergenic
1182707148 22:32290831-32290853 GTCACTAATCCCATTCATGAGGG + Intergenic
1182915325 22:34024124-34024146 GGCACTAATCCCATTCATGAAGG + Intergenic
1182920548 22:34075264-34075286 GGCATTAATCCTATTCATGAGGG + Intergenic
1183007554 22:34916147-34916169 GACACTAATCCTGTTCATGAGGG - Intergenic
1183498001 22:38161387-38161409 GGCACTAATCCCATTCATGAGGG + Intronic
1183611897 22:38914261-38914283 GGCACTAATCCCATTCATGAGGG - Intergenic
1183761360 22:39821881-39821903 GGCACTAATCATATTCATGAGGG + Intronic
1183870851 22:40741058-40741080 GACACTAATCCCATTCATGAGGG - Intergenic
1184323289 22:43760632-43760654 GCACCTACTCCTATTCAAGAGGG - Intronic
1184622593 22:45693524-45693546 GGCACTAATCCCATTCACGAGGG + Intronic
1184956430 22:47889927-47889949 GGCACTAATCCTATTCACGAAGG + Intergenic
1185019793 22:48367504-48367526 GGCACTAATCCCATTCATGAGGG + Intergenic
1185131669 22:49043017-49043039 GGCACTAATCCTTTTCATGAGGG + Intergenic
1185133656 22:49056033-49056055 GTCACTAATCCTATTCGTGAGGG - Intergenic
949591153 3:5495771-5495793 GGCACTAATCCCATTCATGAGGG - Intergenic
949833840 3:8246473-8246495 GGTACTAGTCCTATTCATGAGGG - Intergenic
949957069 3:9277915-9277937 GGCACTAATCCCATTCATGAGGG - Intronic
950490267 3:13300431-13300453 GAAATTAATCCCATTCATGAAGG + Intergenic
950588513 3:13916294-13916316 GACACTAATCCCATTCATGAGGG + Intergenic
950629016 3:14268897-14268919 GGCACTAATCCCATTCATGAGGG - Intergenic
950704425 3:14771109-14771131 GGCACTAATCCCATTCATGAGGG - Intronic
950816045 3:15703451-15703473 GACACTAATCCCATTCATGAGGG - Intronic
950832455 3:15888158-15888180 GGCACTAATCCCATTCATGAGGG - Intergenic
950944606 3:16931925-16931947 GGCACTAATCCCATTCATGAGGG - Intronic
950961741 3:17115122-17115144 GGCACTAATCCTATTCATGAAGG - Intergenic
951467568 3:23018886-23018908 GGCACTAATCCCATTCATGAGGG - Intergenic
951942188 3:28091788-28091810 GGCACTAATCCCATTCATGAGGG - Intergenic
952028832 3:29116579-29116601 GCACCTAATCCTATTCATAAGGG - Intergenic
952051064 3:29385262-29385284 GCAACTAATCCTATTACCGCAGG + Intronic
952111863 3:30133494-30133516 GGTACTAATCCCATTCACGAGGG + Intergenic
952204567 3:31167689-31167711 GACACTAATCCCATTCATGAGGG - Intergenic
952411492 3:33053757-33053779 GGCACTAATCCCATTCATGAAGG - Intronic
952484042 3:33791383-33791405 GGCACTAATCCTATTCATGAGGG + Intergenic
952585658 3:34889026-34889048 GGCACTAATCCCATTCAGGAAGG + Intergenic
953070210 3:39512924-39512946 GGAACAAATCGTGTTCAAGAAGG - Intronic
953225636 3:41016946-41016968 GCACCTAATCCCTTTCATGAGGG - Intergenic
953239562 3:41136642-41136664 GGAACTAATCCCATTCATGAGGG - Intergenic
953277510 3:41517367-41517389 GGTCCTAATCCTATTCATGAGGG - Intronic
953549580 3:43891054-43891076 GGCACTAATCCCATTCATGAGGG - Intergenic
953552727 3:43916919-43916941 GGCACTAATCCCATTCAGGAGGG - Intergenic
954504770 3:51059242-51059264 GGCACTAATCCCATTCACGAGGG + Intronic
954646212 3:52133138-52133160 GCACCTAATCCCCTTCATGAGGG - Intronic
954953850 3:54501110-54501132 ACATCTAATCCCATTCATGAGGG + Intronic
954970725 3:54649680-54649702 GACACTAATCCCATTCATGAGGG + Intronic
955040122 3:55308289-55308311 GGCACTAATTCTATTCATGAGGG + Intergenic
955671512 3:61407829-61407851 GGCACTAATCCCATTCATGAGGG + Intergenic
955847504 3:63181531-63181553 GGCACTAATCCCATTCATGAGGG + Intergenic
955912793 3:63875012-63875034 GGCACTAATCCTATTCATGAAGG + Intronic
955952671 3:64257888-64257910 AGCACTAATCCTATTCATGAGGG - Intronic
956806069 3:72813145-72813167 TCAGCTAAGGCTATTCAAGATGG + Intronic
956905982 3:73765859-73765881 GCAACCAAACCTATTCAACATGG + Intergenic
957087848 3:75699117-75699139 GTAAATAATCCTATTCTAAAAGG - Intergenic
957159733 3:76595010-76595032 GGCACTAATCCCATTCATGAGGG - Intronic
957170763 3:76734036-76734058 GGAACTAATCCCATTCATGAGGG + Intronic
957217808 3:77344444-77344466 GACACTAATCCCATTCATGAGGG - Intronic
957549092 3:81680754-81680776 GGTACTAATCCCATTCATGAGGG - Intronic
957549403 3:81684529-81684551 GGCACTAATCCCATTCATGAGGG + Intronic
957958861 3:87224722-87224744 GGAACTAATCTCATTCATGAGGG - Intergenic
958018093 3:87966220-87966242 GACACTAATCCCATTCACGAGGG + Intergenic
958150363 3:89685346-89685368 GGCACTAATCCCATTCATGAGGG + Intergenic
958484779 3:94690850-94690872 AGAACTAACCCTATTCACGAGGG + Intergenic
958538536 3:95436307-95436329 GGTGCTAATCCCATTCAAGAGGG + Intergenic
958594638 3:96205817-96205839 GCAAATAATCCCATTAAAAACGG + Intergenic
959110640 3:102118239-102118261 GGCACTAATCCCATTCATGAGGG + Intronic
959164453 3:102759128-102759150 GTCACTAATCCTATTCAGGAGGG - Intergenic
959224500 3:103562913-103562935 GGCACTAATCCTATTAATGAGGG - Intergenic
959264873 3:104124521-104124543 GGCACTAATCCCATTCATGAGGG - Intergenic
959346964 3:105207880-105207902 GTAACTATTCCTATGGAAGAAGG + Intergenic
959383305 3:105669287-105669309 GAAACTAATCCCTTTCATGAGGG - Intronic
959508976 3:107188708-107188730 AGAACTAATCCCATTCATGAGGG + Intergenic
959512203 3:107226348-107226370 GCAACTAATCTCATTCACAAGGG - Intergenic
959607264 3:108255440-108255462 GGTACTAATCCCATTCATGAGGG + Intergenic
959781834 3:110243142-110243164 GGCACTAATCCTATTCATGGGGG + Intergenic
960066838 3:113383403-113383425 GAAACTAATCCCATTCACAAGGG + Intronic
960103215 3:113766614-113766636 GGCACTAATCCCATTCATGAGGG + Intronic
960154676 3:114287164-114287186 GGCACTAATTCTATTCATGAGGG + Intronic
960461152 3:117937531-117937553 GGCACTAATCCCATTCATGAGGG - Intergenic
960694847 3:120386089-120386111 GGCACTAATCCCATTCATGAGGG - Intergenic
960808067 3:121603132-121603154 GGCACTAATTCTATTCATGAGGG + Intronic
960848928 3:122031597-122031619 GGCACTAATCCCATTCATGAGGG - Intergenic
960905521 3:122597207-122597229 GGCACTAATCCCATTCATGAGGG + Intronic
961074867 3:123973041-123973063 GGCACTAATCCCATTCATGAGGG + Intronic
961308811 3:125979440-125979462 GGCACTAATCCCATTCATGAGGG - Intronic
962164438 3:133034353-133034375 GGCATTAATCCTATTCATGAGGG + Intergenic
962373708 3:134842105-134842127 GGTACTAATCCCATTCATGAAGG - Intronic
962614877 3:137115614-137115636 GCACCTAATCCCATTCACGAGGG - Intergenic
962850308 3:139303505-139303527 GGCACTAATCCCATTCATGAGGG + Intronic
963231703 3:142914917-142914939 GGCACTAATCCCATTCATGAGGG + Intergenic
963278143 3:143353372-143353394 GGCACTAATCCCATTCATGAGGG - Intronic
963334343 3:143955806-143955828 GCACCTAATCCTATTTATGAGGG + Intergenic
963579237 3:147103414-147103436 GCAAATAACCCTATTGAAAATGG - Intergenic
963639394 3:147839683-147839705 GGCACTAATTCTATTCATGACGG + Intergenic
963892372 3:150650152-150650174 GGCACTAATCCCATTCATGAAGG - Intergenic
964224626 3:154383810-154383832 GGCACTAATCCTACTCATGAGGG - Intronic
964492400 3:157250751-157250773 GGCACTAATCCCATTCATGAGGG + Intergenic
965241882 3:166211626-166211648 GCGACTAATCCCATTCATTACGG - Intergenic
965307159 3:167080611-167080633 GGCACTAATCCTAATCATGAGGG + Intergenic
965618978 3:170623329-170623351 GCAAATAAACCTCTGCAAGAAGG + Intronic
965756415 3:172032212-172032234 GCCACTAATCCCATGCATGAGGG - Intergenic
966083954 3:176043695-176043717 GGCACTAATTCCATTCAAGAGGG + Intergenic
966084523 3:176053037-176053059 GTATCTAATGCTATTCATGAAGG - Intergenic
966174264 3:177118588-177118610 GCAACTAAGCCTCATAAAGAAGG - Intronic
966226688 3:177605459-177605481 GGCACTAATCCCATTCAAGAGGG - Intergenic
966380630 3:179341420-179341442 GGCACTAATCCCATTCATGAGGG - Intergenic
966541421 3:181094666-181094688 GATACTAATCCCATTCATGAGGG + Intergenic
966763350 3:183436552-183436574 GGCACTAATCCCATTCATGAGGG - Intergenic
967248403 3:187512570-187512592 GGCACTAATCCAATTCAAGAGGG + Intergenic
967604763 3:191432362-191432384 GGCACTAATCCTACTTAAGAGGG + Intergenic
968333610 3:197893500-197893522 GCACTAAATCCTAGTCAAGAAGG + Intronic
969093332 4:4713279-4713301 GACACTAATCCCATTCAGGAGGG + Intergenic
969999690 4:11352533-11352555 GGCACTAATCCTATTCATGCAGG + Intergenic
970113831 4:12670383-12670405 GGCACTAATCCCATTCATGAGGG - Intergenic
970340068 4:15096914-15096936 GGCACTAATCCCATTCATGAGGG - Intergenic
970361483 4:15312647-15312669 GACACTAATCCCATTCATGAGGG - Intergenic
970447196 4:16134189-16134211 GGCACTAATCCCATTCATGATGG - Intergenic
970501332 4:16680085-16680107 GGCACTAATCCTATTCACGAGGG - Intronic
970501981 4:16687291-16687313 GGCACTAATCCCATTCATGAGGG - Intronic
970568938 4:17360547-17360569 GGAACTAATCCCATTCACGAGGG + Intergenic
970675762 4:18448596-18448618 GGCACTAATCCCATTCATGAGGG - Intergenic
970698314 4:18704510-18704532 GGGACTAATCCCATTCATGACGG + Intergenic
970778843 4:19710731-19710753 GGCACTAATCCTATTCATGAGGG - Intergenic
970797097 4:19926004-19926026 GCACCTAATCCCTTTCATGATGG - Intergenic
971303701 4:25462650-25462672 GACACTAATCCCATTCATGAGGG + Intergenic
971450785 4:26799608-26799630 GGCACTAATCCCATTCATGAGGG - Intergenic
971460672 4:26892419-26892441 AGCACTAATCCTATTCAAGACGG + Intronic
971563875 4:28115087-28115109 GCCACTAATCTCATTCATGAGGG - Intergenic
971974977 4:33673037-33673059 GGCACTAATCCCATTCAAGAGGG + Intergenic
972007815 4:34133371-34133393 GTCACTAATCTCATTCAAGAGGG + Intergenic
972182006 4:36478584-36478606 GACACTAATCCTATTCATGAGGG - Intergenic
972383044 4:38536701-38536723 GGCACTAATCCCATTCATGAGGG - Intergenic
972624012 4:40778470-40778492 GGCACTAATCCCATTCATGAGGG - Intronic
972822399 4:42716759-42716781 GGCACTAATCCCATTCATGAGGG - Intergenic
973073601 4:45895965-45895987 GGCACTAATTCTATTCATGATGG + Intergenic
973290217 4:48463652-48463674 GGCACTAATCCTATTCATGAGGG + Intergenic
973571202 4:52241477-52241499 GGCACTAATCCCATTCATGAGGG + Intergenic
973576141 4:52291237-52291259 GGCACTAATCCCATTCATGAGGG + Intergenic
973582063 4:52353871-52353893 GGCACTAATCCCATTCATGAGGG + Intergenic
973596628 4:52498090-52498112 GGCACTAATTCTATTCATGAAGG - Intergenic
973746092 4:53964900-53964922 AGCACTAATCCTATTCAAGAGGG - Intronic
973755349 4:54068320-54068342 GGCACTAATCCCATTCATGAGGG - Intronic
973855054 4:55002871-55002893 GGCACTAATCCCATTCATGAGGG - Intergenic
974175062 4:58310742-58310764 CCAAGTAATCTTATTCAAGAAGG - Intergenic
974488956 4:62539321-62539343 GGAACTAATCCTGTTTATGAAGG + Intergenic
974572817 4:63676141-63676163 AGCACTAATCCTATTCATGAGGG - Intergenic
974584952 4:63861713-63861735 GGAACTAATCTCATTCACGAGGG - Intergenic
974821772 4:67075748-67075770 GGCACAAATCCTATTCATGAAGG - Intergenic
975531838 4:75407515-75407537 GGTACTAATCCTATTCATGAGGG + Intergenic
975611283 4:76206072-76206094 AGAACTAATCCCATTCGAGAGGG - Intronic
975705399 4:77107432-77107454 GCAAGTAACCCTATTAAAAATGG + Intergenic
975713920 4:77187640-77187662 GCTATTAATCCCATTCATGAGGG - Intronic
975905413 4:79205439-79205461 CCAAATAATCCTATTAAAAAGGG - Intergenic
975974785 4:80082251-80082273 GACACTAATCCCATTCATGAGGG + Intronic
976179239 4:82383483-82383505 GGCACTAATCCCATTCATGAGGG + Intergenic
976329420 4:83812386-83812408 GCCACTAATCCCATTTATGAAGG - Intergenic
976356276 4:84121154-84121176 AAAAATCATCCTATTCAAGAAGG - Intergenic
976442636 4:85093183-85093205 GGCACTAATCCTATTCATGAAGG + Intergenic
976598707 4:86918127-86918149 GGCACTAATCCCATTCATGAGGG + Intronic
976605887 4:86982537-86982559 GGCACTAATCCCATTCATGAAGG - Intronic
976668778 4:87628730-87628752 GGCACTAATCCCATTCATGAGGG - Intergenic
976982710 4:91251323-91251345 GGCACTAATTCTATTCATGAAGG + Intronic
977141933 4:93384175-93384197 GGAGCTAATCCTATTCATGAGGG + Intronic
977335918 4:95699386-95699408 GAAACTAATCATAATCATGATGG - Intergenic
977421302 4:96803269-96803291 GGAACTAATGCCATTCATGAGGG - Intergenic
977627203 4:99200372-99200394 GTAACTACTCCTATTCCAAAAGG + Intergenic
977960483 4:103079182-103079204 GACACTAATCCTGTTCATGAGGG - Intronic
978156001 4:105489808-105489830 GGCACTAATCCCATTCATGAAGG - Intergenic
978204453 4:106063737-106063759 GGTACTAATTCTATTCATGAAGG - Intronic
978494958 4:109348751-109348773 GGCACTAATCCTATTCATGAGGG - Intergenic
978827859 4:113046485-113046507 GCCACTTATCCCATTCACGAGGG - Intronic
979264139 4:118682178-118682200 GTACCTAATCCCATTCATGAGGG + Intergenic
979348029 4:119612172-119612194 GGCACTAATCCTATTTATGAGGG - Intronic
979723752 4:123935038-123935060 GACACTAATCCCATTCATGATGG + Intergenic
979987404 4:127331958-127331980 GCACCTAATCCCATTCATGAGGG + Intergenic
980196840 4:129600334-129600356 GGCACTAATCCCATTCATGAGGG - Intergenic
980742948 4:136975272-136975294 GATACTAATACTATTCATGAGGG + Intergenic
980967769 4:139539779-139539801 GGCATTAATCCCATTCAAGAGGG - Intronic
981535082 4:145791305-145791327 GGCACTAATCCTAGTCATGAGGG + Intronic
981572753 4:146170385-146170407 GGCACTAATCCCATTCATGAGGG - Intergenic
981578170 4:146226600-146226622 GCTACTAATCCCATTCATAAGGG + Intronic
981642756 4:146964102-146964124 GGCACTAATCCCATTCATGAGGG + Intergenic
981683844 4:147430882-147430904 GGCACTAATTCTATTCATGAAGG - Intergenic
981806782 4:148725131-148725153 GGCACTAATCCCATTCATGAGGG + Intergenic
981822777 4:148904606-148904628 GTACCTAATCCCATTCATGAAGG - Intergenic
982079777 4:151778152-151778174 GGCACTAATCCCATTCATGAGGG + Intergenic
982099599 4:151955043-151955065 GGCACTAATCCCATTCATGAGGG - Intergenic
982125958 4:152184112-152184134 GGCACTAATCCCATTCATGAGGG + Intergenic
982165198 4:152607858-152607880 GGCACTAATCCCATTCATGATGG - Intergenic
982241353 4:153302923-153302945 ACAACTTATCCTATTCAAATGGG - Intronic
982268595 4:153563967-153563989 GGTACCAATCCTATTCATGAAGG - Intronic
982374105 4:154669406-154669428 GCCAGTAATCATATTCACGAAGG + Intronic
983045555 4:162982668-162982690 GGCACTAATTCTATTCATGAGGG + Intergenic
983838816 4:172429093-172429115 GGAACTAATCCTATTCATGAAGG + Intronic
983849691 4:172565133-172565155 GCCACTAATCCCATTTATGAAGG + Intronic
983956594 4:173705407-173705429 GGCACTAATCCCATTCATGAGGG - Intergenic
984281120 4:177672031-177672053 GTCACTAATCCCATTCATGAGGG + Intergenic
984319044 4:178167882-178167904 GGCACTAATCCTATTCATGAGGG - Intergenic
984337454 4:178410980-178411002 GGCACTAATCCCATTAAAGAGGG - Intergenic
984546319 4:181108424-181108446 GGCACTAATCCCATTCATGAAGG + Intergenic
984600373 4:181719578-181719600 GGCACTAATCCCATTCATGAAGG + Intergenic
984760835 4:183361304-183361326 GCACCTAATCTCATTCATGATGG - Intergenic
985005015 4:185525726-185525748 GGCACTAATCCCATTCATGAGGG - Intronic
985729406 5:1538976-1538998 GACACTCATCCTATTCATGAAGG + Intergenic
985818640 5:2145251-2145273 GGCACTAATCCCATTCAGGAGGG + Intergenic
985964331 5:3328453-3328475 GGCACTAATCCCATTCATGAGGG - Intergenic
986261206 5:6147965-6147987 GCAGCTAATCCCATTCATGAGGG + Intergenic
986348463 5:6855757-6855779 GGCACTAATCCCATTCATGAGGG + Intergenic
986627283 5:9734076-9734098 GGCACTAATCCTATTCATGAGGG - Intergenic
986862180 5:11939557-11939579 GGCACTAATCCCATTCATGAGGG + Intergenic
986870830 5:12043785-12043807 GAAACTAATCCCATTCATGAGGG - Intergenic
987143551 5:14969247-14969269 GGCACTAATCCCATTCATGAGGG + Intergenic
987299766 5:16586976-16586998 GGCACTAATCCCATTCATGAGGG + Intronic
987333435 5:16876961-16876983 GGCACTAATCCCATTCATGAAGG - Intronic
987868300 5:23575009-23575031 GGCACTAATCCTATTCATGAGGG + Intergenic
988025727 5:25686376-25686398 GGCACTAATCCTATTCAACAGGG + Intergenic
988203416 5:28099441-28099463 GCATCTAATGCCATTCATGAAGG - Intergenic
988227772 5:28434953-28434975 GACACAAATCCCATTCAAGAGGG - Intergenic
988239855 5:28595969-28595991 GGCACTAATTCTATTCATGAGGG + Intergenic
988283717 5:29184750-29184772 GGCACTAATCTTATTCAAAAAGG + Intergenic
988348056 5:30065897-30065919 AGCACTAATCCTATTCATGAGGG + Intergenic
988515384 5:31899761-31899783 GGCACTAATCCCATTCATGAGGG - Intronic
988655252 5:33204283-33204305 GGCACTAGTCCTATTCATGAGGG - Intergenic
988777914 5:34493774-34493796 GGCACTAATCCCATTCATGAGGG - Intergenic
988821222 5:34888073-34888095 GGCACTAATCCCATTCATGAAGG - Intronic
989154835 5:38334472-38334494 GGAACTAATCCTGTTCATGAGGG + Intronic
989315422 5:40072314-40072336 GCACCTAATCTCATTCATGAGGG - Intergenic
989399634 5:40994823-40994845 GGCACTAATCCCATTCATGAGGG - Intergenic
989450432 5:41580919-41580941 GGCACTAATCCCATTCATGAGGG + Intergenic
989626258 5:43432037-43432059 GGTACTAATCCCATTCATGAGGG + Intergenic
989782879 5:45290312-45290334 GGCACTAATCCTATTCATCAGGG + Intronic
990033438 5:51290027-51290049 GACACTAATCCTATCCAAGAGGG + Intergenic
990058110 5:51611203-51611225 GGCACTAATCCAATTCACGAGGG - Intergenic
990199306 5:53353385-53353407 GTCACTAATCCTATGCATGAGGG + Intergenic
990377225 5:55183612-55183634 GGCACTAATCCCATTCATGAGGG + Intergenic
990392704 5:55342943-55342965 GATACTATTCCTATTCCAGACGG - Intronic
990435455 5:55786017-55786039 GCAATTAATTCTATTATAGATGG - Intronic
990639451 5:57765326-57765348 GACACTAATCCCATTCATGAAGG + Intergenic
990949655 5:61286155-61286177 GGCACTAATCCCATTCATGAGGG + Intergenic
990958202 5:61364778-61364800 GACACTAATCCCATTCATGAGGG + Intronic
991322092 5:65385035-65385057 GGCACTAATCCCATTCATGAAGG + Intronic
992154638 5:73943001-73943023 GGCACTAATCCCATTCATGAGGG - Intergenic
992363048 5:76062293-76062315 GCACCTAATCCCATTCACAAGGG - Intergenic
992365846 5:76088537-76088559 GGCACTAATCCCATTCATGAGGG + Intronic
992521293 5:77554414-77554436 AGCACTAATCCTATTCACGAGGG - Intronic
992646965 5:78820012-78820034 GGCACTAATCCTATCCATGAGGG - Intronic
993168702 5:84387854-84387876 GGAACTAATCCCATTCATGAGGG - Intergenic
993299892 5:86195041-86195063 GCACCATATCCTATTCAAGTTGG + Intergenic
993453857 5:88105032-88105054 GCCACTAATTTTATTCATGAAGG - Intergenic
993825784 5:92684934-92684956 GGCACTAATCCCATTCATGAGGG + Intergenic
993978349 5:94511043-94511065 GACACTAATCCCATTCATGAGGG - Intronic
994090442 5:95805316-95805338 GGCACTAATCCCATTCATGAGGG + Intronic
994223744 5:97228009-97228031 GGCACTAATCCCATTCATGAGGG + Intergenic
994327325 5:98463618-98463640 GGCACTAATCCTGTTCATGAGGG - Intergenic
994564017 5:101417195-101417217 GGGACTAATCCCATTCATGATGG + Intergenic
994965469 5:106664283-106664305 GGAACTAATCCCATTTATGAGGG + Intergenic
995280641 5:110331711-110331733 GGCACTAATCCCATTCATGAGGG - Intronic
995430429 5:112068752-112068774 GAAACTACTCCTTTTCAAGTTGG - Intergenic
995463918 5:112431258-112431280 GCAGCTGATCCTCTTCAAGCAGG + Intergenic
995755493 5:115499246-115499268 GGCACTAATCCCATTCATGAGGG + Intergenic
996049047 5:118910927-118910949 GGCACTAATCCAATTCATGAAGG + Intronic
996178683 5:120391857-120391879 GGCACTAATCCCATTCATGAGGG - Intergenic
996214016 5:120845824-120845846 GGCACTAATCCCATTCATGAAGG - Intergenic
996226599 5:121007037-121007059 GCCACTAATCCCATTCACAAGGG + Intergenic
996571875 5:124940511-124940533 GGCACTAATCCCATTCAGGAGGG + Intergenic
996645905 5:125816758-125816780 GGCACTAATCCCATTCATGAGGG + Intergenic
996764316 5:127020527-127020549 GGCACTAATCCCATTCAGGAGGG - Intronic
997043075 5:130280261-130280283 GTTACTAATCCCATTCATGAGGG - Intergenic
997050463 5:130373960-130373982 GGAACTTATCCCATTCATGATGG - Intergenic
997709883 5:135995411-135995433 GTATCTAATCTTATTCATGAAGG - Intergenic
997847032 5:137296030-137296052 GGCACTAATCCCATTCATGAGGG - Intronic
997901001 5:137764233-137764255 GGCACTAATCCCATTCATGAGGG - Intergenic
998068295 5:139176708-139176730 GGCACTAATCCTATTCATGAGGG + Intronic
998458466 5:142291920-142291942 GTCACTAATCCTATTCATAAGGG + Intergenic
998585513 5:143422549-143422571 GGCACTAATCCCATTCATGAGGG - Intronic
999288616 5:150408826-150408848 GCACCTAATCCCATTCGTGAGGG - Intronic
999441009 5:151600848-151600870 GGCACTAATCCCATTCATGAGGG - Intergenic
999698858 5:154209662-154209684 GGCACTAATCCCATTCACGATGG + Intronic
999805814 5:155080273-155080295 GGCACTGATCCTATTCATGAGGG + Intergenic
999945898 5:156595231-156595253 GACACTAATCCCATTCATGAGGG - Intronic
999962706 5:156774458-156774480 AGCACTAATCCTATTCACGAGGG + Intergenic
1000845563 5:166275445-166275467 GACACTAATCCTGTTCATGAAGG - Intergenic
1001321203 5:170683435-170683457 GCAAGTAATCCAGTTCCAGATGG + Intronic
1001511451 5:172325695-172325717 GCAACTAATTCCATTCATGAGGG + Intronic
1001541024 5:172539481-172539503 GACACTAATCCTATTCATGAGGG - Intergenic
1001630405 5:173170831-173170853 GGCACTAATCCCATTCATGAGGG - Intergenic
1001836823 5:174839640-174839662 GGCACTAATCCCATTCATGAGGG - Intergenic
1002667266 5:180834129-180834151 GCCACTAATCCCACTCATGAGGG - Intergenic
1003613017 6:7630283-7630305 GGCACTAATCCCATTCATGAGGG - Intergenic
1003787842 6:9506994-9507016 GGCACTAATCCCATTCAAGAGGG + Intergenic
1003846886 6:10183049-10183071 GGCACTAATCCCATTCATGAGGG - Intronic
1003947628 6:11089883-11089905 GGTACTAATCTCATTCAAGAGGG - Intergenic
1004072099 6:12309167-12309189 GGCACTAATCCCATTCATGAGGG - Intergenic
1004764423 6:18709419-18709441 AGCACTAATCCTATTCATGAAGG + Intergenic
1005129735 6:22492325-22492347 GGCACTAATCCCATTCAAAAAGG - Intergenic
1005429427 6:25739303-25739325 GGAACTAATCTCATTCATGAGGG + Intergenic
1005472351 6:26173487-26173509 GAAAGTACTCCTATTCAACACGG - Intergenic
1005596530 6:27383650-27383672 GGCACTAATCCTATTAATGAGGG + Intronic
1007008846 6:38395107-38395129 GGAACTAATCTCATTCATGAGGG - Intronic
1007311793 6:40952530-40952552 GGCACTAATGCTATTCATGAGGG - Intergenic
1007944995 6:45818131-45818153 GGCACTAATCCCATTCATGAGGG - Intergenic
1008352193 6:50505048-50505070 GCAAATAATCCTGTTAAAAATGG + Intergenic
1008372628 6:50751654-50751676 GGCACTAATCCTATTCATGAGGG + Intronic
1008644085 6:53495514-53495536 GACACTAATCCCATTCATGAGGG - Intergenic
1008679062 6:53853129-53853151 GGCACTAATCCCATTCATGAGGG + Intronic
1008810157 6:55486989-55487011 GGAACTAATTCTATTCATGGAGG + Intronic
1008869978 6:56261457-56261479 GGCACTAATCCCATTCATGAGGG - Intronic
1009041778 6:58188932-58188954 GGCACTAATCCCATTCATGAGGG + Intergenic
1009217628 6:60943195-60943217 GGCACTAATCCCATTCATGAGGG + Intergenic
1009349502 6:62656526-62656548 GGTACTAATCCTATTCATAAGGG + Intergenic
1009556050 6:65168547-65168569 GACACTAATCCTATTCATGAGGG + Intronic
1009594360 6:65715300-65715322 CCCACTAATCATATTCATGAGGG + Intergenic
1009790431 6:68394561-68394583 GGCACTAATCCCATTCATGAGGG + Intergenic
1009893177 6:69713873-69713895 GCAACAAAACCTTTTCAGGATGG + Intronic
1009929819 6:70163967-70163989 GGCACTAATCCTATTCATGAAGG + Intronic
1010085546 6:71913559-71913581 ACAGCTAATCCTATTTAAAATGG + Intronic
1010278335 6:73994696-73994718 GGCACTAATCCCATTCATGAGGG + Intergenic
1010308162 6:74349364-74349386 GCAACTAATCCCATTCAGAAGGG + Intergenic
1010527043 6:76913717-76913739 GCTAATAATCCTATTAAAAATGG + Intergenic
1010554845 6:77266219-77266241 GGCACTAATCCCATTCATGAGGG + Intergenic
1010731033 6:79391561-79391583 GGCACTAATCCCATTCATGAGGG + Intergenic
1010882315 6:81193194-81193216 GGCACTAATCCCATTCAAAAAGG + Intergenic
1010930902 6:81801744-81801766 GACACTAATCCCATTCAGGAGGG - Intergenic
1011003949 6:82622825-82622847 GGCACTAATCCCATTCATGAGGG - Intergenic
1011545409 6:88477477-88477499 GTTACTAATCCTTTTCTAGAAGG - Intergenic
1012298531 6:97555118-97555140 GCAATTAATCCTATTAACCAAGG - Intergenic
1012352070 6:98264209-98264231 GACACTAATCCTATTCATGAGGG + Intergenic
1012357490 6:98333685-98333707 GGCACTAATCTTATTCATGAAGG + Intergenic
1012412013 6:98969408-98969430 GGCACTAATCCTATTCATGAGGG + Intergenic
1013374993 6:109506022-109506044 GGCACTAATCCCATTCATGAGGG + Intronic
1013448120 6:110251780-110251802 GCACCTAATCCCATTCATGCAGG + Intronic
1013478171 6:110529068-110529090 GACACTAATCCCATTCATGAGGG - Intergenic
1013499952 6:110739245-110739267 GGAACTAATTCCATTCATGAGGG - Intronic
1013632062 6:111995577-111995599 GGCACTAATCCCATTCATGAAGG + Intergenic
1013715355 6:112954570-112954592 GGCACTAATCCCATTCATGAGGG - Intergenic
1013823686 6:114185297-114185319 GGTACTAATTCTATTCATGAGGG - Intronic
1013879838 6:114883849-114883871 GCAAATAACCCTATTAAAAAGGG + Intergenic
1013996074 6:116309839-116309861 GCACCTAATCCAATTCATGAGGG + Intronic
1014121951 6:117736145-117736167 GGCACTAATCCCATTCATGAGGG - Intergenic
1014526069 6:122503100-122503122 GACACTAATTCTATTCAGGAGGG + Intronic
1014653084 6:124065474-124065496 GGTACTAATCCTATTCATGAGGG - Intronic
1015399690 6:132775109-132775131 GATACTAATTCTATTCATGAAGG - Intronic
1015613327 6:135049299-135049321 GAAATTAATCCCATTCATGAGGG + Intronic
1015770157 6:136760649-136760671 GGCACTAATCCCATTCATGAGGG - Intronic
1015985490 6:138880360-138880382 GCACCTGATCCCATTCATGAAGG + Intronic
1016019426 6:139220102-139220124 GGCACTAATCCCATTCATGAGGG - Intergenic
1016133411 6:140506724-140506746 GGCACTAATCCCATTCATGAGGG - Intergenic
1016239358 6:141910578-141910600 GGCACTAATCCTATTCATGAAGG + Intergenic
1016265407 6:142227446-142227468 GGCACTAATCCCATTCATGAAGG + Intergenic
1016285566 6:142468906-142468928 GGCACTAATCCTATTCATGAGGG + Intergenic
1016371851 6:143382966-143382988 GGCACTAATCCCATTCATGAGGG + Intergenic
1016597502 6:145817698-145817720 GCATCTAATCCCATTCATTAGGG + Intergenic
1016777886 6:147925179-147925201 GGCACTAATCCTATTCATAAGGG - Intergenic
1016793572 6:148093016-148093038 GACACTAATCCCATTCATGAGGG + Intergenic
1016926623 6:149356610-149356632 GCCACTAATCCCATTCATGTAGG + Intronic
1017155370 6:151318133-151318155 GACACTAATCCCATTCATGAGGG - Intronic
1017186977 6:151611520-151611542 AGCACTAATCCCATTCAAGATGG + Intronic
1017187497 6:151616859-151616881 GGCACTAATCTTATTCATGAGGG + Intronic
1017287637 6:152695118-152695140 GACACTAATCCCATTCATGAGGG - Intergenic
1017330680 6:153194869-153194891 GACACTAATCCCATTCATGAGGG - Intergenic
1017346759 6:153391805-153391827 GGCACTAATCCCATTCAAAAGGG - Intergenic
1017371477 6:153714281-153714303 GACACTAATCCTGTTCAACAGGG + Intergenic
1017459224 6:154633494-154633516 GGCACTAATCCCATTCATGAGGG - Intergenic
1017721130 6:157243917-157243939 GGCACTAATCCCATTCATGAAGG - Intergenic
1017852296 6:158315342-158315364 GCCACTAATCCCATACATGAGGG + Intronic
1018288693 6:162268297-162268319 GGCACTAATCCCATTCATGAAGG - Intronic
1018351598 6:162965528-162965550 GGGACTAATCCCATTCATGAAGG + Intronic
1018428479 6:163704274-163704296 GGAAGTAATCCTATTCATGAGGG - Intergenic
1018586359 6:165364262-165364284 GGAACTAATCCCATTCATGAGGG - Intronic
1019839256 7:3423080-3423102 GGGAATAATCCTAATCAAGAAGG + Intronic
1020333715 7:7045038-7045060 GCCACTATTCCCATTCATGAGGG + Intergenic
1020676074 7:11186391-11186413 GACACTAATCCTGTTCACGAGGG - Intergenic
1020684210 7:11273439-11273461 ATCACTAATCCTATTCATGAGGG + Intergenic
1020723542 7:11780182-11780204 AAAACTAATCGTATTCATGAGGG + Intronic
1020814741 7:12891551-12891573 GGCACTAATCCCATTCATGAGGG - Intergenic
1021399195 7:20190022-20190044 GGCACTAATCCTATTCATGAGGG + Intronic
1021550336 7:21864561-21864583 GCAGGAAATCCAATTCAAGAGGG - Exonic
1021767306 7:23962906-23962928 GGCACTAATCCCATTCACGAGGG - Intergenic
1021910445 7:25380693-25380715 GGCACTAATCCCATTCATGATGG - Intergenic
1021987021 7:26106914-26106936 AGCACTAATCCCATTCAAGACGG + Intergenic
1022349767 7:29556990-29557012 GATACTAATCCCATTCATGAAGG - Intergenic
1022371110 7:29772467-29772489 ACACCTAATCCCATTCATGAAGG + Intergenic
1022421739 7:30229906-30229928 GACACTAATCCCATTCATGAGGG + Intergenic
1022525711 7:31035698-31035720 GTAACTAATCCCATTCATGAGGG + Intergenic
1022796785 7:33738067-33738089 GGCACTAATCCCATTCATGATGG - Intergenic
1022842811 7:34180819-34180841 GGCACTAATCCCATTCATGAGGG - Intergenic
1022843063 7:34182896-34182918 GGCACTAATTCTATTCATGAGGG - Intergenic
1022958467 7:35402504-35402526 GGCACTAATCCTGTTCAAGAGGG - Intergenic
1023724183 7:43125151-43125173 GGAACTAATGCCATTCATGAGGG + Intronic
1023900720 7:44476418-44476440 GCCACTACTCATATTCACGAGGG - Intronic
1024135210 7:46399778-46399800 GGCACTAATCCCATTCACGAGGG - Intergenic
1024335148 7:48199473-48199495 GGCACTAATCCTATTCACGAAGG + Intronic
1024364949 7:48509842-48509864 GCCATTAATCCCATTCAGGAGGG - Intronic
1024509039 7:50188358-50188380 GGCACTAATCCCATTCATGAGGG - Intergenic
1024930916 7:54665746-54665768 GGAACCAATCCCATTCATGAGGG - Intergenic
1025018996 7:55466025-55466047 GCCACTAATCCCTTTCATGAGGG - Intronic
1026111791 7:67464263-67464285 GGCACTAATCCCATTCATGAGGG + Intergenic
1026658310 7:72276469-72276491 GGCACTAATCCCATTCATGAGGG - Intronic
1026995663 7:74614384-74614406 GGCACTAATCCCATTCATGAAGG - Intergenic
1027569989 7:79853726-79853748 TGCACTAATCCTGTTCAAGAGGG - Intergenic
1027795210 7:82684233-82684255 GACACTAATCCCATTCATGAAGG + Intergenic
1027819209 7:83022111-83022133 GGCACTAATCCCATTCATGAGGG - Intronic
1028137043 7:87232809-87232831 GGTACTAATCCCATTCAAGAAGG - Intergenic
1028416784 7:90589164-90589186 GGCACTAATCCCATTCATGAGGG - Intronic
1028635462 7:92984411-92984433 GGCACTAATCCTATTCATGAAGG + Intergenic
1028896457 7:96047163-96047185 GATACTAATCCCATTCATGAGGG + Intronic
1028911228 7:96209632-96209654 TCAAATAATCCCATTTAAGATGG + Intronic
1029003477 7:97182024-97182046 GGCACTAATCCCATTCATGAGGG - Intergenic
1029502318 7:100939534-100939556 GGCACTAATCCCATTCATGAGGG - Intergenic
1029804438 7:102981746-102981768 GGCACTAATCCCATTCATGAGGG + Intronic
1029935672 7:104421889-104421911 GATACTAATCCCATTCATGAGGG - Intronic
1030267416 7:107634667-107634689 GCATCTAATCCCATTCACAAGGG + Intergenic
1030276803 7:107729911-107729933 GGCACTAATCCCATTCATGAGGG - Intergenic
1030605984 7:111639574-111639596 GACACTAATCTTATTCATGAGGG - Intergenic
1030740487 7:113103392-113103414 GGCACTAATCCCATTCATGAGGG + Intergenic
1030865993 7:114702392-114702414 GGCACTAATCCCATTCATGAGGG - Intergenic
1031161908 7:118179000-118179022 GGCACTAATCCTGTTCATGAGGG - Intergenic
1031237283 7:119192173-119192195 GGTACTAATCCCATTCATGAGGG + Intergenic
1031447116 7:121868371-121868393 GACATTAATCCTATTCACGAGGG - Intergenic
1031718318 7:125135828-125135850 GGCACTAATCCTATTAATGATGG - Intergenic
1031850468 7:126857122-126857144 GAAACTATGCCTATTCTAGAAGG + Intronic
1032669545 7:134070417-134070439 ACAACTAATCCTATTCCAACTGG + Intergenic
1032715671 7:134507124-134507146 GGCACTAATCCCATTCATGAAGG - Intergenic
1032881324 7:136093498-136093520 GGCACTAATCCCATTTAAGAGGG + Intergenic
1033153704 7:138938097-138938119 GACACTAATCCTGTTCATGAGGG - Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1033266242 7:139889744-139889766 AGCACTAATCCTGTTCAAGAGGG + Intronic
1033391535 7:140933180-140933202 GTCACTAATCCCATTCATGAGGG + Intergenic
1033665827 7:143439546-143439568 GACACTAATCCCATTCATGAGGG + Intergenic
1033730629 7:144175505-144175527 GACACTAATCCCATTCATGAGGG - Intergenic
1033773549 7:144581095-144581117 GGTACTAATCCCATTCATGAGGG - Intronic
1033846909 7:145444504-145444526 GGCACTAATCCCATTCATGAAGG + Intergenic
1033944811 7:146703712-146703734 GGCACTAATCCCATTCATGAAGG + Intronic
1034056864 7:148044533-148044555 GGCACTAATCCTGTTCATGAAGG - Intronic
1034100823 7:148448976-148448998 GGCACTAATCCCATTCAGGAGGG - Intergenic
1034522859 7:151633368-151633390 CTCACTAATCCTATTCAACATGG + Intronic
1035088381 7:156281433-156281455 GCACCTAATCCCATTCATGAGGG + Intergenic
1035851337 8:2922026-2922048 GGAATTAATCCCATTCATGAGGG - Intergenic
1036439213 8:8765527-8765549 GGCACTAATCCCATTCATGAGGG + Intergenic
1036586873 8:10132639-10132661 GGCACTAATCCCATTCATGATGG + Intronic
1036590249 8:10162275-10162297 GCCACCAATCCCATTCATGAAGG - Intronic
1036792919 8:11734808-11734830 GGTACTAATCCCATTCATGAGGG + Intronic
1036911765 8:12763432-12763454 GGCATTAATCCCATTCAAGAGGG + Intergenic
1037174931 8:15935859-15935881 GGCACTAATCCCATTCATGAGGG + Intergenic
1037625735 8:20605336-20605358 GGCACTAATCCTATTCAGGAGGG - Intergenic
1038159740 8:25025200-25025222 GGCACTAATCCCATTCATGAGGG + Intergenic
1038161765 8:25046387-25046409 GGCACTAATCCCATTCATGAGGG - Intergenic
1038340531 8:26681631-26681653 GGCACTAATCCTATTCATGAGGG - Intergenic
1038394297 8:27235719-27235741 GGCACTAATCCCATTCATGAAGG - Exonic
1038512188 8:28148961-28148983 GTAACTAACCCCATTCATGAGGG - Intronic
1038697212 8:29817311-29817333 GGCACTAATCCTATTTATGAGGG - Intergenic
1038731666 8:30133535-30133557 GCAAATTCTCCTATTCAGGATGG - Intronic
1039660531 8:39457749-39457771 AACACTAATCCCATTCAAGAAGG + Intergenic
1039778385 8:40759431-40759453 GGTACTAATCCCATTCATGAGGG - Intronic
1040406067 8:47104197-47104219 GGCACTAATCCCATTCATGAGGG - Intergenic
1040723772 8:50356674-50356696 GCCTCTAATCCCATTCATGAAGG + Intronic
1040859657 8:51985992-51986014 GAAACTAATCCCATTCATAAGGG - Intergenic
1040871491 8:52104207-52104229 GGCACTAATCCTATTCTTGAGGG - Intergenic
1041290750 8:56306184-56306206 GGCACTAATCCCATTCATGAGGG - Intronic
1041742801 8:61175257-61175279 GGCACTAATCCCATTCATGAGGG - Intronic
1041748054 8:61230948-61230970 AGTACTAATCCTATTCATGAGGG + Intronic
1041862394 8:62529496-62529518 GGCACTAATCCCATTCAGGAGGG - Intronic
1041909316 8:63071693-63071715 GGCACTAATCCCATTCATGAGGG - Intronic
1042096040 8:65217067-65217089 GACACTAATCCCATTCATGATGG - Intergenic
1042605859 8:70545875-70545897 GCCACTAATCCCATTCGTGAGGG + Intergenic
1042659681 8:71140898-71140920 GGCACTAATCCCATTCATGAGGG + Intergenic
1042691860 8:71508582-71508604 GCCACTAATCCCATTCAGGAGGG - Intronic
1042739772 8:72030262-72030284 GGAACTAATTCCATTCATGAGGG + Intronic
1042786826 8:72557022-72557044 GACACTAATCCCATTCATGAGGG + Intronic
1042865417 8:73352723-73352745 GACACTAATCCTATTCATGAGGG - Intergenic
1042997660 8:74718816-74718838 GGAACTAATCCTATTCATGAGGG + Intronic
1043056220 8:75443066-75443088 GGAACTAATCCCATTCTCGAAGG - Intronic
1043374537 8:79633667-79633689 GACACTAATCCCATTCATGAAGG + Intronic
1043602568 8:81958385-81958407 GGCACTAATCCCATTCATGAGGG - Intergenic
1043715626 8:83481904-83481926 GGCACTAATCCCATTCATGAGGG - Intergenic
1043940217 8:86188594-86188616 GGCACTAATCCTATTTACGAGGG + Intergenic
1044025307 8:87162904-87162926 GGACCTAATCCAATTCAGGAGGG - Intronic
1044725659 8:95192394-95192416 GGCACTAATCCCATTCAGGAGGG - Intergenic
1045442440 8:102227855-102227877 GGCACTAATCCTATTCATGAGGG + Intronic
1045730505 8:105233996-105234018 GTAACTACTCTTATTCAATATGG - Intronic
1046060059 8:109128377-109128399 GACACTAATCCTGTTCATGAGGG + Intergenic
1046381874 8:113461346-113461368 GACACTAATCCCATTCATGAGGG - Intergenic
1046454909 8:114445915-114445937 GCAAATAATCCCATTAAAAATGG + Intergenic
1046509040 8:115175683-115175705 GGCACTATTCCTATTCATGAGGG - Intergenic
1046622001 8:116538054-116538076 GACACTAATCCCATTCAGGAGGG - Intergenic
1046902349 8:119536832-119536854 GGCACTAATCCCATTCATGAGGG - Intergenic
1046953372 8:120039136-120039158 GGCACTAATCCCATTCATGAGGG - Intronic
1047046907 8:121064027-121064049 GGCACTAATCCCATTCATGAGGG + Intergenic
1047611785 8:126528169-126528191 GGAACAAATCCCATTCATGAAGG + Intergenic
1047820673 8:128516732-128516754 GGCACTAATCCCATTCATGAGGG - Intergenic
1047846396 8:128810272-128810294 GTTACTAATCCTATTCCTGAGGG - Intergenic
1047896184 8:129368959-129368981 GGCACTAATCCCATTCATGAGGG - Intergenic
1048071465 8:131026198-131026220 GACACTAATCCCATTCATGAAGG - Intronic
1048234672 8:132677914-132677936 GCATCTAATCCTATTCATGAGGG + Intergenic
1048642748 8:136382699-136382721 GCACCTAATGCCATTCATGAGGG - Intergenic
1048841805 8:138573096-138573118 GGCACTAATCCCATTCATGAGGG + Intergenic
1049135471 8:140894149-140894171 GGCACTAATCCCATTCATGAGGG - Intronic
1049490808 8:142900703-142900725 GCACCTAATCCCATTCACGAGGG - Intronic
1050025554 9:1331181-1331203 GCACCTAATCCCATTCATGAGGG - Intergenic
1050272292 9:3959180-3959202 GGCATTAATCCCATTCAAGAGGG - Intronic
1050327507 9:4511379-4511401 GGCACTAATCCCATTCAGGAGGG + Intronic
1051550993 9:18329106-18329128 GGCACTAATCCCATTCATGAGGG - Intergenic
1051733111 9:20168513-20168535 GGAAGTAATCCAATTCAAAATGG + Intergenic
1051884248 9:21873448-21873470 GAAACTAATCTCATTCATGAAGG - Intronic
1051969077 9:22864928-22864950 GCCACTAATTCTATTCATGAGGG + Intergenic
1051970714 9:22884229-22884251 TGCACTAATCCTATTCATGAGGG + Intergenic
1052338900 9:27346078-27346100 GACACTAATCCCATTCATGAGGG - Intronic
1052427780 9:28327063-28327085 GGTACTAATCCCATTCATGAGGG - Intronic
1052949497 9:34197256-34197278 ATAAATAATCCTATTAAAGAAGG - Intronic
1053272255 9:36758518-36758540 GGCACTAATCCCATTCAGGAGGG - Intergenic
1055618200 9:78095056-78095078 GGCACTAATCCCATTCATGAGGG - Intergenic
1055728697 9:79258681-79258703 GGCACTAATCCCATTCATGAGGG - Intergenic
1056219290 9:84435544-84435566 GGCACTAATCCCATTCATGAGGG + Intergenic
1056335315 9:85562920-85562942 GGCACTAATCCCATTCAAGAGGG - Intronic
1056418872 9:86404213-86404235 GGCACTAATCCCATTCAAGAGGG - Intergenic
1056468904 9:86886222-86886244 GCCATTAATCCCATTCATGAGGG - Intergenic
1056693348 9:88826427-88826449 GGCACTAATCCCATTCATGAGGG - Intergenic
1056782158 9:89558819-89558841 GGCACTAATCCTGTTCATGAGGG + Intergenic
1057056270 9:91963642-91963664 GGAACTAATCCCATTCAGGAGGG - Intergenic
1057706341 9:97397740-97397762 GGCACTAATCCCATTCATGAGGG + Intergenic
1057754955 9:97826308-97826330 GTATCTAATCCCATTCATGAGGG - Intergenic
1057871102 9:98718442-98718464 GGCACTAATCCTATTCAAGAAGG + Intergenic
1058128821 9:101226629-101226651 GAAACTAATCCCATTTATGAGGG + Intronic
1058227550 9:102383901-102383923 GGCACTAATCCTATTCACAAGGG + Intergenic
1058335855 9:103828187-103828209 GGCACTAATCCCATTCATGAGGG - Intergenic
1058541275 9:106014930-106014952 GGCACTAATCCCATTCATGAGGG + Intergenic
1058794804 9:108487884-108487906 GGCACTAATCCCATTCATGAGGG + Intergenic
1058862415 9:109128935-109128957 GACACTAATGCTATTCATGAGGG + Intergenic
1059370193 9:113824428-113824450 GGCACTAATCCCATTCATGAAGG - Intergenic
1059613393 9:115923250-115923272 GGCACTAATCCCATTCATGAGGG + Intergenic
1059785595 9:117579313-117579335 GGCACTAATTCCATTCAAGACGG - Intergenic
1059999034 9:119941769-119941791 GGCACTAATCCCATTCATGAGGG - Intergenic
1060146025 9:121253117-121253139 GGCACTAATCCCATTCATGAGGG + Intronic
1060231981 9:121832050-121832072 GATGCTAATCCTATTCAATAAGG + Intronic
1185936394 X:4261887-4261909 GGAACTAATCTCATTCATGAGGG - Intergenic
1185942201 X:4334160-4334182 GACACCAATCCTATTCAATAAGG - Intergenic
1186281564 X:7998747-7998769 GGCACTAATCCCATTCATGAGGG - Intergenic
1186287426 X:8060587-8060609 GGCACTAATCCTATCCAGGAGGG - Intergenic
1186690103 X:11966282-11966304 GGCACTAATCCCATTCATGAGGG - Intergenic
1186951525 X:14630991-14631013 GCACCTAATTCCATTCATGAGGG + Intronic
1186988162 X:15038685-15038707 GACACTAATCCCATTCATGAGGG - Intergenic
1187092157 X:16107849-16107871 GACACTAATCCCATTCATGAAGG - Intergenic
1187178167 X:16915730-16915752 GACACTAATCCTGTTCATGAGGG - Intergenic
1187420640 X:19130702-19130724 GGCACTAATCCCATTCATGAGGG - Intergenic
1187603970 X:20862937-20862959 GTCACTAATCCCATTCATGAGGG - Intergenic
1187974584 X:24692479-24692501 GGCACTAATCCTATTCATGAGGG + Intergenic
1188083853 X:25879706-25879728 GACACTAATCCCATTCATGAAGG - Intergenic
1188315446 X:28667859-28667881 GGCACTAATCCCATTCATGAGGG + Intronic
1188691645 X:33136600-33136622 GGCACTAATCCCATTCATGAGGG - Intronic
1189074163 X:37898213-37898235 GGTACTGATCCCATTCAAGAGGG + Intronic
1189208768 X:39265115-39265137 GGCACTAATCCTATTTATGAGGG - Intergenic
1189397331 X:40634655-40634677 GCAACTAACCCTAAAGAAGATGG + Intronic
1189740155 X:44109502-44109524 GTCACTAATCCCATTCATGAAGG + Intergenic
1189880404 X:45485757-45485779 GCCACTAATCCCATTCATGAGGG - Intergenic
1190163969 X:48056220-48056242 GTCACTAATCCCATTCATGAGGG + Intronic
1190381960 X:49847739-49847761 GGCACTAATTCTATTCATGACGG + Intergenic
1190444626 X:50511432-50511454 GCCACTAATCCCATTCTTGAGGG - Intergenic
1190959323 X:55229518-55229540 GGCACTAATCCCATTCATGAGGG - Intronic
1191727321 X:64294779-64294801 GGAACTAATCCCATTCATGAGGG + Intronic
1192200618 X:69064356-69064378 GGCACTAATCCCATTCATGAGGG + Intergenic
1192252481 X:69424058-69424080 GGCACTAATTCTATTCATGAGGG - Intergenic
1192533001 X:71905412-71905434 GGCACTAATCCCATTCATGAGGG - Intergenic
1192577224 X:72252711-72252733 GACATTAATCCTATTCATGAGGG + Intronic
1192919105 X:75686620-75686642 AGCACTAATCCTTTTCAAGAGGG - Intergenic
1193299937 X:79878091-79878113 GTTACTAATCCCATTCATGAGGG - Intergenic
1193458643 X:81762203-81762225 GACACTAATCCTATTCACGAGGG + Intergenic
1193466376 X:81852724-81852746 GTAAATAATCTTATTCAAAAAGG + Intergenic
1194601127 X:95923115-95923137 GGCACTAATCCTATTCATGAGGG + Intergenic
1194668541 X:96702883-96702905 GTCACTAATCCCATTCATGAAGG + Intronic
1194699719 X:97098744-97098766 GGAACTAATCATATTCGTGAGGG + Intronic
1194931249 X:99889809-99889831 GCTGCTAATCTTATTCATGAGGG + Intergenic
1194957355 X:100196609-100196631 GGCACTAATCCCATTCATGAGGG - Intergenic
1194957584 X:100198697-100198719 GGCACTAATCCTATTCATGAGGG - Intergenic
1195116818 X:101707486-101707508 GGCACTCATCCTATTCATGAGGG + Intergenic
1195163952 X:102198856-102198878 GACACTAATCCCATTCATGAGGG - Intergenic
1195194909 X:102488239-102488261 GACACTAATCCCATTCATGAGGG + Intergenic
1195407784 X:104535609-104535631 GGTACTAATCCCATTCATGAGGG + Intergenic
1195462156 X:105139678-105139700 GGCACTAATCCCATTCATGAGGG + Intronic
1195577046 X:106463006-106463028 GCACCTACTCCCATTCATGAAGG + Intergenic
1195718683 X:107844104-107844126 GCCACTAATCCTAATCAGGGAGG - Intronic
1196005146 X:110828936-110828958 CAAACGAATCCTATTCATGAGGG + Intergenic
1196081966 X:111642118-111642140 GACACTAATCCTATTCATGAGGG + Intergenic
1196129608 X:112140634-112140656 GGCACTAATCCCATTCATGAGGG + Intergenic
1196251105 X:113460867-113460889 GGCACTAATCCCATTCATGAAGG + Intergenic
1196315119 X:114213310-114213332 GGCACTAATCCTATACATGAGGG + Intergenic
1196327274 X:114421576-114421598 GGCACTAATCCCATTCATGAGGG + Intergenic
1196404061 X:115346174-115346196 GGCACTAATCCCATTCATGAGGG - Intergenic
1196506320 X:116448013-116448035 ACTACTAATACTATTCAAAATGG + Intronic
1196576170 X:117321728-117321750 TCATCTCATCCTATTCAAAATGG - Intergenic
1196701078 X:118669555-118669577 GGTACTAATCCCATTCATGAGGG + Intronic
1196931299 X:120684445-120684467 GGCACTAATCCCATTCATGAGGG + Intergenic
1197377535 X:125699885-125699907 GCAAATAACCCTATTAAAAATGG + Intergenic
1197439901 X:126475554-126475576 GTAACTAATCCCATTCCAAATGG + Intergenic
1197563944 X:128057876-128057898 GGTACTAATCCCATTCATGAGGG - Intergenic
1197596029 X:128465104-128465126 GGCACTAATCCCATTCATGAGGG - Intergenic
1197800978 X:130348241-130348263 GGCACTAATCCTGTTCATGAGGG + Intronic
1198300789 X:135332414-135332436 GGCACTAATCCTATTCATGAGGG - Intronic
1198381852 X:136091406-136091428 GGCACTAATTCTATTCATGAGGG + Intergenic
1198463969 X:136888290-136888312 GGCACTAATCCCATTCATGATGG - Intergenic
1198546432 X:137697393-137697415 GCCACTAATCCCATCCATGAGGG - Intergenic
1198574058 X:137990720-137990742 GTCACTAATCCTATTCATGAGGG + Intergenic
1198591906 X:138192878-138192900 GGCACTAATCCAATTCAGGAGGG - Intergenic
1198673295 X:139104785-139104807 GCACTTAATCCCATTCATGAGGG + Intronic
1198851980 X:140974547-140974569 GGCACTAATCCTATTTATGAGGG - Intergenic
1199156675 X:144557469-144557491 GGCACTAATCCCATTCATGAGGG + Intergenic
1199231958 X:145446184-145446206 GGCACTAATCCTATTCATGGGGG - Intergenic
1199276622 X:145951310-145951332 GGCACTAATCTTATTCATGAAGG - Intergenic
1199279832 X:145988365-145988387 GGCACTAATCCTATTCATGCAGG - Intergenic
1199326334 X:146502734-146502756 GACGCTAATCCTATTCAGGAGGG + Intergenic
1199373583 X:147081528-147081550 GCAAATAATCCAATTTAAGGGGG + Intergenic
1199407072 X:147474729-147474751 GGAATTAATCCCATTCATGAGGG + Intergenic
1199688278 X:150284177-150284199 GTTACTAATCTTATTCATGATGG + Intergenic
1199986758 X:152958404-152958426 GCAACTAATAGTAGTCAAAATGG - Intronic
1200017051 X:153173871-153173893 GACACTAATGCTATTCATGACGG - Intergenic
1200180870 X:154150018-154150040 GGCACTAATCCCATTCATGAGGG + Intronic
1200186513 X:154187132-154187154 GGCACTAATCCCATTCATGAGGG + Intergenic
1200192165 X:154224270-154224292 GGCACTAATCCCATTCATGAGGG + Intronic
1200197920 X:154262074-154262096 GGCACTAATCCCATTCATGAGGG + Intronic
1200374426 X:155765051-155765073 AGAACTAATCCCATTCATGAGGG + Intergenic
1201451641 Y:14121870-14121892 GGCACTAATCCCATTCATGAAGG - Intergenic
1201673830 Y:16557073-16557095 GCCACTAATCCCATTCATAAGGG - Intergenic
1201720684 Y:17093803-17093825 GGAACTAATCCCATACATGAGGG - Intergenic
1202281552 Y:23196121-23196143 GCAACAAAGCCTCATCAAGATGG + Intronic
1202284339 Y:23222398-23222420 GCAACAAAGCCTCATCAAGATGG - Intronic
1202433224 Y:24810506-24810528 GCAACAAAGCCTCATCAAGATGG + Intronic
1202436014 Y:24836784-24836806 GCAACAAAGCCTCATCAAGATGG - Intronic