ID: 1179243037

View in Genome Browser
Species Human (GRCh38)
Location 21:39608831-39608853
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179243031_1179243037 -7 Left 1179243031 21:39608815-39608837 CCTGGCTTGGGCCATGTTTCCTC 0: 1
1: 0
2: 3
3: 24
4: 283
Right 1179243037 21:39608831-39608853 TTTCCTCAGCCCCCTGGGAGGGG 0: 1
1: 0
2: 3
3: 40
4: 305
1179243030_1179243037 -6 Left 1179243030 21:39608814-39608836 CCCTGGCTTGGGCCATGTTTCCT 0: 1
1: 1
2: 3
3: 25
4: 328
Right 1179243037 21:39608831-39608853 TTTCCTCAGCCCCCTGGGAGGGG 0: 1
1: 0
2: 3
3: 40
4: 305
1179243026_1179243037 6 Left 1179243026 21:39608802-39608824 CCACGTGGGCCACCCTGGCTTGG 0: 1
1: 0
2: 0
3: 19
4: 273
Right 1179243037 21:39608831-39608853 TTTCCTCAGCCCCCTGGGAGGGG 0: 1
1: 0
2: 3
3: 40
4: 305
1179243029_1179243037 -3 Left 1179243029 21:39608811-39608833 CCACCCTGGCTTGGGCCATGTTT 0: 1
1: 0
2: 3
3: 15
4: 262
Right 1179243037 21:39608831-39608853 TTTCCTCAGCCCCCTGGGAGGGG 0: 1
1: 0
2: 3
3: 40
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900138151 1:1127558-1127580 TCTGTCCAGCCCCCTGGGAGTGG - Intergenic
900340403 1:2186090-2186112 TCTTCTGAGCTCCCTGGGAGAGG + Intronic
900754117 1:4421745-4421767 AGTTCTGAGCCCCCTGGGAGGGG - Intergenic
901665345 1:10823051-10823073 TTTCCTCAGAACCCGGGGAGGGG - Intergenic
904441763 1:30536358-30536380 TTTCCTCAGACCCCTTTGACTGG - Intergenic
904598415 1:31660939-31660961 TGTCCTCAGCCTTCTGGGAGGGG - Intronic
904615339 1:31746474-31746496 TTTCTTCAGCAGCCTGGGGGTGG - Intronic
905217329 1:36418102-36418124 CGTCCTCTGCCCCCAGGGAGAGG - Exonic
905309502 1:37039294-37039316 TTTCTTCAGCACCATGGGTGGGG + Intergenic
905926348 1:41752504-41752526 TTCCCTCAGCCCCCTAGGCTGGG - Intronic
906610083 1:47195380-47195402 TGTCCACAGCCCTCTGGGAAGGG - Intergenic
907277945 1:53327384-53327406 TTTCCGCAGACCCCTGCGCGCGG - Intronic
907289144 1:53401803-53401825 CATCCACAGCCCCCTGTGAGGGG + Intergenic
907439122 1:54467923-54467945 TTTCTTCTGCCGGCTGGGAGTGG - Intergenic
907753803 1:57289794-57289816 TTTTCTCAGCTGCATGGGAGAGG - Intronic
909616304 1:77612776-77612798 TTTCCCCACCCCCCTGCCAGTGG - Intronic
912498687 1:110107605-110107627 TTTCCTGTGGCCCCTGGGAGTGG + Intergenic
912869991 1:113294830-113294852 TTTCCCCACCCCTCTGGGACAGG - Intergenic
913093522 1:115495851-115495873 TTTCCACAGTGCCCTGGGTGGGG - Intergenic
913329201 1:117653286-117653308 ACTCTTCAGCCCCCTGGGATAGG - Intergenic
914389722 1:147209027-147209049 TTTCCTCAGCACCAGGAGAGGGG - Exonic
915561731 1:156691919-156691941 TCTCCACCGCCCCCTGTGAGCGG + Intergenic
918046645 1:180945502-180945524 CTTCCTCAGCCCCATGGCTGGGG + Exonic
918873386 1:190006588-190006610 TTTCCACAGACCACAGGGAGTGG - Intergenic
920708574 1:208273807-208273829 TTGCATCAGCCCCCAGTGAGAGG - Intergenic
922200123 1:223394029-223394051 CTTCCTCAGTTCCCTCGGAGCGG + Exonic
922599473 1:226838639-226838661 ACTCCTCAACCTCCTGGGAGAGG - Intergenic
922842338 1:228653227-228653249 TAACCTCTGCCCCCTGGGAGGGG + Intergenic
922905238 1:229169018-229169040 CCTCCTCAGCCCCCAGGGAGGGG - Intergenic
923264428 1:232300540-232300562 TTTCTTCTGCCACCTGGGAGAGG + Intergenic
1065179365 10:23109108-23109130 TTTCCTCTGGCCCATAGGAGGGG + Intronic
1065751367 10:28890705-28890727 TTTCCCCAGCCCCCAGCCAGGGG - Intergenic
1066713476 10:38261795-38261817 TTTCCTGAACCCGCTGGGATGGG + Intergenic
1067111191 10:43401776-43401798 TATCCTCAGCCCCCTGAGGAAGG + Intronic
1068301658 10:55150229-55150251 TTTCCTGAACCCCCTTGGATTGG - Intronic
1068657647 10:59591608-59591630 TGACCTCAGGCCCCTGGGAGGGG - Intergenic
1069750765 10:70743840-70743862 ATTGCTCAGCCCCATTGGAGGGG + Intronic
1070415663 10:76187055-76187077 TTGCCTCTTCACCCTGGGAGAGG - Intronic
1073596924 10:104809949-104809971 AAGCCTCAGCCCCCTGGGATAGG + Intronic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1078401984 11:11036821-11036843 TTTCCTGAGTCCCTTGGGGGTGG - Intergenic
1080822864 11:35824040-35824062 TTTCTGGAGGCCCCTGGGAGCGG - Intergenic
1081767082 11:45618876-45618898 GTTCCTCAGCTTCCGGGGAGGGG + Intergenic
1081962628 11:47149445-47149467 TTTCCCGAGCCCTCTGGGAGTGG + Intronic
1082284216 11:50301873-50301895 TGTCCCCAGGACCCTGGGAGAGG - Intergenic
1083877359 11:65531363-65531385 TTTCATCAGCCTCCTGAAAGAGG + Intronic
1084051507 11:66603177-66603199 TTTCCTCAGCACACAGGCAGGGG - Intronic
1084319731 11:68366577-68366599 TTTTCTCTGCTCCCTGGCAGGGG + Intronic
1084809264 11:71602843-71602865 GTGCCTCAGCCCCCTGCGATGGG - Intronic
1084956740 11:72695616-72695638 CTTCCTCATCCACCTGGGAAGGG + Exonic
1085764295 11:79269743-79269765 TTTCCCCAGCCCCCTGTAATTGG - Intronic
1088359941 11:108979249-108979271 TTTACTCTGCCCCCTGTGAGGGG + Intergenic
1088882114 11:113980503-113980525 TTTCCTCAGCCTTCTGGGCTTGG - Intronic
1089494724 11:118902351-118902373 TTTCTTCAGCCCGCTGGGAGGGG + Exonic
1089602386 11:119623865-119623887 CTTCCTGGGCCCACTGGGAGGGG - Intronic
1089620188 11:119717703-119717725 TCTCCTCTGCCCTCTGGGACCGG - Intronic
1090417327 11:126549576-126549598 TTTCTTCAGACCCTGGGGAGAGG + Intronic
1090613120 11:128489477-128489499 TTTCCTCAGACCCCCGGCAGTGG - Exonic
1091779489 12:3204939-3204961 TCTCCTTTGCCCCCTGGGAGGGG - Intronic
1092013278 12:5134796-5134818 TTTTCTCAGCTCCCTGGGCTGGG - Intergenic
1092539093 12:9408610-9408632 GTGCCTCAGCCCCCTGCGATGGG - Intergenic
1093225285 12:16475781-16475803 ATTCATCAGCCACCTGGGAAGGG - Intronic
1093516457 12:19992394-19992416 TCTGGTCAGCTCCCTGGGAGGGG + Intergenic
1093991134 12:25591249-25591271 TGTTCTGAGCCACCTGGGAGTGG + Intronic
1094515323 12:31122442-31122464 GTGCCTCAGCCCCCTGCGATGGG - Intergenic
1094596315 12:31869940-31869962 ACTCCTCAACCTCCTGGGAGGGG - Intergenic
1096562928 12:52449934-52449956 TGTCCTCGCTCCCCTGGGAGAGG - Intronic
1096567090 12:52491034-52491056 TGTCCTCGCTCCCCTGGGAGAGG - Intronic
1097712708 12:62933861-62933883 TTCCCTCAGCCCTTGGGGAGGGG - Intronic
1097917762 12:65038849-65038871 TTTCCTTAGCCCCAAGGGGGTGG + Intergenic
1100068072 12:90675104-90675126 TTTCCTGATGCCCCTGGGATAGG - Intergenic
1101838313 12:108310555-108310577 TTTCCTCAGCCCACAGGGACTGG + Intronic
1101914866 12:108888203-108888225 TTTGCTCAGGCTCCTTGGAGAGG + Intronic
1102198069 12:111038440-111038462 ATGGCTCAGCCCCCTGAGAGGGG + Intronic
1102822885 12:115923405-115923427 TTTTCCCAGCACCCTGGGGGTGG + Intergenic
1103915952 12:124375867-124375889 TTTCCACTGCCCCCGGGGAGGGG + Intronic
1107782535 13:43919562-43919584 TTTCCTCAGCCTGCTTGGAAGGG + Intergenic
1108272041 13:48771178-48771200 ATTCCTCAGCCTCCTGGAAAAGG - Intergenic
1111056071 13:82952814-82952836 TTTGCTGAGCTCCGTGGGAGTGG - Intergenic
1111868075 13:93794931-93794953 TTCCATCAGCCCCCTGAGATTGG + Intronic
1112449890 13:99498836-99498858 TTTCCTCAATCCCCCGGGATCGG - Intergenic
1112861028 13:103829942-103829964 TTTGCTGAGCTCCCTGGGGGTGG + Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1115446243 14:33493572-33493594 TTACCTCAGCCCGCTGTGAGAGG + Intronic
1117441686 14:55766154-55766176 CTTCCGCAGCCGCCTGGGAGAGG - Intergenic
1119186958 14:72650035-72650057 TTGCCCCAGCCCTCTGGCAGGGG - Intronic
1119557783 14:75566898-75566920 TCTGCTCAGCCCCTTGGGACCGG - Intergenic
1119733511 14:76966197-76966219 CTTCCTCAGCCTCTAGGGAGAGG - Intergenic
1120340607 14:83216782-83216804 TTTCCTCAGACCCCTGGGCCTGG + Intergenic
1121377754 14:93430256-93430278 TTGTCACAGCCCCCTGGCAGTGG + Intronic
1122409097 14:101517022-101517044 TTTCCCCAGCTCCCTGGAAGGGG + Intergenic
1122723511 14:103735579-103735601 TTCCCTCAGTCCTCTGGCAGAGG - Intronic
1123191892 14:106579361-106579383 TGGCCTGAGCCTCCTGGGAGGGG + Intergenic
1202875520 14_GL000225v1_random:204931-204953 TTTCACCAGCTCCCTGTGAGTGG + Intergenic
1125731974 15:41897601-41897623 TCTCCCCAGCTCCCAGGGAGGGG - Exonic
1125755305 15:42060301-42060323 TCTCCTCTGCCCCCTGCGATTGG + Intergenic
1126323418 15:47448840-47448862 TTTCCACAGCCCCCTGCTTGAGG - Intronic
1126958951 15:53968587-53968609 TTTCCTCAGCTTCCTGGCTGAGG - Intergenic
1127158036 15:56149924-56149946 TTTCCTGGGCTCCGTGGGAGTGG - Intronic
1127730607 15:61798619-61798641 CTTCTACAGCCCCCAGGGAGGGG - Intergenic
1128577168 15:68784038-68784060 TTTCCAAAGCCCCCAGGGAGTGG - Intronic
1129332010 15:74832567-74832589 TTTCCCCTTCACCCTGGGAGCGG + Intergenic
1130316961 15:82804263-82804285 CTGCCTGGGCCCCCTGGGAGAGG - Intronic
1131121242 15:89824475-89824497 TTGCCTCTCTCCCCTGGGAGGGG + Intergenic
1133123889 16:3631635-3631657 CTGCCTCAGCCCCCTAGTAGTGG + Intronic
1133987362 16:10678633-10678655 TTTCCTCAGTGTCCTGGGATGGG - Intronic
1134034748 16:11021091-11021113 CTTCCTCAGCCCCTAGGGAGGGG + Intronic
1136117268 16:28102384-28102406 TTTGCTTAGCCCCCAGGCAGAGG - Intronic
1136277028 16:29184876-29184898 ATTCCTCAGGCCCCGGGAAGGGG + Intergenic
1137693250 16:50444423-50444445 CTGCCTCAGCCTCCTGGGAAGGG - Intergenic
1139960016 16:70712082-70712104 TTTTTTCAGCCTCCCGGGAGGGG - Intronic
1140250441 16:73289918-73289940 TTTCCTCAGCACCCCTGAAGGGG - Intergenic
1140411482 16:74743603-74743625 TTTCCTCAGCCTCCATAGAGAGG - Intronic
1140692470 16:77497642-77497664 TTTCCACAGTTCCCTTGGAGAGG + Intergenic
1141643016 16:85352462-85352484 TCTCCAGGGCCCCCTGGGAGTGG + Intergenic
1141690409 16:85593427-85593449 TGACATCAGGCCCCTGGGAGAGG - Intergenic
1141729260 16:85810756-85810778 TTCCCTGAGCACCCTGGGAGGGG - Intergenic
1142317309 16:89355998-89356020 TCGCCTCAGCCCCCAGGGCGGGG - Intronic
1142501503 17:335749-335771 CTTCCTCTGGCACCTGGGAGGGG - Intronic
1143562297 17:7703292-7703314 TTTCCTGAGCCCACAGAGAGTGG + Exonic
1143742886 17:8966673-8966695 TTTCCCCAGCCCCTGGGGAAGGG + Intergenic
1144643423 17:16952350-16952372 TTTCCTCAGCCACCTGACTGTGG + Intronic
1144952915 17:19003765-19003787 TGTCCTCGGGCCCCTGAGAGGGG + Exonic
1145184725 17:20784408-20784430 TTTCCTCAGCCCCCTTTTATTGG - Intergenic
1146663301 17:34679621-34679643 TTTCTCCAGCCTGCTGGGAGGGG + Intergenic
1147422097 17:40326986-40327008 TTTACTCAGCTCCCTGGGGAGGG - Intronic
1147848940 17:43426284-43426306 TTTCCTCAGCCCCCTAGACAAGG + Intergenic
1147935444 17:44007999-44008021 ATTCCTCAGGCCCCTGTGAGAGG - Intronic
1147988513 17:44319904-44319926 TTTCCTCAGCACTGAGGGAGGGG - Exonic
1148198097 17:45729247-45729269 TCTCCTCACCCCCATGTGAGGGG - Intergenic
1148822194 17:50366138-50366160 ATACCTCACCCCCCTGGGAGTGG - Intergenic
1149503705 17:57175259-57175281 TTTCTTCAGCCCCATGGGCCAGG - Intergenic
1150101695 17:62429579-62429601 TTTCCTCAGCAGGCTGGGCGCGG - Intronic
1150200325 17:63349506-63349528 TTTTAACAGCCACCTGGGAGAGG + Intronic
1150294904 17:64002385-64002407 TGTCCTCTGCCCCCTGGGCCAGG + Exonic
1151326135 17:73380770-73380792 TTTCTTAAGCCCCCTGGGGTGGG + Intronic
1151343572 17:73487381-73487403 TGTCTTCAGCCCCCTGGCATTGG - Intronic
1151422528 17:74007813-74007835 CTTCACCAGCCCCCTGGGTGAGG + Intergenic
1151447288 17:74175663-74175685 TCTGCTCAGCCCCATTGGAGGGG - Intergenic
1151957286 17:77386703-77386725 TTCCCCCAGCCCCCTGGGGCAGG - Intronic
1152390466 17:80001190-80001212 TTCCCTCAGACCCCTGGCATCGG + Intronic
1152988039 18:337289-337311 TGTCCTCAGACCAATGGGAGAGG - Intronic
1153539676 18:6140222-6140244 CTTCCTCAGCCCCTTCTGAGGGG + Intronic
1153766925 18:8383908-8383930 TCTCATCAGGCCCCGGGGAGAGG - Intronic
1153927233 18:9844616-9844638 TTTTCTCTGGCCCCTGGGAGAGG + Intronic
1153987563 18:10367101-10367123 TTTCCTTCTCCCCTTGGGAGAGG - Intergenic
1155229480 18:23758556-23758578 TAGCCTCAGCCCCCAGGGAGAGG - Intronic
1156238951 18:35232999-35233021 CTTCCTCAGCTCCCTAGGAAGGG - Intergenic
1157583514 18:48787017-48787039 GTTCATCAGCAGCCTGGGAGGGG + Intronic
1160462385 18:79048797-79048819 TTTCCTCAGAGCCCAGGGCGAGG + Intergenic
1160753009 19:743539-743561 GTTTCTAAGCCCCCAGGGAGGGG - Intronic
1160951931 19:1671973-1671995 TTTCCCCACCTCCCAGGGAGAGG - Intergenic
1161497144 19:4592882-4592904 TTTTCTCAGCTGCCTGGTAGGGG + Intergenic
1161724013 19:5918147-5918169 TATTCCCAGCCACCTGGGAGTGG - Intronic
1163034543 19:14563339-14563361 TCTCTGCAGGCCCCTGGGAGAGG - Intronic
1163551865 19:17969832-17969854 TTTCCTGGGCCCCCTGGAGGAGG + Intronic
1163785143 19:19271112-19271134 TCTCCACAGCCCCCTGTGGGTGG - Exonic
1165866394 19:38942091-38942113 CTTCCTCAGCCCCCCAGAAGGGG - Exonic
1167041028 19:47022459-47022481 TCTGCTCAGCCCCCTGGGGGAGG - Intronic
1167163255 19:47781024-47781046 TGTTCTCATCCCCCTGGGAAGGG + Intronic
1168136913 19:54357751-54357773 CTGCCTCAGCCCCGGGGGAGGGG - Intronic
925589705 2:5497318-5497340 TTCTCTCAGGACCCTGGGAGGGG + Intergenic
926311522 2:11679234-11679256 TTTGCACAGCACCTTGGGAGGGG + Intronic
926757740 2:16249820-16249842 TTTCCCCATCCACCTTGGAGAGG + Intergenic
927210140 2:20634170-20634192 TGTCCTCAGCCCCCTGTGGGCGG + Intronic
927617400 2:24613375-24613397 CTTGCTCAGCCCCAGGGGAGTGG + Intronic
928609262 2:32976309-32976331 TTTCCTCAGGGCCGTGGCAGTGG + Intronic
929439346 2:41953117-41953139 TTTCCTCAGGCACCTCTGAGAGG - Exonic
929950592 2:46406840-46406862 TTTCCCCAGCCCACTGGCAACGG + Intergenic
930755586 2:54968849-54968871 CCTCCTCATGCCCCTGGGAGAGG - Intronic
932791826 2:74660406-74660428 TTTTCTTAGCCACCTGGGAAAGG + Intronic
933148604 2:78887838-78887860 TTACCACATCACCCTGGGAGAGG + Intergenic
934562808 2:95321781-95321803 TTTCCTCTTCCCTCTGGCAGAGG - Intronic
934613536 2:95757650-95757672 TTTCCTGAGTCCCCAGGGAGAGG + Intergenic
934647360 2:96066765-96066787 TTTCCTGAGTACCCAGGGAGAGG - Intergenic
934840733 2:97622585-97622607 TTTCCTGAGTCCCCAGGGAGAGG - Intergenic
935444282 2:103139783-103139805 CTTCTTCAGTCACCTGGGAGAGG + Intergenic
938777100 2:134551531-134551553 TTTCCCCAGGCCCCTTGGAGAGG - Intronic
939606953 2:144265178-144265200 TTTGCTGAGCCCACTGGGAGTGG - Intronic
941239398 2:163017549-163017571 TTTGCTGGGCTCCCTGGGAGTGG + Intergenic
942454582 2:176129485-176129507 GCTCCGCAGCCTCCTGGGAGTGG + Intergenic
944132467 2:196361673-196361695 GTCCCTCAGCCAGCTGGGAGGGG + Intronic
944419995 2:199519377-199519399 TTTCCTCAGCCACAAGAGAGAGG - Intergenic
946519204 2:220447169-220447191 TGTCCTCAGGTCCTTGGGAGAGG - Intergenic
946693998 2:222333719-222333741 TGTCCTCAGGCCCCTGGGAGGGG - Intergenic
947461089 2:230305801-230305823 TTTGTTCAGCCTCCTGTGAGGGG - Intronic
947470911 2:230400528-230400550 TTTCCTCAACCCCCTGGGACAGG - Intronic
947569217 2:231218263-231218285 TTTCTTCAACCTTCTGGGAGAGG - Intronic
948187764 2:236034887-236034909 TGTCCCCACACCCCTGGGAGTGG + Intronic
948383648 2:237568231-237568253 ATTCCTCAGCTCCGTGGGCGTGG + Intergenic
948387633 2:237591474-237591496 GTTCCTCCGCCCTGTGGGAGTGG + Intronic
1168805796 20:671710-671732 TTTCCTCAGCTTGCTGGGGGAGG + Intronic
1168885172 20:1245823-1245845 TTTCCTCTGCCACCTGGTATTGG + Intronic
1169142557 20:3234513-3234535 TCACCTCAGCCCCCAGGTAGAGG + Intronic
1169220243 20:3818411-3818433 CTTCCTCAGCCTACTGGGAGTGG - Intergenic
1170760010 20:19240834-19240856 TTTCCCCTGCCCCATGCGAGGGG - Intronic
1171436540 20:25129438-25129460 TTTCCACAGATCCCTGGGAAAGG - Intergenic
1172765277 20:37347323-37347345 TCTTCTCAGCCCCCTGGCTGGGG + Intronic
1173548496 20:43916271-43916293 TTTCGTCAGGCCCCTGGTAGTGG + Intronic
1173993266 20:47319056-47319078 CTTCCTCCTCCCCCTGGGAGAGG - Intronic
1178374513 21:32055888-32055910 TTTTCTCAGCCTCCAGGGAGAGG + Intergenic
1179186753 21:39090673-39090695 TTCCATCAGCAACCTGGGAGGGG + Intergenic
1179243037 21:39608831-39608853 TTTCCTCAGCCCCCTGGGAGGGG + Intronic
1179972352 21:44843177-44843199 TTTCCTCAGCTCCATGGCTGTGG + Intergenic
1181148757 22:20867527-20867549 TTTCCTCTGCCTTCTGGGGGTGG + Intronic
1181773469 22:25143294-25143316 CCTCCTCAGACCCCTGAGAGTGG - Intronic
1181805680 22:25373287-25373309 TTTTCTCTGCTCCCTGGCAGGGG - Intronic
1182228480 22:28818528-28818550 TTTCCTCACCCCACTTGGCGTGG + Intergenic
1182771918 22:32802208-32802230 TTTCCTCTGCCCCAGGAGAGGGG + Intronic
1183592605 22:38789009-38789031 TTTCATTTGCCCCATGGGAGGGG + Intronic
1184831827 22:46993767-46993789 TTTCCTCAGCCACCTGGCTCTGG + Intronic
949395890 3:3614447-3614469 TTTTCTCAGAGTCCTGGGAGAGG + Intergenic
949697475 3:6715799-6715821 CTGCCTCAGTCCCCTGGGACTGG + Intergenic
951269389 3:20606632-20606654 TTGCCTCAGCGTCCTGGGTGAGG - Intergenic
951703024 3:25515056-25515078 TTTCCTCAGCCCCAAGAGACAGG - Intronic
951982068 3:28576331-28576353 CTCCGCCAGCCCCCTGGGAGCGG - Intergenic
953434888 3:42870599-42870621 TTTCCTGAGACCCCTGGGAAAGG - Intronic
953910964 3:46892850-46892872 TTTCCTCAGACCCCTGGGCAGGG - Intronic
954131568 3:48563813-48563835 CTCCCTCAGCCCCCTGGGGTGGG + Intergenic
955103067 3:55870694-55870716 GCTCCTTAGCCCCCTGGGAATGG - Intronic
955235281 3:57133818-57133840 TTGCCTCAGCCCTATAGGAGAGG - Intronic
956237003 3:67083523-67083545 ATTCCTCAGCAGCCTGTGAGAGG - Intergenic
956744295 3:72299365-72299387 TTTACTGAGCCCCCAGGGCGTGG - Intergenic
957079512 3:75624010-75624032 GTTCCTCACCCCCCTGCGATGGG + Intergenic
957100908 3:75827229-75827251 TTTCACCAGCCCCCTGTGGGTGG - Intergenic
957228443 3:77479141-77479163 GTTCCTCTGGCCTCTGGGAGAGG + Intronic
960525801 3:118708445-118708467 TTTCAGGAGCCCCTTGGGAGTGG + Intergenic
961322268 3:126084098-126084120 TTCCCGCCGCCGCCTGGGAGGGG - Exonic
962258330 3:133887128-133887150 TTTCCACAGCCTGGTGGGAGGGG - Intronic
962741607 3:138366250-138366272 TGTCCTCATCCCCCTGGGTTGGG + Intronic
962992842 3:140595227-140595249 AGTCCTCACCCACCTGGGAGTGG - Intergenic
963851889 3:150217585-150217607 TTTCCCCATCCCTCTAGGAGAGG - Intergenic
964157839 3:153606979-153607001 TTTCTTTAGGGCCCTGGGAGAGG + Intergenic
966762434 3:183429358-183429380 TACCCTCAGCCCCCTGTGATGGG - Intergenic
966917263 3:184592000-184592022 TTTCCTGAGCCCTCTGGTGGGGG - Intronic
967830172 3:193911961-193911983 TATCCTCATCTGCCTGGGAGAGG - Intergenic
968432628 4:567711-567733 TTTCCCAAGCCCCTGGGGAGGGG + Intergenic
968660876 4:1798230-1798252 GCTTCTCAGCCCCCAGGGAGGGG + Intronic
968902732 4:3439041-3439063 AGTGCTCAGCCCCCTGGGGGTGG + Intronic
969079878 4:4610151-4610173 TTTACACAGAACCCTGGGAGTGG - Intergenic
969549546 4:7855561-7855583 CTTCCTCAGCCTCCTGACAGTGG - Exonic
969672516 4:8597636-8597658 TTTCCTAAAGCACCTGGGAGTGG - Intronic
969731223 4:8959209-8959231 GTGCCTCAGCCCCCTGGGATGGG - Intergenic
969790858 4:9493396-9493418 GTGCCTCAGCCCCCTGCGATGGG - Intergenic
969790928 4:9493635-9493657 TTGCCTCACCCCCCTGCGATGGG - Intergenic
974785741 4:66618480-66618502 ACTCCTCAGCCCCCAGGTAGTGG + Intergenic
977971136 4:103215865-103215887 TTTCCTGAGCCCCCGGGGACTGG - Intergenic
978754108 4:112285019-112285041 TTTCCGCAGCCACCAGGAAGTGG - Intronic
981405003 4:144357569-144357591 TTTCCTCAGGACTCTGGGACAGG + Intergenic
981469349 4:145112519-145112541 ATTCCTAAGCTCCCTGGAAGCGG - Intronic
983690595 4:170464938-170464960 TTTCCTTAGCCCCAAGGGTGGGG + Intergenic
983779585 4:171651247-171651269 TGTCCTCAGGCTCCTGAGAGGGG - Intergenic
984879632 4:184399197-184399219 GTTCTTCAGCCCCATGGCAGGGG - Intronic
985645604 5:1083352-1083374 TTCCCTCAACCCCCTGGGGCAGG + Intronic
985660549 5:1155030-1155052 CCTCCTCAGCCCACTGGAAGCGG + Intergenic
986721816 5:10565206-10565228 TTTCCCCAGGTCCCTGGCAGGGG + Intronic
987933179 5:24428510-24428532 TTTCCTAAGCCCCAAGGCAGTGG + Intergenic
988601381 5:32642332-32642354 TTTCCAAAGGCCCCTGGGAAAGG + Intergenic
988697184 5:33633997-33634019 TTTCCTAAGCTCCCTTTGAGAGG - Intronic
988785436 5:34562288-34562310 TTTCCTCAGAGCCTTGGTAGAGG + Intergenic
988877944 5:35468993-35469015 TTTACCCTGCCCCCTGTGAGAGG - Intergenic
989719685 5:44509997-44510019 TTTCTCCAGTCTCCTGGGAGAGG - Intergenic
990351317 5:54919318-54919340 TTTCCTGGGCTCCATGGGAGTGG - Intergenic
990410430 5:55535377-55535399 TTACCTCATCCCCATGGAAGGGG - Intergenic
992213783 5:74506233-74506255 TTTGCTCAGCCCCCCAGGGGAGG - Intergenic
997071891 5:130632683-130632705 TTTCCTGAGCCACCTGGGGCTGG + Intergenic
1002434876 5:179225090-179225112 GTTCCTCAGGCCCCTGCGTGAGG - Intronic
1003435036 6:6080419-6080441 TTTCATGAGCCACCTGGGACGGG - Intergenic
1003474717 6:6470738-6470760 TGGCCAGAGCCCCCTGGGAGTGG - Intergenic
1003957035 6:11173676-11173698 ATTCCTCTGCAGCCTGGGAGGGG - Intergenic
1004545403 6:16593321-16593343 TTTCCATAGTCCCCAGGGAGGGG - Intronic
1004775583 6:18840924-18840946 TTGCCTCAGCCCACTGGTATGGG - Intergenic
1005452139 6:25983670-25983692 TTTCCTTAGTCACCTGGGGGAGG - Exonic
1005826001 6:29632334-29632356 CTTCCTCCGCCCCCCGGGCGCGG - Exonic
1007376491 6:41460317-41460339 CCTCCTCAGAGCCCTGGGAGGGG - Intergenic
1007569133 6:42876669-42876691 TTTCATCACCCCATTGGGAGTGG - Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018960948 6:168448296-168448318 CCTCCCCAGCCTCCTGGGAGTGG - Intronic
1019061996 6:169263340-169263362 TGGCCTCAGCTCCCTAGGAGAGG - Intergenic
1019508310 7:1404689-1404711 GTCCCCCAGCCCCCTGGGTGTGG + Intergenic
1022533722 7:31083012-31083034 TTTCCTGAGCTCCCTGGAGGTGG + Intronic
1022843755 7:34190059-34190081 TTGCCACAGCCCCCTGAGACCGG - Intergenic
1022902578 7:34825500-34825522 TTACATCAGCCCCCTGGGCTAGG - Intronic
1022971815 7:35525486-35525508 TTTCTTCAGCCCCCTGACCGAGG - Intergenic
1023080645 7:36523094-36523116 TATCCTCAGCCCCTGGGGAATGG - Intronic
1023230529 7:38023123-38023145 CTGCCTCAGCCCCCTTGGACTGG + Intronic
1023644312 7:42293379-42293401 TTTTCTCAGCACTTTGGGAGGGG + Intergenic
1024047457 7:45594709-45594731 TTTCCTCAGCCCTATGGAGGAGG + Intronic
1024152965 7:46591243-46591265 TTTCCTGGGCTCCGTGGGAGTGG - Intergenic
1025187287 7:56871154-56871176 TGTCCCCAGGACCCTGGGAGAGG + Intergenic
1025188706 7:56880962-56880984 TGTCCCCAGGACCCTGGGAGAGG + Intergenic
1025683228 7:63695958-63695980 TGTCCCCAGGACCCTGGGAGAGG - Intergenic
1025684638 7:63705766-63705788 TGTCCCCAGGACCCTGGGAGAGG - Intergenic
1026404503 7:70051050-70051072 TTTGCTCATCCCCTTGGCAGGGG - Intronic
1027641420 7:80737929-80737951 TTTCCTTATCCCCCTGGCACTGG - Intergenic
1028001467 7:85502600-85502622 TTTGCTCAAAGCCCTGGGAGAGG - Intergenic
1028414694 7:90567255-90567277 TTTCCCCAGGCCTCTGTGAGTGG + Intronic
1030086384 7:105819469-105819491 CTTCAGCAGCCCCCTGGGAAAGG - Intronic
1030875076 7:114803999-114804021 TTTCCTAAGTCCCCTGAGAGAGG + Intergenic
1031144181 7:117979404-117979426 TTACCAAAGCCCCATGGGAGAGG - Intergenic
1031993236 7:128211303-128211325 TGGTCTCAGCCTCCTGGGAGAGG - Intergenic
1032030839 7:128482442-128482464 TTTCCTCAGCAGGCTGGGCGCGG - Intronic
1032401764 7:131629104-131629126 TTGCCCCAGCCAGCTGGGAGGGG - Intergenic
1032695176 7:134329723-134329745 TTGCCACAGCCCTATGGGAGAGG + Intergenic
1033809990 7:145001548-145001570 GGTCCTCAGCACCCTGGGTGTGG + Intergenic
1034739007 7:153456081-153456103 TTTCCCCATCCCCGTGGCAGTGG - Intergenic
1034808078 7:154106068-154106090 TCTCCACAGCCCCCATGGAGAGG + Intronic
1035870607 8:3133146-3133168 TCTCCTCAGCGACCTGGGGGAGG + Intronic
1037802767 8:22044264-22044286 CCCCCTCACCCCCCTGGGAGGGG + Intronic
1038534362 8:28343418-28343440 TTACCTCTGCCTCCCGGGAGCGG - Intergenic
1047738869 8:127790924-127790946 TTGCCTCAGCCTCCTGAGTGGGG - Intergenic
1048095157 8:131283994-131284016 CTACCTCAGCTCCCTGGCAGAGG - Intergenic
1049109356 8:140634114-140634136 TTTCCCCCTCCACCTGGGAGGGG - Intronic
1049322827 8:142006087-142006109 TTTCTGCAGCCCCCAGGAAGGGG - Intergenic
1049379271 8:142303930-142303952 TTTCCTCAGGCCCCTCGGCAGGG + Intronic
1049552735 8:143267890-143267912 TGTTCCCAGCCCCGTGGGAGCGG - Intronic
1049653890 8:143789353-143789375 TGTCCTCAGGCCCCTGGGCCAGG + Intergenic
1050253530 9:3770756-3770778 ACTCCTCAGCCCCCTGTGGGAGG + Intergenic
1052971143 9:34377718-34377740 CTTGCCCAGCCCCCGGGGAGAGG - Intergenic
1052991979 9:34523642-34523664 TTCCCTCTGCCACCTGGGTGTGG + Intergenic
1054938296 9:70712762-70712784 TTTCATCAGACCCCAGGGTGTGG - Intronic
1054939987 9:70730755-70730777 TTTCATCAGACCCCAGGGTGTGG - Intronic
1056616820 9:88175646-88175668 TGTCCTCAGACCCCTGGGATTGG - Intergenic
1056801714 9:89696764-89696786 TTTCATCAGCACCCAGGAAGTGG - Intergenic
1057822210 9:98341425-98341447 TGTCTTGAGCCCTCTGGGAGAGG - Intronic
1058439453 9:104993525-104993547 TTTCCAAAGCCTCCTAGGAGAGG - Intergenic
1060229972 9:121819117-121819139 CTGCCTCTGCCCACTGGGAGGGG + Intergenic
1060773947 9:126355294-126355316 TTTCCGCAGACCCCTAGGATGGG - Intronic
1060855893 9:126914924-126914946 CTTCCTCATGGCCCTGGGAGCGG - Exonic
1061135084 9:128729241-128729263 TTTCCTCAGCCCCTCGGGCCAGG + Intergenic
1061948403 9:133921562-133921584 TTTCCCCAGCCTGCAGGGAGAGG - Intronic
1062141613 9:134962145-134962167 GATCCTCAGCCTCCTGGGAAGGG - Intergenic
1186909320 X:14144667-14144689 TTTCCTCAACCTCCATGGAGAGG + Intergenic
1187762517 X:22603422-22603444 TTTCCTCAGAACTCTGGGTGAGG + Intergenic
1189194461 X:39140979-39141001 TTCCCTCAATCCCCTGAGAGGGG - Intergenic
1189263153 X:39692360-39692382 TTTGCTCAGGGCCCTGAGAGGGG - Intergenic
1192334388 X:70205268-70205290 CTGCCTCAGCCACTTGGGAGAGG - Exonic
1195011566 X:100737098-100737120 TTTCCTCAGCCCCTGGTGACAGG + Intergenic
1196981591 X:121220172-121220194 TTCTTTCAGCCCCCTCGGAGAGG + Intergenic
1199210616 X:145205857-145205879 TTTCCTCACTGCCCTGGCAGTGG + Intergenic
1200693900 Y:6339235-6339257 TTTCCTAGGTCCCCTGGTAGTGG + Intergenic
1200952415 Y:8912443-8912465 TTTCCTAGGTCCCCTGGTAGTGG + Intergenic
1201041377 Y:9835484-9835506 TTTCCTAGGTCCCCTGGTAGTGG - Intergenic
1202160588 Y:21931151-21931173 TTTCCTAGGTCCCCTGGTAGTGG - Intergenic
1202230768 Y:22655224-22655246 TTTCCTAGGTCCCCTGGTAGTGG + Intergenic
1202312390 Y:23540941-23540963 TTTCCTAGGTCCCCTGGTAGTGG - Intergenic
1202334047 Y:23787633-23787655 TATCCTCATTCCCTTGGGAGAGG - Intergenic
1202536721 Y:25882426-25882448 TATCCTCATTCCCTTGGGAGAGG + Intergenic
1202558413 Y:26129653-26129675 TTTCCTAGGTCCCCTGGTAGTGG + Intergenic