ID: 1179245687

View in Genome Browser
Species Human (GRCh38)
Location 21:39632342-39632364
Sequence TGGTATGTTCAGATAAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179245684_1179245687 0 Left 1179245684 21:39632319-39632341 CCAAGTAGGCTATTGGTGACCTT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1179245687 21:39632342-39632364 TGGTATGTTCAGATAAGCAGTGG 0: 1
1: 0
2: 1
3: 8
4: 124
1179245682_1179245687 2 Left 1179245682 21:39632317-39632339 CCCCAAGTAGGCTATTGGTGACC 0: 1
1: 0
2: 0
3: 10
4: 51
Right 1179245687 21:39632342-39632364 TGGTATGTTCAGATAAGCAGTGG 0: 1
1: 0
2: 1
3: 8
4: 124
1179245683_1179245687 1 Left 1179245683 21:39632318-39632340 CCCAAGTAGGCTATTGGTGACCT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1179245687 21:39632342-39632364 TGGTATGTTCAGATAAGCAGTGG 0: 1
1: 0
2: 1
3: 8
4: 124
1179245679_1179245687 23 Left 1179245679 21:39632296-39632318 CCTGTGTTAACTATTTTCTGGCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1179245687 21:39632342-39632364 TGGTATGTTCAGATAAGCAGTGG 0: 1
1: 0
2: 1
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179245687 Original CRISPR TGGTATGTTCAGATAAGCAG TGG Intronic
900272208 1:1796790-1796812 TGGTCTGGTCATATAGGCAGTGG + Intronic
903167163 1:21528669-21528691 TGGTATGTTTTGATAACAAGAGG + Intronic
903249578 1:22043062-22043084 AGGTGTGTACAGATAACCAGGGG + Intergenic
905520397 1:38594724-38594746 TAGTATGTTCAAAGAAGCAAAGG - Intergenic
906053231 1:42892211-42892233 TGCTATGTTCATATCTGCAGCGG + Intergenic
908674452 1:66587637-66587659 TAGAATGTTCACATAAGCACTGG - Intronic
909736284 1:78966613-78966635 TGGAATGGACAGATGAGCAGGGG + Intronic
911803747 1:102178452-102178474 TGGAATTTACAGATAAGCAGAGG - Intergenic
919134091 1:193487329-193487351 TGGTATGTTCATGTCAGCTGGGG + Intergenic
919541806 1:198856585-198856607 TTGTATGTTTAGAAAAGGAGAGG + Intergenic
919725651 1:200881363-200881385 TGGTATATTTATAAAAGCAGAGG - Intergenic
921122929 1:212152394-212152416 TGGTAGCCCCAGATAAGCAGCGG + Intergenic
921721426 1:218476036-218476058 TGGAATTTTCAGATAAGCCCTGG - Intergenic
1067992281 10:51228278-51228300 TAGAATGTTCAGAGAAGCTGAGG + Intronic
1068996205 10:63207782-63207804 TGGCATGTGGAGAAAAGCAGCGG - Exonic
1071561831 10:86651443-86651465 TGGTATGTGGGGATAAGAAGTGG - Intergenic
1077522799 11:3046283-3046305 TGGTACGTCCAGCTCAGCAGTGG - Intronic
1078198893 11:9161503-9161525 TGGTAGGGTCATTTAAGCAGTGG - Intronic
1082111330 11:48278924-48278946 TTGTTTGTTCAGACAAGCAGTGG - Intergenic
1089644180 11:119867174-119867196 TGGTATATACACATAAGGAGGGG - Intergenic
1092470923 12:8779989-8780011 TTGTATGCCCATATAAGCAGTGG - Intronic
1093577346 12:20748345-20748367 TTGTATGCTCAGAGAAACAGAGG - Intronic
1093625562 12:21343073-21343095 TGGAATCTTCAGTTTAGCAGAGG + Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1111166121 13:84459342-84459364 TGGTATTTTTACATATGCAGAGG - Intergenic
1111464364 13:88589270-88589292 TGCTATCTCCAGATTAGCAGAGG - Intergenic
1113318550 13:109209249-109209271 TCGCATGTTCAGAGAAGAAGGGG + Intergenic
1114103578 14:19400038-19400060 TGGTGTGTTCAGATTGGCAACGG - Intergenic
1114594573 14:23900318-23900340 TTGTATGTTCAGAGACACAGAGG + Intergenic
1114844257 14:26301776-26301798 TGATATGTGCATAGAAGCAGGGG + Intergenic
1116093363 14:40336588-40336610 TGTTCTGTTCATATGAGCAGGGG + Intergenic
1120532110 14:85644406-85644428 TGGTATGATAAGATAATCAAGGG - Exonic
1121548032 14:94777031-94777053 TGGTTTCTGCACATAAGCAGTGG - Intergenic
1127422647 15:58822387-58822409 TGGTATGGTCAGGTACCCAGAGG + Intronic
1127658376 15:61076856-61076878 TGAACTGTTCAGCTAAGCAGAGG + Intronic
1128611466 15:69076981-69077003 TGTTATGATCAGATAAGCCTGGG + Intergenic
1128674840 15:69600895-69600917 TGTAATGTTCAGGTCAGCAGAGG - Intergenic
1128851488 15:70962208-70962230 AGAAATGTTCAGATAAGCAAGGG + Intronic
1132766832 16:1538632-1538654 TGCAATGTTTAGAGAAGCAGAGG + Intronic
1137804189 16:51287956-51287978 TGGAAGGTTCAGGTAGGCAGAGG + Intergenic
1137834279 16:51575654-51575676 TAGTATATTAAGAAAAGCAGAGG + Intergenic
1140215462 16:73003775-73003797 TGGTATGGTCAGAAATGCAGAGG + Intronic
1140258777 16:73359304-73359326 TGGCATGTGCAGAGAAGCAGAGG + Intergenic
1141289719 16:82706531-82706553 TGTAATGTTCAGAAATGCAGAGG + Intronic
1142210792 16:88807580-88807602 TGTTCTGTTCAGATGTGCAGTGG + Intronic
1144295397 17:13870412-13870434 TGGTGTGATCACTTAAGCAGTGG - Intergenic
1148442711 17:47720084-47720106 TGGGATGTTCAGCACAGCAGGGG - Intergenic
1150505167 17:65691305-65691327 TTTTATGTCCAGATAAACAGTGG + Intronic
1152144521 17:78560350-78560372 CGGAAAGTTCAGATGAGCAGAGG - Intronic
1155651816 18:28152407-28152429 TGGGAGGTTAAGATATGCAGAGG + Intronic
1163312335 19:16521948-16521970 TGGTTTATTCAGACATGCAGCGG + Intronic
1164171271 19:22727593-22727615 AGGTATGTTCAGAAAAGAAAGGG + Intergenic
925771633 2:7288051-7288073 TGATATGTTTAGAAAAGCTGGGG - Intergenic
926419375 2:12681847-12681869 TGGTATGTTGAGAGACACAGTGG + Intergenic
926784456 2:16506790-16506812 GGGTAGTTTCAGATGAGCAGAGG - Intergenic
928363165 2:30681664-30681686 TGGTAGGGTCAGATAAGCAGGGG - Intergenic
930027019 2:47035115-47035137 TGGTATATTCCAATGAGCAGGGG + Intronic
930530714 2:52584761-52584783 CTGTCTTTTCAGATAAGCAGGGG + Intergenic
931893516 2:66702612-66702634 CTATATATTCAGATAAGCAGGGG + Intergenic
932110206 2:68992432-68992454 TGCTGTGTTCAGAAAAGGAGAGG - Intergenic
944944465 2:204667204-204667226 TGGAATCTTCATAAAAGCAGGGG + Intronic
944959939 2:204860869-204860891 TCATATGTGCAGATTAGCAGTGG + Intronic
947282952 2:228476734-228476756 TAGTATGTTCAGCTAATCAGAGG + Intergenic
1174033422 20:47649979-47650001 GGTTATACTCAGATAAGCAGGGG - Intronic
1175082808 20:56435562-56435584 TGGAAAGTTCAAATAAGAAGGGG + Intronic
1175353341 20:58342554-58342576 TGGCATTTTCAGATATGCTGAGG - Intronic
1177284278 21:19028470-19028492 TGGTTTATTCACATAAGCAGAGG + Intergenic
1178473356 21:32914993-32915015 TTGTATTTTCAGTTATGCAGGGG - Intergenic
1178612268 21:34094539-34094561 TGGTATGCTCAGATTAGGACAGG - Intronic
1179245687 21:39632342-39632364 TGGTATGTTCAGATAAGCAGTGG + Intronic
1179327958 21:40368183-40368205 TGGCATGTTCAGAAAAGAAAGGG - Intronic
1185136617 22:49077157-49077179 TGGGATGTGCAGATGAGGAGTGG + Intergenic
955469952 3:59276211-59276233 TCGTATGTTCACATGAGAAGTGG + Intergenic
963237735 3:142972255-142972277 TGGTTAGTTCAGATAAGAAAAGG + Intronic
963507853 3:146209501-146209523 AGGTCTCTTAAGATAAGCAGTGG + Intronic
967298360 3:187987421-187987443 TGGCATGTTCAGAGACCCAGGGG - Intergenic
968866103 4:3212929-3212951 TGGTAGGTGCAGATGAGAAGGGG - Intronic
970389477 4:15593234-15593256 GGGAATGTTCAGAAAAGTAGTGG - Intronic
974791989 4:66703598-66703620 TGGGGTGTTGAGAAAAGCAGAGG - Intergenic
979434084 4:120668461-120668483 TGGCATGTAGAGGTAAGCAGAGG + Intergenic
982745411 4:159101180-159101202 TGGTATGAGGAGCTAAGCAGAGG + Intergenic
985165263 4:187087376-187087398 TTTTAGGTTCAGATAAGTAGAGG - Intergenic
986253828 5:6085274-6085296 TGGTATGATCAGATATGCTTGGG - Intergenic
987728303 5:21732872-21732894 TGTTATCTTCAGCTAAGCAAAGG + Intergenic
991435642 5:66595539-66595561 CGGTATGATCAGCTAAGCAGAGG - Intergenic
992027436 5:72684549-72684571 TGGACTGTTCTGACAAGCAGTGG - Intergenic
992680132 5:79144978-79145000 TGGTATGATCAGAAAAAGAGGGG + Intronic
993153276 5:84188463-84188485 TGGTGAGTTCTTATAAGCAGAGG - Intronic
994788813 5:104198482-104198504 TTGTATGTTTAGATACACAGTGG - Intergenic
996129278 5:119761940-119761962 TGGTATGTAGAGAGAAGTAGAGG + Intergenic
998270958 5:140706082-140706104 TGGGATGTTCAGACAAGAGGTGG - Exonic
998777974 5:145624159-145624181 TGGTATGCTCTGAGAAGCCGTGG - Intronic
999675954 5:154003068-154003090 TGGTACGTTCAGGTAAGAACAGG - Intronic
1000027629 5:157373754-157373776 TGGTATGTGCAGAGAAGAACTGG + Intronic
1004198226 6:13524764-13524786 TGGGCCCTTCAGATAAGCAGTGG + Intergenic
1005048170 6:21661717-21661739 TGATAACTTCAGAAAAGCAGAGG + Intergenic
1011861526 6:91763519-91763541 TGGTATGTTTAAAAAAACAGAGG - Intergenic
1014689188 6:124541294-124541316 TGTTTTGGTCAGATAAGCAAGGG + Intronic
1015439521 6:133232090-133232112 ATTAATGTTCAGATAAGCAGTGG - Intergenic
1023063100 7:36348124-36348146 TGGTTACTTCAGATAAGCATGGG + Intronic
1023502734 7:40867814-40867836 TGTTTTGGTCAGATAAGCACAGG - Intergenic
1023604166 7:41912733-41912755 TGCTATTTTCAGATAAAGAGCGG + Intergenic
1024700136 7:51898094-51898116 TGGGATGTTCTGAAAAGCTGAGG - Intergenic
1027437357 7:78178152-78178174 TGGTATGTTCAGTTCCTCAGGGG - Intronic
1028820106 7:95199400-95199422 TTATATATTCAGATAAGAAGGGG - Intronic
1029616990 7:101665291-101665313 GGGTATGGTCAGAAGAGCAGAGG - Intergenic
1030508382 7:110453508-110453530 GGGTTTGTTCAGAAAAGCTGAGG - Intergenic
1040289139 8:46115487-46115509 GGGTATGTTGAGGTAGGCAGAGG - Intergenic
1040290368 8:46121119-46121141 TGGTATGATCAGGAAGGCAGAGG - Intergenic
1040299825 8:46182133-46182155 TGGAATGTTCAGGCAGGCAGTGG - Intergenic
1040336649 8:46419415-46419437 GGGGATGTTCAGACAGGCAGAGG + Intergenic
1041393843 8:57372518-57372540 TGGGCTGTTCACATATGCAGTGG - Intergenic
1042740231 8:72035331-72035353 TGGTATGGTGAGAAAGGCAGTGG - Intronic
1046742001 8:117839383-117839405 TGGTATGGACACCTAAGCAGTGG - Intronic
1047803529 8:128334685-128334707 AGGTATTTTCAGAGAAGTAGAGG - Intergenic
1050553273 9:6766817-6766839 AAGAATGTTCTGATAAGCAGAGG - Intronic
1051649631 9:19308632-19308654 TGGTATCTTTTGATAAACAGGGG + Intronic
1055168265 9:73223334-73223356 TAGGATATTCAGATAAGCAAAGG - Intergenic
1057631907 9:96726026-96726048 TGCTATGTTCATATCTGCAGCGG - Intergenic
1057879648 9:98783459-98783481 TGGGATGATCACATAAGAAGGGG + Intronic
1059371387 9:113842076-113842098 TGGTATATTCATATAAGAAGAGG + Intergenic
1060011900 9:120051027-120051049 TGGTTTGAACAGGTAAGCAGTGG - Intergenic
1189418510 X:40834895-40834917 TGCTATGTTCACATCTGCAGCGG - Intergenic
1189459005 X:41221924-41221946 TGGGATATTCAGAGAAGGAGGGG + Intronic
1191874546 X:65782257-65782279 TGGTATTTTCAGATAATTATTGG + Intergenic
1191936748 X:66435208-66435230 TGGGAGGATCAGATAGGCAGAGG - Intergenic
1192321872 X:70096410-70096432 TGGTATGTGCAAATAAAGAGAGG - Intergenic
1192754027 X:74026540-74026562 TGGTAAGCTCTGAAAAGCAGAGG + Intergenic
1192767990 X:74162161-74162183 TGCTATGTTCATATTTGCAGCGG + Intergenic
1195054972 X:101135507-101135529 TGTTGTGTTCAGAAAAGCAAGGG + Intronic
1196121723 X:112058427-112058449 TGGTGTGAGCAGATAAGCTGGGG + Intronic
1197571391 X:128155309-128155331 TGGTATGTTTAGAAAATTAGTGG - Intergenic
1199722419 X:150551439-150551461 TGGTGTGTTCTTATAAGAAGGGG - Intergenic
1201247236 Y:12016610-12016632 TGGTATGGTAAGAAAAGCAAGGG + Intergenic