ID: 1179242933

View in Genome Browser
Species Human (GRCh38)
Location 21:39608108-39608130
Sequence TATCATGCCCACTGTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179242932_1179242933 9 Left 1179242932 21:39608076-39608098 CCATCTTTCTATAAGCTTTACAA 0: 1
1: 0
2: 2
3: 26
4: 330
Right 1179242933 21:39608108-39608130 TATCATGCCCACTGTGTAGATGG 0: 1
1: 0
2: 1
3: 27
4: 256
1179242931_1179242933 25 Left 1179242931 21:39608060-39608082 CCAGCATTTGGCTGCACCATCTT 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1179242933 21:39608108-39608130 TATCATGCCCACTGTGTAGATGG 0: 1
1: 0
2: 1
3: 27
4: 256
1179242930_1179242933 28 Left 1179242930 21:39608057-39608079 CCTCCAGCATTTGGCTGCACCAT 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1179242933 21:39608108-39608130 TATCATGCCCACTGTGTAGATGG 0: 1
1: 0
2: 1
3: 27
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179242933 Original CRISPR TATCATGCCCACTGTGTAGA TGG Intronic
902864717 1:19270450-19270472 GATCCTGCCCACTGTGTACCAGG - Intergenic
902866937 1:19285887-19285909 GATCCTGCCCACTGTGTACCAGG - Exonic
902869987 1:19308157-19308179 GATCCTGCCCACTGTGTACCAGG - Exonic
903697229 1:25216884-25216906 TACCATGCCCACTTTGAAGCAGG + Intergenic
904484895 1:30818137-30818159 CATCATCCCCACTTTGCAGATGG + Intergenic
904890110 1:33773482-33773504 CATCATGCCCACTGGGTTCAGGG - Intronic
905174880 1:36128980-36129002 TATTGTCCCCACTTTGTAGATGG + Intergenic
905514926 1:38555670-38555692 TATTATTCCCACTTTATAGATGG + Intergenic
907700280 1:56779718-56779740 TTTCATGCCCACTGTTTACTAGG + Intronic
908493118 1:64666346-64666368 TATCATTCCCATTTTATAGACGG - Intronic
908647957 1:66300157-66300179 TTTGATGCCCACTCTGTTGAAGG - Intronic
908682798 1:66681671-66681693 TATGATGCTCACTTTGTGGAGGG + Intronic
911705233 1:101003550-101003572 TATTATACCCATTTTGTAGAAGG - Intronic
912863416 1:113235492-113235514 GATCATTCCCACTGTATAAATGG + Intergenic
913190720 1:116410765-116410787 TATAATCCCCACTTTGCAGAGGG + Intergenic
913245934 1:116870101-116870123 TATCAAGCCTCCTGTGTAGCTGG + Intergenic
913317787 1:117567218-117567240 TCTCTTTCCCACTGTGTATATGG - Intergenic
915221999 1:154382194-154382216 TATTATGCCCATTTTTTAGATGG - Intergenic
918899535 1:190396116-190396138 TATTATTGCCATTGTGTAGATGG + Intronic
919351256 1:196456859-196456881 TATCATGCCTACTGTCTCCAGGG - Intronic
919471028 1:197979214-197979236 TTACATTCCCACTGCGTAGAGGG + Intergenic
919481022 1:198089056-198089078 TATCTTGACCATTCTGTAGAAGG + Intergenic
919978665 1:202628936-202628958 TATCATTCCCATTTTGCAGACGG - Intronic
920049775 1:203156594-203156616 TATCCTGACCACTGAGCAGAGGG - Intronic
921137146 1:212271885-212271907 AAACATGCCCAATGTGTATAAGG + Intergenic
921711869 1:218380956-218380978 TATTATCCCTACTTTGTAGATGG + Intronic
922080044 1:222287091-222287113 TATCATACCCATTTTATAGATGG + Intergenic
922696054 1:227731641-227731663 CATCATACCCAGTGTGAAGAGGG + Exonic
923539015 1:234875012-234875034 AATTATGCCCACTGTGGAAACGG - Intergenic
924088219 1:240476448-240476470 GATCATGCCCCATTTGTAGAGGG + Intergenic
1063812951 10:9735268-9735290 TAGCATTCCCATTCTGTAGAAGG + Intergenic
1064658946 10:17586308-17586330 TCTCATGCCCACTGTGTGTCAGG - Intergenic
1067851651 10:49758681-49758703 TGTCATTCCCACTGGGCAGATGG + Intronic
1068900296 10:62261303-62261325 TATCATGCCCACTGTAAGGAAGG + Intronic
1068967058 10:62923300-62923322 TTACATTCCCACTGTGTATAGGG - Intergenic
1070238028 10:74650741-74650763 TATCATGCCCAGTTTGTATATGG + Intronic
1071524671 10:86351503-86351525 TCTCATGCCTACTTTCTAGAGGG - Intronic
1074058014 10:109940297-109940319 TATCATCCCCATTTTGTAGATGG + Intergenic
1074210894 10:111334012-111334034 TAGGATGGCCACTGTGGAGATGG + Intergenic
1074855117 10:117467612-117467634 TATCATTCCCATTTTATAGATGG - Intergenic
1077529651 11:3089235-3089257 TATCAAGCCCACTTTACAGAGGG + Intronic
1078564109 11:12398669-12398691 TCTTATGCCCATTTTGTAGAAGG - Intronic
1078921381 11:15834120-15834142 TATTATCCCCACTTTATAGATGG + Intergenic
1079790538 11:24732868-24732890 TATTATTCCCATTTTGTAGATGG + Intronic
1081726463 11:45332874-45332896 TATTATGCCCACTGCACAGATGG - Intergenic
1085310397 11:75513221-75513243 TATCAGACCCACTTTATAGAAGG - Intronic
1086457880 11:86977269-86977291 TATGATCCCCATTGTGTAGATGG + Intergenic
1088332253 11:108665977-108665999 TATCATCCCCACATTGTAGCTGG + Intronic
1089582050 11:119487432-119487454 TATCATCTCCAGTGTGCAGATGG - Intergenic
1092486259 12:8904808-8904830 AAACATGCCCTCTGTGTACAAGG + Intergenic
1092731806 12:11541755-11541777 GAACATGCCCACTGTCTCGATGG - Intergenic
1093186985 12:16031307-16031329 TATTAAGCACACTGTGTATAAGG - Intronic
1093298052 12:17416350-17416372 TTTCATGCCCACTGTTCAGTGGG - Intergenic
1094434600 12:30407592-30407614 ATTCATGCACACTGTGGAGAGGG - Intergenic
1094500508 12:31016979-31017001 GAACATGCCCACTGTCTTGATGG + Intergenic
1095834979 12:46628105-46628127 TATCAGGGCCACTGTGATGAAGG + Intergenic
1097078311 12:56411040-56411062 CATCATGCCAACTGTGCAGCTGG - Intergenic
1097616393 12:61889081-61889103 CATTATGTCCACTCTGTAGACGG - Intronic
1097806286 12:63968425-63968447 GATAATGGCCACTGTGTAGGAGG - Intronic
1097900687 12:64870915-64870937 TGTCATGCCAGCTGTGTTGATGG - Intronic
1098428957 12:70398176-70398198 GATCCTGCCCACTGGGGAGATGG - Intronic
1098810888 12:75090115-75090137 TATCATTCCAACAGTCTAGATGG + Intronic
1099079693 12:78161179-78161201 TATCATCCCCACTTTTAAGAAGG - Intronic
1102013259 12:109631853-109631875 GATCATCCCCACTGTGCAGATGG - Intergenic
1103448459 12:121010463-121010485 TATCATTCCCACTGTACAGATGG - Intronic
1104003539 12:124875694-124875716 TCTCATTCCCACTGTGCAGAGGG - Intronic
1104411447 12:128561550-128561572 TAATATGCCCACTGCTTAGAAGG - Intronic
1104763590 12:131312835-131312857 CATCCTGCCCACTGTGCAGATGG + Intergenic
1104815910 12:131645242-131645264 CATCCTGCCCACTGTGCAGATGG - Intergenic
1105469087 13:20675376-20675398 TATCCAGCCCACTTTGTATACGG + Intronic
1106072896 13:26430657-26430679 TTTCATGCCTACTTTGTTGAGGG - Intergenic
1106139141 13:26996799-26996821 TATCATCCCCATTTTGCAGATGG - Intergenic
1107727102 13:43309768-43309790 TATCATGCTCAATATATAGAGGG - Intronic
1112226008 13:97541163-97541185 TATTATTCCCACTTTGCAGATGG + Intergenic
1116221734 14:42096276-42096298 TATCATGCCCAAAGTTCAGAGGG + Intergenic
1117333380 14:54736237-54736259 GATGTTGCCCACTGTGTAGAAGG + Intronic
1118437077 14:65781518-65781540 TATTATCCTCATTGTGTAGATGG + Intergenic
1118444530 14:65839295-65839317 TATCATCCCCATTTTATAGATGG + Intergenic
1119157682 14:72426512-72426534 TATTATTCCCATTTTGTAGATGG + Intronic
1119567815 14:75643728-75643750 TAGTATGGCCACTGTGGAGATGG + Intronic
1119873106 14:78033521-78033543 TCTCATGCCCATTGTTTAAAAGG - Intergenic
1121085879 14:91145760-91145782 TATCCTCCCCATTTTGTAGATGG + Intronic
1121743821 14:96272331-96272353 CATCATGCCCATTTTATAGATGG + Intergenic
1123726664 15:23109940-23109962 TATCCTGCCGGCTGTGAAGAAGG + Intergenic
1124348643 15:28939466-28939488 TATTATGCCAACAGTGTACAAGG + Intronic
1127308592 15:57731197-57731219 TGTTATTCCCACTATGTAGATGG - Intronic
1127548650 15:60015207-60015229 TATTATGCCCATTGTACAGATGG + Intronic
1127931688 15:63601152-63601174 TCTTATCCCCACTGTGCAGACGG - Intronic
1128990692 15:72257384-72257406 CATGACGCCCAGTGTGTAGAAGG + Exonic
1129176669 15:73845212-73845234 GACCATGCCCAGTGTGAAGAAGG + Intergenic
1129194892 15:73957933-73957955 TGTCATTCCCATTTTGTAGATGG + Intergenic
1129204931 15:74031906-74031928 TATTATTCCCACTTTATAGAGGG + Intronic
1129480741 15:75823607-75823629 TATCATTCCCACTTTACAGATGG - Intergenic
1130201428 15:81831378-81831400 TATTATTCCCACTTCGTAGATGG - Intergenic
1133383013 16:5346829-5346851 TATCATCCTCACTTTGCAGATGG - Intergenic
1134013310 16:10871140-10871162 TATCATCTCCACTTTATAGATGG - Intergenic
1134020987 16:10921562-10921584 TATCATGCCCATTTTACAGATGG + Intronic
1134690166 16:16185973-16185995 TAACATGCCCATTTTGGAGATGG + Intronic
1135194397 16:20382715-20382737 TATCTTCCCAACAGTGTAGAGGG + Intronic
1135711857 16:24724310-24724332 TATTATCCCCACTTTGCAGATGG - Intergenic
1138505489 16:57476335-57476357 TATCATCCCCATTTTATAGATGG + Intronic
1142216467 16:88832311-88832333 CATCATGCCCACTGAGGAAATGG + Intronic
1142530111 17:573681-573703 TATGATCCTCACAGTGTAGAGGG + Intronic
1144286518 17:13780147-13780169 TATTATGCCCACTTTCGAGATGG + Intergenic
1146553317 17:33800840-33800862 TATCATTACCACTGTATGGATGG + Intronic
1151174685 17:72277615-72277637 TATCATGCCCATTTTACAGATGG + Intergenic
1157159017 18:45295878-45295900 TATCATTCCCATTTTGCAGATGG - Intronic
1157916245 18:51666709-51666731 TATTATCCCCATTGTATAGATGG + Intergenic
1166066470 19:40362258-40362280 TACCATGCCCATTTTGCAGATGG + Intronic
1166392441 19:42416735-42416757 TTTCAAGCCCACTGTTGAGACGG + Intronic
1166658277 19:44627863-44627885 TATCATCCCCATTTTGCAGATGG - Intronic
1167348047 19:48958937-48958959 TATCATCCCCGCTCTGTAGGTGG - Intronic
1167660347 19:50792454-50792476 TGCCATCCCCACTGTGCAGATGG - Intronic
925189688 2:1872899-1872921 CATGATCCTCACTGTGTAGATGG + Intronic
926059589 2:9796743-9796765 TATTAACCACACTGTGTAGAAGG - Intergenic
926261271 2:11265058-11265080 TATTATGCCCATTGTACAGATGG - Intronic
926784627 2:16507893-16507915 CATCATGCCCACTTTGCAGGTGG + Intergenic
926854511 2:17240024-17240046 TAATATGCCAACTGTGTGGAAGG - Intergenic
927192118 2:20524048-20524070 GATTATGCCCAGTGTGCAGAAGG - Intergenic
928667390 2:33563359-33563381 TATCATAGCAACTGTGTAGTGGG - Exonic
928731684 2:34239068-34239090 TATTATCCCCATTGTGTAGATGG - Intergenic
932930088 2:76025510-76025532 TTTGATGCCTACTGTGTTGAGGG - Intergenic
933171485 2:79130696-79130718 TGTGATGCCCACTGTGTTTATGG + Intergenic
934507359 2:94904819-94904841 TATCATTCCCAATGTCCAGAGGG + Intergenic
934975450 2:98799122-98799144 ACTCAAGCACACTGTGTAGAAGG - Intronic
935710591 2:105894761-105894783 TATCATCCCCATTTTATAGATGG + Intergenic
936997360 2:118429553-118429575 TATCATACCCATTTTATAGATGG - Intergenic
937019353 2:118635946-118635968 TATTATGCTCATTTTGTAGATGG - Intergenic
938793117 2:134694066-134694088 TATCATCCCCACTTTGTAGATGG - Intronic
938832520 2:135066982-135067004 TTTCATACCCACTCAGTAGATGG + Intronic
939292399 2:140213206-140213228 CATCATGTCCCCTGTTTAGAAGG - Intergenic
942070918 2:172314579-172314601 TATGATGCCTACAGTGTACATGG + Intergenic
944291020 2:198005368-198005390 GATCATGCTCACTCTGTTGATGG + Intronic
946560676 2:220908931-220908953 TATTATCCCCATTGTGTAGATGG + Intergenic
946810145 2:223514864-223514886 TTACATGCCCACTGAGAAGATGG - Intergenic
947120179 2:226805780-226805802 GATCCTGCCCACTGAATAGAGGG - Intergenic
947907969 2:233779540-233779562 TATGATGTCCACTGTGCAGATGG - Intronic
1168816885 20:743753-743775 TATCTTTCCCACTGTATAGAGGG - Intergenic
1169429183 20:5521286-5521308 TATCTTGCCCAAGGTGAAGAGGG + Intergenic
1171739111 20:28839343-28839365 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171739163 20:28840368-28840390 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171757636 20:29127281-29127303 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171757956 20:29132991-29133013 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171758121 20:29136234-29136256 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171758285 20:29139481-29139503 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171758615 20:29145514-29145536 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171758668 20:29146539-29146561 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171758770 20:29148589-29148611 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171758916 20:29151493-29151515 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171759185 20:29156788-29156810 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171759358 20:29160207-29160229 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171759530 20:29163453-29163475 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171759677 20:29166188-29166210 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171759854 20:29169602-29169624 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171760012 20:29172847-29172869 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171760217 20:29177119-29177141 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171760385 20:29180365-29180387 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171760547 20:29183611-29183633 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171760714 20:29186855-29186877 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171760822 20:29189078-29189100 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171760985 20:29192322-29192344 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171761320 20:29198981-29199003 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171761433 20:29201204-29201226 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1171761527 20:29203253-29203275 TTTCAGGCCTACAGTGTAGAAGG + Intergenic
1172800457 20:37572849-37572871 TATCACCCCCACTTTGTAGATGG + Intergenic
1173462031 20:43250870-43250892 TATCCTGCCTACTTTCTAGATGG - Intergenic
1174912909 20:54625645-54625667 TATAATCCACACTTTGTAGAAGG - Intronic
1175126160 20:56753234-56753256 TCTCATCACCACTTTGTAGATGG - Intergenic
1175180189 20:57140906-57140928 TATTATCCCCATTTTGTAGATGG + Intergenic
1175215477 20:57389992-57390014 TCCCATCCCCACTGTGCAGAGGG + Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175578099 20:60077898-60077920 TATTATGCCCACTTTACAGATGG - Intergenic
1176657366 21:9599168-9599190 TATCAGGCTCATTGTGTGGAAGG + Intergenic
1179242933 21:39608108-39608130 TATCATGCCCACTGTGTAGATGG + Intronic
1183296553 22:37033138-37033160 TATTCAGCCCACTGTGTGGATGG - Intergenic
949826907 3:8175266-8175288 TATCATTCCCATTTTATAGAGGG + Intergenic
950119135 3:10470299-10470321 TTTCATGCCCATTATATAGATGG + Intronic
950202367 3:11054391-11054413 TATCATTCCCATTCTGCAGATGG + Intergenic
950230673 3:11272830-11272852 TATCATTCCCATTTTGCAGATGG - Intronic
951784933 3:26407250-26407272 GATCATGCTATCTGTGTAGACGG - Intergenic
953721196 3:45356675-45356697 TATCATGTCCGCTGAGAAGAGGG - Intergenic
953858530 3:46521608-46521630 GATAATGCCCAATGTGAAGATGG - Exonic
955064634 3:55523714-55523736 TTGCATGCCCACTGTGTGGCAGG - Intronic
955087957 3:55721227-55721249 CATTATGCCCACTTTGCAGATGG - Intronic
959787281 3:110315554-110315576 TATCATGCCCAGAGTCCAGATGG - Intergenic
960323992 3:116272496-116272518 TATCATGCCCACTGGCTAATAGG + Intronic
961383880 3:126513559-126513581 TATTATGCCCACTTTACAGATGG - Intronic
962482377 3:135808895-135808917 GATGATGCCCACTGTGAAGATGG + Intergenic
962727739 3:138249720-138249742 AATATTGCCCACTGGGTAGAGGG + Intronic
964653695 3:159042800-159042822 TATTATCCCCACTTTGCAGATGG + Intronic
966821867 3:183931259-183931281 TCTCCTGCCCACTGAGTAGCCGG + Intronic
969193480 4:5542666-5542688 TATCATCCCCATTTTATAGATGG - Intergenic
969196067 4:5564906-5564928 TATCATCCCCACTTTCTGGAAGG + Intronic
969444671 4:7237696-7237718 TATTATTCCCACTTTATAGATGG - Intronic
973801434 4:54482621-54482643 TATTATGCCCATTTTATAGATGG + Intergenic
974656671 4:64832754-64832776 TTTCATGCCGATTTTGTAGAGGG + Intergenic
976116851 4:81736900-81736922 TATCATGCCCTCTATTTGGATGG - Intronic
976909504 4:90283932-90283954 TTACATTCCCACTGTGTATAAGG + Intronic
977061474 4:92262850-92262872 TATCAAGAGCACTGTGTAGAGGG + Intergenic
978945776 4:114494384-114494406 CATCCTGCCCCCTGTGAAGAAGG - Intergenic
979320395 4:119316585-119316607 GATCATGAGCTCTGTGTAGAAGG - Intergenic
979981227 4:127257816-127257838 TCTCAAGGCCACAGTGTAGAAGG - Intergenic
980615034 4:135208564-135208586 TACCATGCCCGCTTTGTACATGG - Intergenic
985361058 4:189176369-189176391 CATCATGCCCACTGAGCTGAAGG - Intergenic
985418045 4:189756914-189756936 TATCAGGCTCACTGTGTGGAAGG - Intergenic
986150364 5:5123467-5123489 TATCATGCCCACTACACAGATGG + Intergenic
988695186 5:33614791-33614813 TATTATCCCCACTTTGTATATGG - Intronic
989361392 5:40605534-40605556 TATCATAAGCACAGTGTAGAGGG - Intergenic
989428828 5:41328171-41328193 TATTATGCCCACTTTATAGATGG - Intronic
998693005 5:144608230-144608252 TATCTTTGCCACTGTTTAGATGG + Intergenic
998872307 5:146564747-146564769 TATCATCCCCATTTTTTAGATGG - Intergenic
999425965 5:151488091-151488113 GCTCATGCCCTCTGAGTAGAAGG - Exonic
999903764 5:156116737-156116759 TAGGATTCCCACTTTGTAGATGG - Intronic
1002017724 5:176338907-176338929 TATCATCCCCATTCTATAGAAGG - Intronic
1002156091 5:177281031-177281053 GATCATGGTCACTGTGTAGGAGG + Intronic
1004758048 6:18634852-18634874 TAGCAAGCTCACTGTGTAGTGGG + Intergenic
1007421514 6:41722582-41722604 TATCATTCCCATTTTGCAGATGG - Intronic
1008034452 6:46731815-46731837 TCTCATTCCCATTTTGTAGATGG + Intronic
1008094369 6:47324079-47324101 TATCATTCCCATTTTGTAGATGG + Intergenic
1009836594 6:69009059-69009081 TTACATGCCCACTGTGTGTAAGG - Intronic
1010072902 6:71765108-71765130 TGTCATTACCACTATGTAGAAGG + Intergenic
1010673907 6:78719627-78719649 TATCATGCCCATTTTACAGATGG + Intergenic
1010851854 6:80786418-80786440 GATCATGCCTACTGAGTAGCTGG + Intergenic
1012505142 6:99937136-99937158 TATCATGCCATCTGTGAACAAGG + Intronic
1015120915 6:129700753-129700775 TATTATTCCCAGTGTGCAGAAGG + Intronic
1017380964 6:153829073-153829095 TAGCATCCCCACTTTGCAGATGG - Intergenic
1017599865 6:156068906-156068928 TTTCATGCAATCTGTGTAGAAGG - Intergenic
1018331032 6:162727663-162727685 TATCATGGTCACTGGGTAGGTGG + Exonic
1021219692 7:17961866-17961888 CATCATACCCACTCTGTCGATGG + Intergenic
1021874130 7:25032745-25032767 CATGAAGCACACTGTGTAGAGGG + Intergenic
1022513651 7:30961550-30961572 TATCATCCCCACTTTTCAGATGG + Intronic
1023130985 7:37003048-37003070 GATCAGGCCAACTGTGTAGGAGG - Intronic
1023635288 7:42203646-42203668 TATCTTGCCCATTGTGAATAAGG + Intronic
1024551011 7:50562350-50562372 CATCTTGCCCTCTGTGCAGATGG - Intronic
1026901481 7:74039798-74039820 TATAATGGCCATTTTGTAGATGG + Intronic
1026994543 7:74606812-74606834 TTTCAGGCTCACTGTGCAGATGG + Intergenic
1027250640 7:76396686-76396708 TATCATTCCCAGTGTATAGGTGG - Intronic
1035574095 8:693907-693929 TTTCATGCACACTGTCTGGAAGG + Intronic
1035862347 8:3042667-3042689 TATCATGCCCAGAGTATACATGG - Intronic
1036808519 8:11851660-11851682 TATCATCCCCATTGTGCAGAAGG + Intronic
1037899587 8:22679885-22679907 TATTATCCCCACTGTACAGATGG + Intergenic
1042224409 8:66504285-66504307 TTTCAGACCCACTTTGTAGAAGG - Intronic
1042243899 8:66691728-66691750 TATCATGCTGACTGTGTTAAGGG + Intronic
1042959994 8:74293441-74293463 TATCATGCCCATTTTACAGATGG + Intronic
1043441700 8:80282230-80282252 TATCATGCCTATTATATAGAAGG + Intergenic
1044056818 8:87581223-87581245 TAACATGCCCACTTTAGAGATGG - Intronic
1045634554 8:104168821-104168843 TTTTATGCCAACTGTGTTGAGGG + Intronic
1046801457 8:118433003-118433025 TAACATCCCTACTGTGTAGTTGG - Intronic
1047362619 8:124183173-124183195 TATCATCCCCATTTTGTAGATGG + Intergenic
1047533687 8:125699820-125699842 TTTCATGCCCACTGGGTTGCTGG + Intergenic
1048092618 8:131257945-131257967 TATCATTCCCATTTTATAGATGG + Intergenic
1048310670 8:133320285-133320307 TAACATCCCCACTGTATAAATGG + Intergenic
1053294833 9:36905369-36905391 TATAATTCCCACTGGGCAGACGG + Intronic
1055516592 9:77039997-77040019 AATAATGCCTACTGTGTGGAGGG - Intergenic
1056112512 9:83409708-83409730 TATTATTCCCACTTTGCAGATGG + Intronic
1056723999 9:89096209-89096231 TCTCATGCCTACTTAGTAGAAGG - Intronic
1057171358 9:92965130-92965152 GATTGTGCCCACTGTGCAGAGGG + Intronic
1059536591 9:115086562-115086584 AATCGTGGCCGCTGTGTAGACGG - Exonic
1059708802 9:116848480-116848502 TATCATGCCCACTTAACAGATGG + Intronic
1060198293 9:121637183-121637205 TATTATGCCCATTTTGCAGATGG - Intronic
1060743032 9:126112063-126112085 ATTCATTCCCACTGTGCAGATGG + Intergenic
1061411943 9:130426521-130426543 TGTCATGCCCGCGGTGCAGATGG - Intronic
1203635090 Un_KI270750v1:102743-102765 TATCAGGCTCATTGTGTGGAAGG + Intergenic
1185942714 X:4339238-4339260 TATAATGCCCATTGTGGGGAGGG + Intergenic
1186684894 X:11915846-11915868 TATCATTCCCATTTTGCAGATGG - Intergenic
1190735923 X:53256053-53256075 TCTCATCCCCACAGTGTGGAGGG - Exonic
1191668955 X:63731371-63731393 TATCTTGCCCAAAGTGTTGAAGG + Intronic
1192224022 X:69216238-69216260 TATGATGCCCATTTTATAGATGG + Intergenic
1192606305 X:72522173-72522195 TATCATTACCACTGTATATATGG - Intronic
1193245743 X:79226808-79226830 TATCTTGCCCATTTTGTAAATGG + Intergenic
1194345956 X:92765965-92765987 CACCTTGCCCACTGTCTAGACGG - Intergenic
1194517317 X:94871255-94871277 TTTCATGCCCACTGTTTGGTGGG - Intergenic
1196411895 X:115428355-115428377 TATCATGCCCACCGTCAGGAGGG + Intergenic
1196981775 X:121222234-121222256 TATCATGCCTATTTTGTAGAAGG + Intergenic
1197332222 X:125167672-125167694 TACCGTGCCCACTTTATAGAGGG - Intergenic
1198037680 X:132817817-132817839 TATCATGCCCATTTTACAGAAGG - Intronic
1200654301 Y:5882613-5882635 CACCTTGCCCACTGTCTAGACGG - Intergenic
1200869910 Y:8086660-8086682 CATAATGCCCACTGTATACAAGG + Intergenic
1200870242 Y:8089993-8090015 CATAATGCCCACTGTATACAAGG + Intergenic
1200890360 Y:8317084-8317106 CATAATGCCCACTGTATACAAGG - Intergenic
1200890684 Y:8320418-8320440 CATAATGCCTACTGTGTACAAGG - Intergenic
1200897660 Y:8392812-8392834 CATCATGCCCACTGTATACAGGG + Intergenic
1202254860 Y:22910480-22910502 CATCATGCCCACTGTATACATGG - Intergenic
1202407851 Y:24544229-24544251 CATCATGCCCACTGTATACATGG - Intergenic
1202462931 Y:25125852-25125874 CATCATGCCCACTGTATACATGG + Intergenic