ID: 1179245345

View in Genome Browser
Species Human (GRCh38)
Location 21:39628700-39628722
Sequence TCCCATTAGGTCCCCTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179245345_1179245348 24 Left 1179245345 21:39628700-39628722 CCTGTACAGGGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1179245348 21:39628747-39628769 GCAGATGTAAGTCTTTAGAATGG 0: 1
1: 0
2: 2
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179245345 Original CRISPR TCCCATTAGGTCCCCTGTAC AGG (reversed) Intronic
902652071 1:17843637-17843659 GCCCATGAGCTCCCCTTTACTGG + Intergenic
904314880 1:29653609-29653631 ACCCATCAGTTCCCCTGCACTGG + Intergenic
904664805 1:32111831-32111853 TGCCACTAGGTGCCCTGTAGGGG + Intronic
905922903 1:41730858-41730880 TCCCATTAGATCCCCTGAATAGG - Intronic
909551429 1:76901673-76901695 TTCCATTTGGTCCTCTGAACTGG + Intronic
918099870 1:181364073-181364095 TCCCATTAGGGCCTTTGTAATGG + Intergenic
918225167 1:182474604-182474626 TCCCATCTGGTCACCTATACTGG + Intronic
921642228 1:217569164-217569186 TCCCATTTCGTCATCTGTACTGG - Intronic
923316002 1:232780633-232780655 TCCCCTTTGGTCCCCAGTACGGG + Intergenic
1063704069 10:8413876-8413898 ACCCATTATGTGCCCTGGACTGG + Intergenic
1080589966 11:33714407-33714429 TCACAGTAAGTGCCCTGTACAGG - Intronic
1108325102 13:49322787-49322809 TCCTATTAGATCCCCTGAAAAGG + Intronic
1117556544 14:56891847-56891869 TCCCAAGAAGTCCCCTGGACTGG - Intergenic
1119119705 14:72063228-72063250 TCCTTTTCGGTCCCCTTTACTGG - Intronic
1119550240 14:75504745-75504767 TCCCATTAGGCCCCACTTACTGG + Intergenic
1120893522 14:89509707-89509729 GCCCATTATGTGTCCTGTACTGG - Intronic
1123887027 15:24736215-24736237 TCCCTTTGGGTCCCCTGTCTTGG - Intergenic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1138131423 16:54483058-54483080 TCACAATAGGTCCGCAGTACAGG + Intergenic
1138230239 16:55331206-55331228 TCCCATTGGTTGGCCTGTACCGG - Intergenic
1143246159 17:5487053-5487075 TCCCATTAGGACCTCTCTTCGGG - Intronic
1144469540 17:15525217-15525239 TGCCATTAGGTGCCCGGCACTGG + Intronic
1144732451 17:17536586-17536608 TCCCATGAGGTCACCTTTGCTGG - Intronic
1144926815 17:18818458-18818480 TGCCATTAGGTGCCCGGCACTGG - Intergenic
1146934479 17:36804031-36804053 TCTCACTAGGTGCCCTGTATAGG - Intergenic
1148821640 17:50363494-50363516 TCCCATTCTCTCCCCTGTCCAGG + Intergenic
1148990669 17:51664032-51664054 TCCCATGAGAACCACTGTACTGG + Intronic
1149300199 17:55298167-55298189 TCAGATTAGATCCCCTGTTCAGG + Intronic
1150280584 17:63927824-63927846 TCTCACTAGTTCCCCTGTGCTGG + Intergenic
1151147877 17:72058194-72058216 TCTCTTTCGGTCCCCTGTACAGG + Intergenic
1153722794 18:7923732-7923754 TGCCATTAACTCCCCTGTAAGGG - Intronic
1155809234 18:30210477-30210499 TTCCATTATGTCCCTTCTACTGG + Intergenic
1164861961 19:31568725-31568747 TCCCATTATGTCCCCAGCGCTGG + Intergenic
1165767642 19:38361134-38361156 TCCCATCAGGGCCTCTGCACAGG - Intronic
1166342098 19:42144345-42144367 TCCCATTAGCTCCCTTTTGCAGG - Intronic
926323884 2:11767698-11767720 CCCCATGAGGTCTCCTGTCCTGG + Intronic
929897514 2:45974853-45974875 TCCTAGAAGGTCCCCTGCACAGG - Intronic
937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG + Exonic
1170119987 20:12901135-12901157 TCTCCTCAGGTCCCCTGCACAGG - Intergenic
1171227511 20:23453513-23453535 TCCCATCAGGTCCCCAGGATGGG - Intergenic
1174754292 20:53142413-53142435 TCCCACCAGGTCACATGTACAGG + Intronic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
966113833 3:176436811-176436833 TCCCTTTAGGTCCCTCCTACTGG + Intergenic
971941944 4:33226924-33226946 TCCCACTAGGTCCCCTACATGGG - Intergenic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
977437723 4:97020813-97020835 TCACATTAAGTGCCCTATACAGG - Intergenic
983320594 4:166191624-166191646 TCTCATCAGTTCCCCTGTAATGG - Intergenic
986310095 5:6545136-6545158 CCCCACTGGGTCCCCTGCACAGG + Intergenic
987294746 5:16539666-16539688 TCACATCAGGGCCCCGGTACCGG - Intronic
987544689 5:19298127-19298149 TCCCATGAGGTCACCTTTTCTGG - Intergenic
987857216 5:23436260-23436282 TCACAGTAAGTGCCCTGTACAGG + Intergenic
1022039381 7:26565684-26565706 TAGCATTATGTCCACTGTACAGG - Intergenic
1023878432 7:44305551-44305573 TCCCCTGAGGTGCCCTGCACTGG + Intronic
1031844367 7:126786629-126786651 TGCCATGAGGTGGCCTGTACAGG - Intronic
1032790568 7:135239499-135239521 CCCCATTAGGTGCTCAGTACTGG - Intronic
1044489014 8:92789887-92789909 TCCCCTTAGAACTCCTGTACTGG + Intergenic
1048997792 8:139804867-139804889 TCCCATGAGGACCCCTGTATGGG + Intronic
1049333205 8:142066376-142066398 CCCCATTAGGTTCCCTGGATAGG - Intergenic
1049477476 8:142803498-142803520 TCCCTATAGGACACCTGTACAGG - Intergenic
1051261845 9:15272339-15272361 TTCCCTTAGCTCCCCAGTACTGG + Intronic
1056200172 9:84267933-84267955 TATCATTAAGTCCCCTGTATTGG - Intergenic
1060000201 9:119951759-119951781 TCCCATTGCCTCCCCTGTTCAGG + Intergenic
1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG + Intronic