ID: 1179245348

View in Genome Browser
Species Human (GRCh38)
Location 21:39628747-39628769
Sequence GCAGATGTAAGTCTTTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179245346_1179245348 11 Left 1179245346 21:39628713-39628735 CCTAATGGGACCATGTCGAGTGA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1179245348 21:39628747-39628769 GCAGATGTAAGTCTTTAGAATGG 0: 1
1: 0
2: 2
3: 16
4: 173
1179245345_1179245348 24 Left 1179245345 21:39628700-39628722 CCTGTACAGGGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1179245348 21:39628747-39628769 GCAGATGTAAGTCTTTAGAATGG 0: 1
1: 0
2: 2
3: 16
4: 173
1179245347_1179245348 1 Left 1179245347 21:39628723-39628745 CCATGTCGAGTGATTATATCTTG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1179245348 21:39628747-39628769 GCAGATGTAAGTCTTTAGAATGG 0: 1
1: 0
2: 2
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179245348 Original CRISPR GCAGATGTAAGTCTTTAGAA TGG Intronic
901789623 1:11647492-11647514 GCAGCTGACAGTCTTTGGAAGGG + Intergenic
903096929 1:20985355-20985377 GCAAAAGTAAGTCTGTAAAATGG - Intronic
908285560 1:62595131-62595153 AAAGATGTAATTCTTTAAAAAGG + Intronic
909880981 1:80877984-80878006 GTAGATGTATGACTTTTGAAAGG - Intergenic
910693830 1:89991680-89991702 ACAGATGAAAGACTTCAGAATGG + Intergenic
911061668 1:93753474-93753496 GCAGATGAAATTCTGCAGAATGG - Intronic
911756544 1:101563582-101563604 TCTGATGTAAGTCTTAGGAAAGG - Intergenic
912803374 1:112736015-112736037 CCAGGTGGAAGCCTTTAGAATGG + Intergenic
913030409 1:114897123-114897145 TTAGATGTACTTCTTTAGAATGG - Intronic
914463728 1:147908392-147908414 GCAGATGTAGGTCCTCAGCAGGG - Exonic
915790904 1:158669908-158669930 GCAGATGTAAGTCCTTATTCAGG + Intronic
916801635 1:168221612-168221634 GAAGATGTCAGTCTTCTGAATGG - Intergenic
918174947 1:182035463-182035485 TTAGATGTACTTCTTTAGAAGGG - Intergenic
918644128 1:186883122-186883144 GCAGATTTAAGATTTCAGAATGG + Intronic
919059256 1:192609641-192609663 GAAGGTGTTAGTTTTTAGAATGG - Intergenic
919549838 1:198971384-198971406 GCAGATGGAAGCCCTTGGAAGGG - Intergenic
920846763 1:209599905-209599927 CCAGATGTAAGACCTCAGAAAGG - Intronic
1063006908 10:1980683-1980705 GCACAAGTAAGACTTTTGAACGG - Intergenic
1063993740 10:11596106-11596128 GCAGATGTAAGTTTTTTTGACGG - Intronic
1065708698 10:28494968-28494990 GCACATATCATTCTTTAGAAGGG - Intergenic
1065938709 10:30544591-30544613 GCATATGTAAATTATTAGAAAGG - Intergenic
1066705455 10:38173124-38173146 GCCTCTGTAAGTCATTAGAAAGG - Intergenic
1066985037 10:42457528-42457550 GCCTCTGTAAGTCATTAGAAAGG + Intergenic
1070437993 10:76412359-76412381 TCTGATGTAAGACTTCAGAAAGG + Intronic
1070983981 10:80672451-80672473 GCAGATGTAGGTCATTGGAAAGG - Intergenic
1071273857 10:84034792-84034814 GCAGATGTATGTCTCCACAAAGG + Intergenic
1071863371 10:89699401-89699423 ACAGATGGAATTCTTTGGAATGG + Intergenic
1073583134 10:104685649-104685671 GCATATGTAAGTTTTTTTAAGGG - Intronic
1076145776 10:128119293-128119315 GAAAATGAAAGTCTTCAGAATGG - Exonic
1076154871 10:128196103-128196125 GCAGAGGTAAGTTTTTGGAATGG + Intergenic
1076476325 10:130755702-130755724 ACAGATTTAAGTCTTTAGAATGG - Intergenic
1078712496 11:13807920-13807942 GCAGATGTAAGTAATTAGGATGG - Intergenic
1078839318 11:15063468-15063490 CCAGGTGTAAGTCTCTAAAATGG - Intronic
1079449993 11:20592343-20592365 GCAGAATAAAGTCCTTAGAATGG + Intergenic
1080130055 11:28783392-28783414 TGAGATGTAACTCCTTAGAAAGG + Intergenic
1083085284 11:60136449-60136471 CCAGTCTTAAGTCTTTAGAATGG - Intergenic
1083502542 11:63123905-63123927 GGAGGAGTAAGTCTTTAAAAAGG + Intronic
1086066191 11:82747707-82747729 TTAGATGTAAGTCTTTAGGCCGG - Intergenic
1087493255 11:98855528-98855550 GCACATGTAAGTATATATAATGG - Intergenic
1092560157 12:9604322-9604344 GCAAATCTGAGTCTGTAGAATGG + Intronic
1093008079 12:14072722-14072744 TGAGATGTAAGTCTTTAGATGGG - Intergenic
1093779367 12:23117095-23117117 GCAGATTTAAGAAGTTAGAAGGG + Intergenic
1093900975 12:24631874-24631896 GCAGACGTAAGATTTGAGAAGGG - Intergenic
1094406667 12:30123513-30123535 GCAGATGTAAGTCAGCACAAAGG + Intergenic
1094720712 12:33060673-33060695 GGAGCTTTAAGTCTTTAGAAAGG + Intergenic
1095582588 12:43817037-43817059 GCAGATGTAGGGCCTTTGAAAGG + Intergenic
1096444841 12:51680210-51680232 TAAGATGTAAATATTTAGAAAGG + Intronic
1097065950 12:56320723-56320745 GCAGCTGTAAGTCTTGAGAGTGG - Intronic
1100308830 12:93376397-93376419 GCAGATGTAAGTTTGTAGAATGG - Intergenic
1106450795 13:29880326-29880348 GGAGATGTAAGTCTCTACCATGG + Intergenic
1106677988 13:31982008-31982030 ACAGATGAAAGTTTTAAGAAGGG - Intergenic
1110441436 13:75530614-75530636 GCTAATGTAAGTCTTGAGCATGG - Intronic
1110933713 13:81256174-81256196 GCAAATAAAAGTCTGTAGAAAGG + Intergenic
1116402228 14:44521957-44521979 ACATATGTATGTCTTAAGAATGG - Intergenic
1117284749 14:54276575-54276597 GCAGATGTTATTTTTCAGAATGG + Intergenic
1117339526 14:54781621-54781643 GGAGATGTGAGTCTTCAGGAAGG - Intronic
1119507909 14:75188749-75188771 GGAGAAGTGCGTCTTTAGAAAGG - Intergenic
1121916589 14:97841197-97841219 GCACTTGTAAGTCACTAGAAGGG + Intergenic
1126139459 15:45425317-45425339 GCAGAAGTGAGTCATCAGAAAGG - Intergenic
1126546579 15:49880746-49880768 CCAGCTGTAAGGATTTAGAAAGG + Intronic
1126952770 15:53900274-53900296 GCAGACATAAGTGTTTAGGATGG + Intergenic
1127072578 15:55300783-55300805 GCTGATGTCAGTCTCTACAATGG + Intronic
1127341535 15:58049960-58049982 GCAAATGGAAGACTTCAGAAAGG + Intronic
1128860782 15:71069919-71069941 GAATATGTAACTCTTTAAAAAGG + Intergenic
1130671267 15:85914987-85915009 GCAGATGTAAGTCGTGGGGACGG - Intergenic
1131366000 15:91840563-91840585 GCAAATGTAAGTAATTACAAAGG - Intergenic
1131715972 15:95111316-95111338 GCAGAGGAAAGTCTTTCTAATGG + Intergenic
1137259563 16:46813514-46813536 GCTTATGAAAGGCTTTAGAAGGG - Intronic
1137533279 16:49297838-49297860 GAACATGTAATTCTTTGGAAGGG - Intergenic
1141762496 16:86038116-86038138 GAAGATGCAAGTCTCTACAAAGG - Intergenic
1143081010 17:4381405-4381427 GCAGATGTAGCTCTTTAGAGTGG + Intergenic
1143817499 17:9529195-9529217 GGAGATGTAAGTCAACAGAAGGG - Intronic
1143919098 17:10316860-10316882 GCATATGTTTTTCTTTAGAATGG + Intronic
1144425494 17:15137666-15137688 GCAGATGATAGTCTTCAGAGTGG - Intergenic
1148947159 17:51273476-51273498 GCAGAGGTAAGTAGTTAGATAGG - Intronic
1151085355 17:71374212-71374234 GCAATTATAAGTCATTAGAAAGG - Intergenic
1151343390 17:73486232-73486254 GCAGAGGGAAGTCTATAGGAGGG + Intronic
1157038676 18:44010166-44010188 GCAGATATAAGTCTTTTGTCAGG + Intergenic
1157956626 18:52105017-52105039 GTAGCTGTAAGTTTTTATAAAGG - Intergenic
1158641489 18:59207591-59207613 CTAGATGTATGTCTTTAGATGGG + Intergenic
1165315296 19:35051718-35051740 GCATATGTCAGTCTTTACTATGG - Intronic
1166511611 19:43413194-43413216 GAAGTTGTAAGCCTTTAAAAAGG + Intronic
925501467 2:4509601-4509623 GCAGCTGGAAGTCTTTAGGAAGG - Intergenic
926782193 2:16483568-16483590 AAAGATGTAAGTTTTTACAAAGG + Intergenic
928860539 2:35852332-35852354 GCACATGTAAGTATCTTGAAGGG - Intergenic
930609487 2:53525204-53525226 ACAGATGTTAGTATTGAGAAGGG + Intergenic
931697345 2:64881144-64881166 AGAGATGTAAGTCTTCAGCATGG + Intergenic
932171272 2:69558687-69558709 ACAGAGGTAAGTCTTCAGTATGG + Intronic
933531953 2:83521772-83521794 GCAAATGTATGCATTTAGAAAGG + Intergenic
935145702 2:100393723-100393745 GCAGAAATAAGTCTTTCGAAGGG + Exonic
936235518 2:110739428-110739450 ACAAATGCAAGTCTTGAGAAAGG - Intronic
939728045 2:145747872-145747894 GCAAATGAAAGTTTTAAGAAAGG + Intergenic
942567746 2:177283299-177283321 ACAGATGTAAGGCTAAAGAAAGG - Intronic
942687992 2:178554207-178554229 CCAGGTGTAACTATTTAGAAAGG + Exonic
943395905 2:187333716-187333738 TAAGATGTAAGACTTTAAAATGG + Intergenic
944597835 2:201278030-201278052 GCAAATCTAAGCCTTTAAAAAGG + Intronic
1170003464 20:11640556-11640578 GCAGATGCAAGAGTTTAGAGCGG - Intergenic
1175064936 20:56276713-56276735 TTAGATGTACCTCTTTAGAAGGG + Intergenic
1177081949 21:16650776-16650798 GCAGATTTTAGACTTTACAACGG + Intergenic
1177214909 21:18115635-18115657 GCAGAGGTAAGTCATTAGAGAGG - Intronic
1179245348 21:39628747-39628769 GCAGATGTAAGTCTTTAGAATGG + Intronic
1179838337 21:44052732-44052754 GCTGCTGTCAGTCTTCAGAAAGG - Intronic
1181295781 22:21837517-21837539 GTAGATGTAACTTTTTAAAAAGG + Intronic
1181912175 22:26247395-26247417 GCAGATGTAATTCGTCAGATGGG + Intronic
1182619063 22:31608451-31608473 GCAGATGTAATTGGTTAGGATGG - Intronic
1183771390 22:39929114-39929136 GAAGATGGAAGTCTTTTTAATGG + Intronic
951041824 3:17996327-17996349 ACAGATATAAATCTTTATAATGG + Intronic
951223700 3:20096320-20096342 GGAGATGTATGTCTATAGTAGGG - Intronic
955010143 3:55005934-55005956 GCAGATGTAAGATGTTACAAGGG + Intronic
956499281 3:69864596-69864618 TCAGATTTGAGTTTTTAGAAAGG - Intronic
961311236 3:126003529-126003551 GCAGATGTACCTCTTCAGAGGGG + Intergenic
961474427 3:127137773-127137795 GCAGTTGTCAATATTTAGAAAGG - Intergenic
961951205 3:130751276-130751298 GCAGATGAATGTATTTATAAAGG - Intergenic
962622914 3:137197679-137197701 GCAGAATAAAGTCCTTAGAATGG + Intergenic
963936385 3:151058142-151058164 GTAGAAGTAAGGCTTTAGAGAGG - Intergenic
966504946 3:180689570-180689592 ATGGATGTAAGTCTTTATAAAGG + Intronic
966523831 3:180900135-180900157 CCAGATGTACTTCTTTAGAGAGG + Intronic
966578534 3:181532068-181532090 GAAGCTGTATGACTTTAGAACGG + Intergenic
967213044 3:187185666-187185688 GAAAATGTAAATCTTTAGCAGGG + Intergenic
969204263 4:5630798-5630820 GCAAATGTCATTCTTTAGACAGG - Intronic
970681868 4:18518107-18518129 GCAGATCTGAGTCTTGAGTATGG + Intergenic
973115603 4:46454536-46454558 GCAGATAAAAACCTTTAGAAAGG + Intronic
974082658 4:57228789-57228811 GCAGTTGGAAGTGGTTAGAAAGG + Intergenic
974963757 4:68735471-68735493 TCAGATGTACTTCTTTACAAGGG - Intergenic
976408776 4:84688683-84688705 TCAATTGTAATTCTTTAGAATGG - Intronic
978841085 4:113213475-113213497 TCAAATATAAGTCTTGAGAAGGG + Intronic
980118487 4:128704251-128704273 ACAGTTGTAAGTCCTTAAAAGGG + Intergenic
982368460 4:154606496-154606518 GCAGGTGGATTTCTTTAGAAGGG + Intronic
982912568 4:161163146-161163168 GGAGATGAAAGCCTTTATAATGG + Intergenic
983014053 4:162587822-162587844 GTAGATGTTAGAATTTAGAAAGG - Intergenic
985381705 4:189402185-189402207 GCAGATGTTTTTCATTAGAAAGG + Intergenic
985705401 5:1397968-1397990 GAAGATTTAAGTCCTTATAATGG + Intronic
986979803 5:13434315-13434337 GCAGAGGTCAGTCTTTGGAAAGG + Intergenic
990178235 5:53131095-53131117 GCAAATCTAAGTCTTAAAAATGG - Intergenic
990362055 5:55030531-55030553 TCTGATGTAACTCTTGAGAATGG - Exonic
991453620 5:66779247-66779269 GCAGCTGTAAGTCTTTTGGAAGG - Intronic
996546141 5:124681070-124681092 ATAGATGTATTTCTTTAGAAAGG - Intronic
999008299 5:148006301-148006323 ACAGATGTACTTCTTTAGAGAGG + Intergenic
1000002054 5:157148415-157148437 AAAGTTGTAAGTCTTTAAAAAGG - Intronic
1000960268 5:167592660-167592682 TCAAATTTAAGTCTTTAAAAGGG - Intronic
1000987308 5:167875054-167875076 GCAGATGCGATTCTTTAGGAAGG + Intronic
1003793745 6:9576870-9576892 GCAGATGTAACTTGTTAAAATGG - Intergenic
1006762194 6:36472798-36472820 TCAGAAGTAAGTATTTACAAAGG - Intronic
1007231408 6:40349840-40349862 GCAGATGTGAGAATGTAGAAGGG - Intergenic
1008213185 6:48751373-48751395 ACAGAGGTAACTCTTTAGATGGG - Intergenic
1009611166 6:65943249-65943271 GTAAATGTAATTCTATAGAACGG + Intergenic
1010769295 6:79810430-79810452 GGAGATGACAGTCTTTTGAAAGG + Intergenic
1011759040 6:90539453-90539475 GCAGATGTAAGCCTTTGATAGGG - Intronic
1018538662 6:164852744-164852766 TCAAATTTAAGTCTTCAGAATGG - Intergenic
1019986535 7:4660496-4660518 GTAGATGTAGGTTTTTAGCAGGG + Intergenic
1020523461 7:9225624-9225646 GAAGAAGTAAGACTTTAGAAGGG + Intergenic
1020850100 7:13342300-13342322 GGATATGTAAGTCTCTAGGAAGG + Intergenic
1021137585 7:16984792-16984814 GTAGATGTGGGTCTCTAGAAAGG - Intergenic
1022327362 7:29344363-29344385 GAAGAGGTAAGTCCTTAGCATGG + Intronic
1023506861 7:40908981-40909003 GCAGAAGAAAATCTTCAGAATGG + Intergenic
1026508285 7:71005590-71005612 GCAGAGGAGAGTCTTTAGGATGG - Intergenic
1030567878 7:111183286-111183308 GCTAATGTAAGCCTTTATAAGGG + Intronic
1030823595 7:114126393-114126415 GAAAATGAAAGTATTTAGAAGGG - Intronic
1031321691 7:120337587-120337609 ACAGATATATGACTTTAGAATGG - Intronic
1032873996 7:136017911-136017933 GCAGATGTATGTTTTAATAAAGG + Intergenic
1033272181 7:139942284-139942306 GCATATGAAAGGCTTGAGAAAGG + Intronic
1034651208 7:152692001-152692023 GCAGATGTAAATCTATATATAGG + Intergenic
1036027863 8:4929845-4929867 GCAAATTTAAGTTTTTACAAAGG + Intronic
1036284494 8:7431852-7431874 GCAGATTTAAGACTTTAGATAGG + Intergenic
1036336982 8:7879678-7879700 GCAGATTTAAGACTTTAGATAGG - Intergenic
1039106125 8:33991762-33991784 GCTTAAGTATGTCTTTAGAATGG - Intergenic
1041829884 8:62142543-62142565 GCATCTGTAATTCTTCAGAAAGG - Intergenic
1042656928 8:71109948-71109970 ACAGATGTAATTTTTTTGAAAGG + Intergenic
1043913103 8:85887167-85887189 TCAGATGAAAATTTTTAGAAGGG + Intergenic
1046062454 8:109155673-109155695 GCAGAAGTAAGTCACTAAAAGGG - Intergenic
1049858295 8:144878438-144878460 GCTGATGTGATTCTTCAGAAAGG - Exonic
1053808826 9:41831845-41831867 ATAGATGCAATTCTTTAGAAAGG - Intergenic
1054621766 9:67355583-67355605 ATAGATGCAATTCTTTAGAAAGG + Intergenic
1055366329 9:75548631-75548653 GCAGCAATAATTCTTTAGAATGG - Intergenic
1055377844 9:75669507-75669529 ACAGAGGTAAGACTTTAGAGAGG - Intergenic
1056029207 9:82534126-82534148 GAAGAAGTATGTCTGTAGAATGG - Intergenic
1056647484 9:88426738-88426760 GCAGATTTAAGTTTCTTGAAAGG + Intronic
1057121950 9:92584151-92584173 GCAGATGGGAGTCATTTGAATGG - Intronic
1058123358 9:101163775-101163797 GCAGATGTAAATCTTTTGGGGGG + Intronic
1060001416 9:119962295-119962317 GCAGACGCAGGTCTTTAGAGGGG - Intergenic
1061226004 9:129281371-129281393 GCAGTTGTAAGTCTTAGAAAGGG - Intergenic
1186010700 X:5128864-5128886 GCAGATGTAAGAAATCAGAAAGG - Intergenic
1190548840 X:51558177-51558199 TTAGATGTACTTCTTTAGAAGGG - Intergenic
1194599329 X:95901115-95901137 GCAAATGTAAGTAAGTAGAAGGG - Intergenic
1194798829 X:98245519-98245541 GCATTTGTAAGTCTTAAGAATGG + Intergenic
1195665828 X:107429408-107429430 GCAGATGGTGGTCTTTTGAATGG - Intergenic
1199001966 X:142649408-142649430 TCAGAGGTAATTGTTTAGAAGGG - Intergenic
1199132509 X:144208275-144208297 GCAGAAGTAAGTTTTCAGCAGGG + Intergenic
1200943959 Y:8813311-8813333 GTAGATATAAGACTTTAGGAAGG - Intergenic
1201356268 Y:13099861-13099883 GCAGAGGTGTGTGTTTAGAAAGG + Intergenic
1201728448 Y:17180774-17180796 GCAGGAGTATGTCTTTAAAATGG + Intergenic
1202152054 Y:21852353-21852375 GGAGTTGTAAGCCTTTAAAAAGG - Intergenic