ID: 1179244837

View in Genome Browser
Species Human (GRCh38)
Location 21:39623932-39623954
Sequence ATGTAGCAGATACATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179244837_1179244841 14 Left 1179244837 21:39623932-39623954 CCCTCTTCATGTATCTGCTACAT 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1179244841 21:39623969-39623991 CAATAAGTCCTGATTGTTACTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1179244837_1179244843 30 Left 1179244837 21:39623932-39623954 CCCTCTTCATGTATCTGCTACAT 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1179244843 21:39623985-39624007 TTACTGGAGACAGTTATCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179244837 Original CRISPR ATGTAGCAGATACATGAAGA GGG (reversed) Intronic
901218275 1:7566962-7566984 GCGTAGCAGATCCATGAAAATGG + Intronic
903755991 1:25661143-25661165 ATGTTGGAGCTACATGCAGAGGG + Intronic
905821888 1:40999103-40999125 CTGTGGCAGACACATGAGGAAGG + Intronic
907652705 1:56310936-56310958 ATGTGGCTGAAACATCAAGATGG + Intergenic
907852406 1:58268455-58268477 GTGTGGCAGAAACATGAAGAAGG + Intronic
910066682 1:83161830-83161852 ATGTTGCAGCTACAAGATGAGGG + Intergenic
910525911 1:88177865-88177887 ATCTGGCTGATAAATGAAGATGG + Intergenic
910702776 1:90093902-90093924 ATGTGGCAGATAGTTGAAAATGG + Intergenic
911404775 1:97422915-97422937 ATGTAGAAGTGACATGAAAATGG + Intronic
917075959 1:171205270-171205292 ATGTCTCAGATACATTATGAAGG + Exonic
918109804 1:181445562-181445584 ATGCAGCAAAGACATGAAGTTGG - Intronic
918991111 1:191697982-191698004 ATGAAGCAGATGCTTAAAGATGG + Intergenic
921168050 1:212521398-212521420 TTATAGCAGGTACATGAAGACGG + Intergenic
922334909 1:224611135-224611157 ATGTAGCAGATCTCTGGAGAGGG + Intronic
922782235 1:228262420-228262442 ATGTACCAGAAACAAGCAGATGG + Intronic
1065852247 10:29800498-29800520 ATGTACCAAATACATGTAAAAGG + Intergenic
1068379328 10:56229638-56229660 TTATAGCAGATACATGAAACTGG + Intergenic
1068893090 10:62168920-62168942 ATAAAGCAGATACACGAAGAGGG - Intergenic
1069117928 10:64531533-64531555 ATGTTGCAAATACAGGAAGGAGG - Intergenic
1069200194 10:65605063-65605085 ATTTAGTAGATACCTTAAGATGG - Intergenic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070639277 10:78154956-78154978 ATGTAGCAGATACATGGTGGTGG - Intergenic
1071451582 10:85796990-85797012 CTGCAGGAGATACATGAAGTAGG + Intronic
1071702325 10:87953231-87953253 ATGTAACAGATTCATAGAGAAGG + Intronic
1071797534 10:89022447-89022469 AAGAAGTAGATAAATGAAGAGGG - Intergenic
1072091415 10:92131426-92131448 ATATGGCATATACACGAAGAAGG + Intronic
1074355786 10:112781924-112781946 CTGTAGCAGATAAATGGAGGAGG - Intronic
1074709469 10:116165235-116165257 AAATAGCAGACACATGGAGATGG + Intronic
1077981339 11:7303501-7303523 CTGTATCAGAGACATGAATATGG + Intronic
1081556087 11:44162754-44162776 ATGTAACTGATAGGTGAAGATGG + Intronic
1084337975 11:68472292-68472314 ATGTAACAGAGAAGTGAAGAAGG - Intronic
1085140891 11:74140389-74140411 ATTAAGTAGAAACATGAAGAAGG - Intronic
1085472045 11:76764646-76764668 ATTTAGCAGAGAAATGATGAAGG - Intergenic
1085796251 11:79542666-79542688 ATGTAGCAGAAACAAAAAGTTGG + Intergenic
1086316694 11:85602306-85602328 ATGTAGGGGATAGATGATGATGG - Intronic
1086527295 11:87742799-87742821 AGGTAGCAGAATAATGAAGAAGG + Intergenic
1086928199 11:92663718-92663740 AATGAGCAGATTCATGAAGAGGG - Intronic
1087195213 11:95298269-95298291 AGGTAGCAGATATAGGAAGCTGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1090087775 11:123666036-123666058 CAGTAAAAGATACATGAAGAAGG + Intergenic
1092104444 12:5911444-5911466 ATCTAGCAGTGCCATGAAGAGGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1093441508 12:19202826-19202848 TTGTAACTGATACATGAGGATGG - Intronic
1093877589 12:24368752-24368774 ATGTAGGATATACAGGAAGAAGG - Intergenic
1094795061 12:33962134-33962156 ATGAAGCAGATAAATGCACAGGG + Intergenic
1095106855 12:38244352-38244374 ATGAAGCAGATAAATGCACAGGG + Intergenic
1097542926 12:60962872-60962894 TTTTAGCAGATACCTGAAAAAGG + Intergenic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1100244373 12:92742468-92742490 CTTGAGAAGATACATGAAGAAGG + Intronic
1100664360 12:96735259-96735281 ATGTAACCCATAGATGAAGATGG + Intronic
1103582448 12:121925310-121925332 AAGTAGCAGATGGAGGAAGAAGG - Intronic
1103653735 12:122454098-122454120 AAGAATCAGATACAGGAAGAGGG - Intergenic
1105550067 13:21385554-21385576 ATGAAGCAGAGAAAAGAAGATGG + Intronic
1105637336 13:22228106-22228128 TTGTGGAAGATACAGGAAGAAGG + Intergenic
1106385783 13:29284214-29284236 ATGTAGCTGTTACATGAATGGGG + Intronic
1108909692 13:55530742-55530764 AGGTAACAGAGACTTGAAGATGG + Intergenic
1109741079 13:66556361-66556383 ATGGAACAGCTACATGAGGATGG - Intronic
1109815812 13:67583107-67583129 GTATAGCAGATTCATGATGATGG + Intergenic
1109971833 13:69780416-69780438 AAGTAAAAGAGACATGAAGAGGG + Intronic
1110144320 13:72170702-72170724 ACGTAGCAGTTACATGACTAGGG - Intergenic
1113138034 13:107115383-107115405 AAGCAGCAGACACAAGAAGAGGG - Intergenic
1114207431 14:20585950-20585972 ATGTAGGAGATCAATGTAGAAGG - Intronic
1114379838 14:22190802-22190824 ATGAAGCACAGACAGGAAGAAGG + Intergenic
1115857075 14:37641990-37642012 ATGTATTACATACATGCAGATGG + Intronic
1115857885 14:37650631-37650653 ATCTAGCAGAGACAAGAAGCAGG - Intronic
1117090725 14:52247464-52247486 ATATATCAGAGACAAGAAGAGGG + Intergenic
1117314672 14:54562572-54562594 ATGTAGAAGAGACGTGCAGAAGG + Intergenic
1117990977 14:61433193-61433215 TTGAATCAGAAACATGAAGAAGG + Intronic
1118802663 14:69205365-69205387 ATGTAGTAGACAGATAAAGAGGG - Intronic
1119108255 14:71945023-71945045 ATGGACCACATACATGAAGGGGG - Intronic
1119939742 14:78627628-78627650 ATGAAGCAGATATATTAACAGGG - Intronic
1120507151 14:85366878-85366900 CTTTAGCACATAGATGAAGATGG - Intergenic
1120511618 14:85422424-85422446 ATGTAGCATTAAGATGAAGAAGG - Intergenic
1127943348 15:63724174-63724196 ATATAACAGAAATATGAAGAGGG + Intronic
1129007908 15:72389841-72389863 ATGAAGCAGATGCAGGAAAAGGG - Intergenic
1129286023 15:74525692-74525714 ATGAAGCAGAGACAGGAAAAGGG - Intergenic
1130933597 15:88450116-88450138 ATTAAGCAGAGTCATGAAGAGGG - Intergenic
1131378727 15:91946709-91946731 ATGATGCAGTTACATGAAAAAGG + Intronic
1132347474 15:101116976-101116998 ATGAAGCAGACACCCGAAGAGGG + Intergenic
1134346934 16:13399878-13399900 ATGTAGAAGATACTTGTAGTGGG + Intergenic
1134865922 16:17607027-17607049 AAGAAACAGAGACATGAAGAGGG + Intergenic
1135059579 16:19259629-19259651 ATGTACAAAATCCATGAAGAGGG - Intronic
1136712311 16:32249221-32249243 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1136755604 16:32680184-32680206 ATGTCTCAGATAGCTGAAGATGG + Intergenic
1136812509 16:33190188-33190210 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1136818985 16:33300268-33300290 ATGTCTCAGATAGCTGAAGATGG - Intronic
1136825548 16:33356801-33356823 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1136830614 16:33455572-33455594 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1136998966 16:35212350-35212372 ATGTATCAGATGGATGAAGATGG + Intergenic
1138177906 16:54918506-54918528 TTGTAGCAGCTATAGGAAGATGG - Intergenic
1139841516 16:69884874-69884896 TTGTAGCTAATAAATGAAGAAGG + Intronic
1202991086 16_KI270728v1_random:13158-13180 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1203057746 16_KI270728v1_random:940539-940561 ATGTCTCAGATAGCTGAAGATGG + Intergenic
1150720596 17:67611150-67611172 ATGTATGAGATACTAGAAGAAGG + Intronic
1151304388 17:73253689-73253711 ATGCAGCTGATACATGCTGAAGG + Intronic
1154051693 18:10966300-10966322 ATGTAGCAGAGAACTGAAGATGG - Intronic
1156000058 18:32374849-32374871 AAGTAGCAGATATATGTATAAGG + Intronic
1156717828 18:40032936-40032958 TTGTAGCAGATATTAGAAGAAGG - Intergenic
1157139036 18:45086959-45086981 AGGTAGCACATACCAGAAGATGG + Intergenic
1158378859 18:56905995-56906017 TTGTAGCCAATAAATGAAGAAGG + Intronic
1158841471 18:61392616-61392638 ATGTAGCAGAGATATAATGATGG - Intronic
1159244296 18:65784884-65784906 ATGTAACACATAAATGAACAAGG - Intronic
1159609655 18:70511421-70511443 ATGCAGCTGATATATGAAAAAGG - Intergenic
1159736701 18:72108531-72108553 ATTTAGAAAATACATAAAGAAGG - Intergenic
1159967484 18:74609778-74609800 ATGGACCACATACATGATGATGG - Intronic
1162738793 19:12761977-12761999 TTGAAGCAGATACCTGAAGGAGG - Intergenic
1165048024 19:33121645-33121667 ATGTAGCAAATACAATAAAATGG + Intronic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1166495262 19:43297893-43297915 ATGTAGCCTATTAATGAAGAAGG + Intergenic
925897681 2:8485615-8485637 ATTTAGCAGTTACAAGAACAGGG + Intergenic
926429403 2:12770672-12770694 ATGTGGCAAATACATTCAGAAGG + Intergenic
926744730 2:16141596-16141618 ATGGAGCAAATGCATGAAGATGG - Intergenic
927746283 2:25624465-25624487 ATGGAGCTGATACAAGAAGGGGG + Intronic
928919479 2:36511826-36511848 ATGCAGCAGATACTTCCAGAAGG + Intronic
930048492 2:47194755-47194777 ATGCAGCAGGTACTTGAATAAGG + Intergenic
930302001 2:49628310-49628332 TTTAAGCAGATACCTGAAGAAGG - Intergenic
932103166 2:68919416-68919438 AAGTGGCACATGCATGAAGAAGG + Intergenic
932454134 2:71835428-71835450 ATTTTGCTGATACAGGAAGAGGG - Intergenic
934724452 2:96606441-96606463 AGGTAGCAGTCACATGAGGAGGG + Intronic
935875527 2:107502795-107502817 AGTTGGCAGATACATGAAAATGG - Intergenic
936468852 2:112779482-112779504 ATGAAGCAGGTACATTAAAATGG - Exonic
938220987 2:129567619-129567641 AGGTAGAAGATACCCGAAGAAGG + Intergenic
939002139 2:136748561-136748583 AAGTAGCAGATACAGTCAGAAGG - Intergenic
939242188 2:139575543-139575565 AAGTAGCAGTTACAAGAACAGGG + Intergenic
939380747 2:141432845-141432867 ATGGAGCAAATACATGAAATCGG - Intronic
939801525 2:146717400-146717422 ATAGAACAGAAACATGAAGATGG + Intergenic
940226468 2:151406579-151406601 AGGTAGCAGATCCATGAGGGTGG + Intergenic
940397483 2:153207519-153207541 TTGTAGCTGATAAATGAAGAAGG - Intergenic
941374140 2:164706651-164706673 ATGTGACAGATACAAGATGAGGG - Intronic
942079312 2:172385228-172385250 ATGCAGCAAAGCCATGAAGAGGG - Intergenic
942222784 2:173787837-173787859 ATGTAGCAGGTACATCATGTAGG + Intergenic
942978948 2:182055123-182055145 ATGTTACAGATACATCAAAATGG - Intronic
943287343 2:186019243-186019265 ATGAAGCAGATAGAAAAAGAGGG - Intergenic
947879634 2:233495961-233495983 ATGTAGCGAATACATTAAAAAGG + Intronic
1173238220 20:41267711-41267733 TTGGAGCAGAAACCTGAAGAAGG + Intronic
1179244837 21:39623932-39623954 ATGTAGCAGATACATGAAGAGGG - Intronic
1179297261 21:40074521-40074543 ATGTAGCAAAAACATAATGAAGG - Intronic
1179377413 21:40862981-40863003 ATGTAGCAGAACCAGCAAGAGGG + Intergenic
1182767712 22:32770605-32770627 ACGAAGCAGAGACATGAACAAGG - Intronic
1185281032 22:49969982-49970004 ATGTAGCAGAAACATGGTGAGGG + Intergenic
949819728 3:8103235-8103257 CTGTAGCAGAAAGATGAACAAGG - Intergenic
950940813 3:16889386-16889408 ATGTAGGAGATATTGGAAGAAGG + Intronic
951953903 3:28232670-28232692 AAGTTGCACCTACATGAAGAAGG + Intergenic
953130432 3:40132781-40132803 ATGAGGCTGATACAAGAAGATGG + Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
959031585 3:101305890-101305912 AGGTAACAGATACATCAGGATGG + Intronic
959384483 3:105684969-105684991 AGGTAGCAAGTACATCAAGAAGG + Intronic
959646896 3:108713396-108713418 ATGTGGCTGATGCATGAAGTGGG - Intergenic
961098545 3:124178095-124178117 ATGTTGTAGATACAACAAGAGGG - Intronic
961989396 3:131171474-131171496 ATGGAGCAGATACATGCAAATGG + Intronic
964818049 3:160738586-160738608 ATGTAGCAGAAAAATAAACATGG + Intergenic
965222852 3:165950463-165950485 ATGTAGCATATTCATTGAGAAGG - Intergenic
966033985 3:175387336-175387358 TTCTAGCTAATACATGAAGAAGG - Intronic
966582250 3:181581223-181581245 ATGTAGTAGATACATAAATGAGG + Intergenic
969556828 4:7917557-7917579 AACAAGCAGATGCATGAAGAAGG + Intronic
970214677 4:13746185-13746207 ATCTAGCAGACACATGAAGTGGG + Intergenic
970729376 4:19084970-19084992 ATGGACCACATATATGAAGATGG + Intergenic
976473216 4:85453786-85453808 ATGTATCTGATAAATGAAGATGG - Intergenic
976607953 4:87000215-87000237 ATGAAGCAGACACAGGAAAAGGG - Intronic
976608143 4:87001831-87001853 GTGAAGCAGACACAGGAAGAGGG - Intronic
978079576 4:104575568-104575590 ATGTAACAGAGACAAGAAGAGGG - Intergenic
978408370 4:108403387-108403409 ATGGAGCAGCAACATGTAGAGGG - Intergenic
979095279 4:116541167-116541189 ATGGACCACATATATGAAGATGG + Intergenic
979369603 4:119868448-119868470 AGGTAGAAGGAACATGAAGAAGG + Intergenic
980222580 4:129938675-129938697 TTATAGCTGATACAGGAAGAAGG - Intergenic
980243820 4:130211229-130211251 ATGCAGCAGATACCTAATGATGG + Intergenic
981343010 4:143644264-143644286 ATGATGCAGATACACGGAGAAGG - Intronic
981814103 4:148808651-148808673 ATGAAGCAGTAACTTGAAGAAGG + Intergenic
983180541 4:164642756-164642778 ATGTACAAGCCACATGAAGATGG - Intergenic
984575711 4:181445954-181445976 ATGTCTCAGATATATTAAGAGGG - Intergenic
985188402 4:187344252-187344274 ATGCAGCAGATATTGGAAGATGG - Intergenic
987114752 5:14717420-14717442 ATGTAACAGACACAGGAAAAGGG + Intronic
987861752 5:23498039-23498061 ATTTGGCAGAGACAGGAAGAGGG + Intergenic
992489546 5:77228857-77228879 ATTTAGGTGATAGATGAAGAGGG + Intronic
993174502 5:84466163-84466185 ATGGAGCAGATAAAGGAAGGTGG + Intergenic
994410475 5:99401981-99402003 ATAGAGCAGATACAGGTAGAAGG + Intergenic
994483350 5:100363288-100363310 ATAGAGCAGATACAGGTAGAAGG - Intergenic
998569170 5:143241713-143241735 GTGTGGCAGAAACATCAAGAGGG + Intergenic
999330556 5:150671196-150671218 ATGTGGCAGAAAAATAAAGATGG + Intronic
999994721 5:157081229-157081251 CTATAGCAGAAACATGAAAAAGG + Intergenic
1000345101 5:160307787-160307809 ATGCAGCAGGGACAGGAAGAAGG + Intronic
1001229454 5:169973448-169973470 AGGTAGAAGACACATGCAGAGGG - Intronic
1004501797 6:16216577-16216599 ATGGAGCAGATTTATCAAGACGG - Intergenic
1006418188 6:33917705-33917727 CTGAAGCAGAAACATGAAGAAGG - Intergenic
1007058899 6:38918297-38918319 ATGTAACAGATATAAAAAGAAGG - Intronic
1007103145 6:39264741-39264763 ATGGAGCAGATATATGATGGTGG + Intergenic
1007962741 6:45975285-45975307 ATGTAGCAGATACAGGAGAATGG + Intronic
1008015173 6:46510525-46510547 ATGTGATAGATGCATGAAGAAGG - Intergenic
1008804375 6:55409834-55409856 ATGTAACAGATACAGGAAATAGG + Intergenic
1010061002 6:71623201-71623223 ATGTATTAGATACATGATTATGG + Intergenic
1010582761 6:77619757-77619779 ATGTACCAAATACTTGGAGATGG + Intergenic
1011922098 6:92590908-92590930 ATCTACCAAATTCATGAAGATGG + Intergenic
1012043831 6:94243622-94243644 ATGTAGAAGATAAATAAAGGTGG - Intergenic
1012500073 6:99878991-99879013 ATGTAGCATAAAAATAAAGAAGG - Intergenic
1013175859 6:107675827-107675849 ATGTAGGAGGTGTATGAAGACGG + Intergenic
1014935727 6:127382793-127382815 AAGCAGCAGATACAGGGAGAGGG - Intergenic
1015866686 6:137734175-137734197 AGGTAGCAGATGTAGGAAGAAGG - Intergenic
1018778368 6:167039968-167039990 ATGTTGCATAGACACGAAGAAGG + Exonic
1019515787 7:1439384-1439406 ATGCACCACATACATGAACACGG + Intronic
1021222850 7:17993137-17993159 TTGTTGCATATACATGATGAGGG - Intergenic
1021905661 7:25330582-25330604 AGGTAGCAGGAACATGAGGAAGG - Intergenic
1022221905 7:28321865-28321887 CTGTGTCAGATACATGAAGTTGG + Intronic
1024564092 7:50667191-50667213 AAATAGCAGATTCATGAAGAAGG - Intronic
1024954278 7:54900089-54900111 ATTTAACAGATACTTGCAGAGGG + Intergenic
1027277425 7:76572931-76572953 ATGTTGCAGCTACAAGATGAAGG - Intergenic
1029089048 7:98033798-98033820 ATGTTCCAGAAACATGGAGAGGG - Intergenic
1030740540 7:113103833-113103855 ATGTGCCAGATAAATAAAGAAGG + Intergenic
1031188642 7:118517419-118517441 AAGCAGCAGATAAATGAAGCAGG + Intergenic
1031473197 7:122191594-122191616 CTAGTGCAGATACATGAAGAGGG + Intergenic
1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG + Intronic
1033460900 7:141546699-141546721 AAGTGGCAGATGCATGAAAATGG - Intergenic
1033560414 7:142525481-142525503 ATGTAGCAGAGACATCAATGTGG + Intergenic
1033660875 7:143401231-143401253 AGGTTGCAGAGACAGGAAGAGGG - Intronic
1036008328 8:4692534-4692556 AAGGAGCAGCCACATGAAGAGGG + Intronic
1036422097 8:8606626-8606648 ATTTAGCTGATACATCATGATGG - Intergenic
1038670046 8:29575685-29575707 AAGAAACAGATACATGAAAAAGG + Intergenic
1042256161 8:66806015-66806037 ATGTAGAAGAAATATGAAAAAGG - Intronic
1042442533 8:68844912-68844934 ATGAAGCAGATAAATTAATAGGG - Intergenic
1045230495 8:100301882-100301904 ATTTAGCAGAGACCTGAAGGAGG + Intronic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1046146629 8:110169980-110170002 ATGCAGTAGATACAGGAAGAAGG - Intergenic
1047240520 8:123083555-123083577 AGGTAGGAAATACATGAGGAGGG - Intronic
1048579562 8:135719838-135719860 ATGTGGCAGCTGCATGAAGCTGG - Intergenic
1050527647 9:6559921-6559943 ATGCAGCAGAAACATGGACAAGG + Intronic
1050692491 9:8243498-8243520 AAGGAGCAGGTACAGGAAGATGG + Intergenic
1051287463 9:15511115-15511137 ATGTAACAGGTGCATGCAGATGG + Intergenic
1051648183 9:19291824-19291846 ATGTAGCAGATAGAACTAGAAGG + Intronic
1051718923 9:20015155-20015177 CTGTATTATATACATGAAGATGG - Intergenic
1053163768 9:35830395-35830417 ATGTAGCAAATAGATGAATATGG + Intronic
1055366004 9:75545471-75545493 ATGTGGCAGATATATGCAAAAGG + Intergenic
1056475942 9:86950939-86950961 GTGTAGAGGATACATGGAGAAGG + Intergenic
1058555762 9:106165204-106165226 ATCTAGAAGATAGATAAAGAAGG + Intergenic
1060585441 9:124782639-124782661 ATGTAGCAGTCACAGGAAGGGGG + Intronic
1186107592 X:6224642-6224664 ATGTAACAGATACTTGATAAGGG - Intronic
1186246509 X:7621917-7621939 ATGTAGCAGATTTATGAAGATGG - Intergenic
1189694986 X:43654692-43654714 AGGAAGCAGATATATGAAGGCGG - Intergenic
1191896177 X:65995754-65995776 AAGTAGAAGATACAGGAAGCTGG + Intergenic
1192139397 X:68634669-68634691 ATGAAACAGATTCATGAAGGAGG + Intergenic
1193654374 X:84181882-84181904 AAGTAGGAGATATATGAAAAGGG - Intronic
1194198139 X:90921571-90921593 ATGTGGCAGGTATATGTAGAAGG + Intergenic
1194567761 X:95514485-95514507 ATGTTTTATATACATGAAGAAGG + Intergenic
1195701105 X:107706468-107706490 TTGATGCAGATACATGGAGAGGG - Intergenic
1200543602 Y:4491260-4491282 ATGTGGCAGGTATATGTAGAAGG - Intergenic
1200975508 Y:9208333-9208355 AGGTAGCAGATTGATCAAGATGG - Intergenic
1202135650 Y:21658196-21658218 AGGTAGCAGATTGATCAAGATGG + Intergenic