ID: 1179249956

View in Genome Browser
Species Human (GRCh38)
Location 21:39664308-39664330
Sequence GAGTACGGAGGTTTGGGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179249956_1179249963 -2 Left 1179249956 21:39664308-39664330 CCAGCCCCCAAACCTCCGTACTC 0: 1
1: 1
2: 1
3: 12
4: 190
Right 1179249963 21:39664329-39664351 TCTGCCTTCTACTGTGACTGTGG 0: 1
1: 0
2: 1
3: 23
4: 278
1179249956_1179249965 12 Left 1179249956 21:39664308-39664330 CCAGCCCCCAAACCTCCGTACTC 0: 1
1: 1
2: 1
3: 12
4: 190
Right 1179249965 21:39664343-39664365 TGACTGTGGCAGAAGCCACTTGG 0: 1
1: 0
2: 1
3: 17
4: 254
1179249956_1179249966 21 Left 1179249956 21:39664308-39664330 CCAGCCCCCAAACCTCCGTACTC 0: 1
1: 1
2: 1
3: 12
4: 190
Right 1179249966 21:39664352-39664374 CAGAAGCCACTTGGCCCCCGTGG 0: 1
1: 0
2: 1
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179249956 Original CRISPR GAGTACGGAGGTTTGGGGGC TGG (reversed) Exonic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
903536023 1:24066914-24066936 GAGTATGGAATTTAGGGGGCCGG + Intronic
904594011 1:31631816-31631838 GACTAAGGAGGTCTGTGGGCAGG - Intronic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
907223977 1:52927739-52927761 GAGTCCCGAGGTGTGTGGGCTGG + Intronic
909913940 1:81294503-81294525 GAGTACTGTTGATTGGGGGCTGG - Intergenic
909975508 1:82042063-82042085 GATTTGAGAGGTTTGGGGGCTGG - Intergenic
910840879 1:91560314-91560336 GGGTGCGGAGGGGTGGGGGCGGG - Intergenic
912669958 1:111616462-111616484 GAGTAAGGCGGTTAGGGGACAGG - Intronic
914900377 1:151708318-151708340 GAGGACTGGGGTGTGGGGGCAGG - Intronic
916065315 1:161131975-161131997 GAGAACGGAGGCTTGGGGAATGG - Intronic
917211764 1:172638950-172638972 GTGTCCTGTGGTTTGGGGGCTGG + Intergenic
920442216 1:205988897-205988919 GAGTAAGGACATTTGAGGGCCGG + Intronic
920551358 1:206864111-206864133 CAGCACTGAGGTTGGGGGGCAGG - Intergenic
921216027 1:212937356-212937378 GAGTTCTGATGTCTGGGGGCAGG + Intergenic
921381406 1:214528632-214528654 AAGAACTGAGGTATGGGGGCTGG + Intronic
923218034 1:231868186-231868208 GAGAACGGAGGGTTTGGGGCAGG - Intronic
924532873 1:244908191-244908213 GAGTATGGGGTTTTGGGAGCCGG + Intergenic
1070480583 10:76878717-76878739 GAGTCAGGGCGTTTGGGGGCTGG + Intronic
1071086343 10:81872684-81872706 GAGTACGGTGGCTTGGGATCTGG + Intergenic
1073476564 10:103757470-103757492 CAGGACGGAGGGTTGGGGGTAGG + Intronic
1073757419 10:106595504-106595526 GAGTATGGAGGTGTGGAGGGTGG - Intronic
1074413675 10:113248883-113248905 GAACACGGTGTTTTGGGGGCAGG - Intergenic
1074713740 10:116199307-116199329 GAGGAGGCAGGTTTGGGGTCCGG - Intronic
1077392411 11:2306265-2306287 GAGGCCGGAGGGGTGGGGGCAGG - Intronic
1078893164 11:15575736-15575758 GAGTACAAAGGTGTGGAGGCTGG + Intergenic
1080079227 11:28194845-28194867 GAAGACGGAGGTTAGGAGGCGGG - Intronic
1081687300 11:45051958-45051980 GAGGACGGATGTTTTGGGCCCGG + Intergenic
1081814526 11:45931010-45931032 CAGAATGTAGGTTTGGGGGCTGG + Intronic
1083630206 11:64091389-64091411 AGGTAGGGAGGTTGGGGGGCGGG + Intronic
1083749585 11:64753854-64753876 GAGTCCGGAGGCTTGGGGGATGG - Intronic
1084090217 11:66874841-66874863 GGGTGCAGGGGTTTGGGGGCTGG + Intronic
1084719369 11:70894499-70894521 GAGTAGGGGGGTTTAGTGGCTGG + Intronic
1085273506 11:75283833-75283855 GAGCAGGGAGTTGTGGGGGCAGG + Intronic
1089932830 11:122331570-122331592 GAGCAGGGAGGTTGGGAGGCAGG - Intergenic
1091633481 12:2179838-2179860 GTGTACAGTGGTTTGGAGGCAGG - Intronic
1091658183 12:2361084-2361106 GACTAGGAAGGTTGGGGGGCTGG + Intronic
1092461990 12:8695211-8695233 AAGTTCGGAGGTGTCGGGGCCGG - Intronic
1092485856 12:8901563-8901585 AAGAATTGAGGTTTGGGGGCCGG - Intergenic
1092814289 12:12299577-12299599 GGGTATGGAGTTTTGGGGCCGGG - Intergenic
1093214749 12:16349359-16349381 TAGTACGGGGGTTTGGGGGGAGG + Intronic
1095180588 12:39143469-39143491 AAGGGTGGAGGTTTGGGGGCGGG - Intergenic
1095946606 12:47757524-47757546 GAGGTGGGAGGTATGGGGGCCGG - Intronic
1096716101 12:53492736-53492758 GGGGAGGGAGGTTGGGGGGCAGG - Intronic
1097956860 12:65495285-65495307 GGGAACTGAGGGTTGGGGGCAGG + Intergenic
1098584006 12:72134765-72134787 AAGTAGGGAAATTTGGGGGCTGG + Intronic
1098881981 12:75926487-75926509 GGGCACAGAGGATTGGGGGCAGG + Intergenic
1099177776 12:79441609-79441631 GAGAACAGAGGGTTGGGGGCTGG - Intronic
1099388871 12:82053283-82053305 GAGAATGGAGGTTTGGAGACTGG - Intergenic
1100356602 12:93836869-93836891 GAGTGTGTAGGGTTGGGGGCAGG + Intronic
1101806297 12:108067186-108067208 GAGTAGGAAGAGTTGGGGGCTGG - Intergenic
1102419288 12:112791439-112791461 GAGTCCGGAGGGGTGGGGGACGG - Intronic
1102896452 12:116602120-116602142 GAGAGAGGAGGTTGGGGGGCGGG - Intergenic
1104048457 12:125180677-125180699 GAGTTTGCAGGGTTGGGGGCTGG - Intergenic
1104818046 12:131659933-131659955 GAGGATAGAGGTTTGGGGGATGG + Intergenic
1105021169 12:132817642-132817664 GAGTGTGGAGGTGTGGGGGGGGG - Intronic
1105021230 12:132817906-132817928 GAGTGTGGAGGTGTGGGGGGGGG - Intronic
1105021247 12:132817971-132817993 GAGTGTGGAGGTGTGGGGGGGGG - Intronic
1105535376 13:21260156-21260178 GTGTGCGCAGGTTGGGGGGCGGG + Intergenic
1107188091 13:37547383-37547405 GAGTCCAGAGGGTTGGTGGCTGG + Intergenic
1107989134 13:45802007-45802029 GAGTAAGAAAGTTTGGGGCCGGG + Intronic
1110703747 13:78580463-78580485 GAGTAGGGAGTTTTTGGGGAGGG - Intergenic
1113592051 13:111507956-111507978 GAGCACCGAGGCTGGGGGGCAGG - Intergenic
1115625968 14:35192222-35192244 AAGTACGAAGATTTGGAGGCAGG - Intronic
1116041436 14:39690991-39691013 GAGGACAGAGGTTTGGAGGAGGG - Intergenic
1119219935 14:72898405-72898427 GAGTAAAGAGGGATGGGGGCTGG - Intergenic
1120022605 14:79547684-79547706 CAGTAAGGAGGTTGGGGAGCTGG + Intronic
1120859988 14:89246499-89246521 GAGAAAGGAGGTGTGGGCGCTGG - Intronic
1121297756 14:92843382-92843404 AAGTATGGAAGTTTGGGGCCGGG - Intergenic
1122919829 14:104875431-104875453 GGCTCCTGAGGTTTGGGGGCAGG + Intronic
1123055152 14:105566042-105566064 GAGGACAGAGGTTTGGTGACAGG + Intergenic
1123079601 14:105685886-105685908 GAGGACAGAGGTTTGGTGACAGG + Intergenic
1125715012 15:41814730-41814752 GAGTGTGGAGGTATGTGGGCTGG + Exonic
1128550635 15:68596009-68596031 GAGTGTGGAGGGTCGGGGGCTGG + Intronic
1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG + Intronic
1132612831 16:825782-825804 AAGAACGGAGGGGTGGGGGCTGG - Intergenic
1132942228 16:2514012-2514034 GGGCACGAAGGTTTGCGGGCGGG - Exonic
1134073664 16:11275988-11276010 GGGGACGGGGGTTAGGGGGCTGG + Intronic
1134232257 16:12438125-12438147 GAGTGGGGAGGTGAGGGGGCAGG + Intronic
1134687531 16:16169346-16169368 CTGTCTGGAGGTTTGGGGGCAGG + Intronic
1137862520 16:51860948-51860970 GAGCACAGAGGCTTGGGAGCTGG - Intergenic
1141746494 16:85929875-85929897 GAGGAGGGCGGTATGGGGGCCGG - Intergenic
1146412154 17:32595845-32595867 GATTAGGGGGGTTTGGGGACAGG + Intronic
1147129297 17:38397176-38397198 GAGCACGGAGGTTTTAGGGAGGG + Intronic
1147767457 17:42846232-42846254 GAGGATGGAGACTTGGGGGCGGG + Intronic
1148264798 17:46217026-46217048 GAGTCCAGGGGTTAGGGGGCTGG + Intronic
1149401046 17:56296184-56296206 GAGTACGGAGGTGAGGGGGCAGG + Intronic
1150625172 17:66836694-66836716 GAGAGAGGAGGTTTGGGGGTGGG - Intronic
1151212908 17:72558239-72558261 GAATACAGAGGACTGGGGGCAGG - Intergenic
1151438638 17:74114217-74114239 GAGTCCGGGTGCTTGGGGGCCGG - Intergenic
1151766659 17:76136623-76136645 GGGTTTGGTGGTTTGGGGGCCGG - Exonic
1152110170 17:78353382-78353404 GAGTAAGGATGTTTGGGAGGGGG - Intergenic
1152985757 18:319090-319112 GAGTCGGGAGGTGTGGGGGATGG - Intergenic
1160659490 19:291509-291531 GAGGAGGGAGGGTTAGGGGCGGG + Intergenic
1161614501 19:5262545-5262567 AATTACAGAAGTTTGGGGGCTGG - Intronic
1163234428 19:16022569-16022591 GAATGGGGAGGTTTGGGGGCAGG + Intergenic
1164597127 19:29537694-29537716 GAGTAGGTGGGTGTGGGGGCGGG - Intronic
1165424861 19:35740137-35740159 AAGTTGGGAGGTTTGGGAGCGGG - Intronic
925370771 2:3343771-3343793 GAGTACAGAGCTGTGGGGCCGGG + Intronic
925409580 2:3632186-3632208 GAGCACTGAGATTTGGGGCCAGG + Intronic
925896941 2:8479719-8479741 AAGGAGGGAGGTTTGGGGCCTGG - Intergenic
926210554 2:10866424-10866446 GACTAAGGAGGCTTTGGGGCGGG - Intergenic
927062858 2:19440781-19440803 GAGGCAGGGGGTTTGGGGGCTGG - Intergenic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
929434651 2:41919243-41919265 GAGGGCAGAGGTTTGGGGGGTGG - Intergenic
929806739 2:45153039-45153061 CAGTAGGGAGGTGAGGGGGCAGG - Intergenic
931178104 2:59873593-59873615 GAGGAGGGAGGATTGGGAGCTGG + Intergenic
931447193 2:62336579-62336601 GAGCAGGGATGTTGGGGGGCGGG - Intergenic
932019723 2:68071506-68071528 GAGTACAAAAGGTTGGGGGCAGG + Intronic
935563636 2:104584296-104584318 GAGTAGGGTGGTTTGGTGGTGGG + Intergenic
936484786 2:112916570-112916592 GAGTTGGGAGGGTTGGAGGCAGG - Intronic
937269918 2:120642942-120642964 CAGCACGGGGGTTTCGGGGCAGG + Intergenic
937418340 2:121735243-121735265 GACTGCTGAGGTTTGGGGTCAGG - Intronic
937682877 2:124663578-124663600 GAGTATGGAGGTTGGGGGCTAGG + Intronic
938340920 2:130535944-130535966 GATTACGGAGGTTGGCAGGCAGG - Intergenic
938348910 2:130584765-130584787 GATTACGGAGGTTGGCAGGCAGG + Intergenic
938747540 2:134293927-134293949 GAGTAGGGAGGTAGGAGGGCTGG + Intronic
942980609 2:182076608-182076630 GAGTTAGGAGGTTTGGGGTGGGG - Intronic
947019607 2:225660312-225660334 GAGTAAGTAGTATTGGGGGCAGG - Intergenic
947076009 2:226346829-226346851 GAGTGCTGATGTCTGGGGGCAGG - Intergenic
947406986 2:229788617-229788639 GACTAGGCAAGTTTGGGGGCTGG - Intronic
948176886 2:235950469-235950491 TACTCCTGAGGTTTGGGGGCTGG + Intronic
948958931 2:241316436-241316458 GGGCTTGGAGGTTTGGGGGCTGG - Exonic
1169758726 20:9068741-9068763 GAGGAGGGAGGCTCGGGGGCAGG + Intronic
1172298633 20:33832144-33832166 GACAACGGAGGTATGGGGGCTGG - Intronic
1175189877 20:57204262-57204284 TAGTACGGAGAGCTGGGGGCTGG - Intronic
1175689466 20:61055098-61055120 GAGTACAGGGATTGGGGGGCAGG + Intergenic
1178193818 21:30319555-30319577 AAGTGAGGAGGTTTTGGGGCTGG + Exonic
1178804710 21:35829342-35829364 GAGGATAGAGGTGTGGGGGCAGG + Intronic
1179249956 21:39664308-39664330 GAGTACGGAGGTTTGGGGGCTGG - Exonic
1181688698 22:24546255-24546277 GAAAATGGGGGTTTGGGGGCCGG - Intronic
1182572483 22:31249399-31249421 GACTGAGGAGGTGTGGGGGCTGG - Intronic
1183505039 22:38203947-38203969 GAGTCAGGAGGGTTGGGGCCAGG + Intronic
949973346 3:9430369-9430391 GAGAAAGGAGGGTTGGGGGTGGG + Intronic
950156650 3:10726078-10726100 GGATACAGAGGGTTGGGGGCAGG - Intergenic
952735785 3:36690349-36690371 CAGCAAGGAGGTTTGGGGGACGG + Intergenic
954118170 3:48478596-48478618 GGGGACTGGGGTTTGGGGGCTGG + Intronic
954882573 3:53845990-53846012 GGGGCCGGAGGTTTGGGGCCGGG - Intronic
964154575 3:153569415-153569437 GCTTAAGGAGTTTTGGGGGCAGG - Intergenic
966426904 3:179789601-179789623 GAGGAGGGAGGATTTGGGGCAGG + Intergenic
967896171 3:194397544-194397566 AAGAACTGAGGTTTGGGAGCCGG + Exonic
968228736 3:196992006-196992028 GAGGACGGAGATTTGTGTGCAGG - Intronic
968360957 3:198146461-198146483 GAGTTCTGATGTTTGGGGGCAGG + Intergenic
968849068 4:3066045-3066067 GAGTAAGCAGCTTTCGGGGCTGG + Intergenic
980375987 4:131949609-131949631 GGGTATTGAGGTTTGGGGGTTGG + Intergenic
981938209 4:150256152-150256174 GATTCCGGAGGGGTGGGGGCCGG - Exonic
983288918 4:165775997-165776019 CAGTACGGGGGTTTGGGCTCAGG + Intergenic
983671990 4:170248084-170248106 GAGTACGGAGGAGAAGGGGCTGG + Intergenic
984074422 4:175157217-175157239 GAGAACGGAGGTTTGGCTGGGGG - Intergenic
989683313 5:44055180-44055202 GACTAGGGTGGTTAGGGGGCAGG + Intergenic
992190315 5:74285495-74285517 GGGTGGGGAGGTTTGGGGGCTGG - Intergenic
992812206 5:80400243-80400265 GTGTAAGGAGGTTTGGTGTCTGG + Intergenic
994245382 5:97471061-97471083 GAGTCCAGGGGTTTGGGGGGTGG + Intergenic
996245960 5:121263971-121263993 GATTCCGGAGGTTTTGGTGCGGG - Intergenic
996306784 5:122056074-122056096 AAGTTCAGAGGTTTGGGGACCGG - Intronic
997199034 5:131998610-131998632 GAGTATTGAGGTTAGGAGGCTGG - Intronic
1000689384 5:164296309-164296331 GAGTAGGGAGGGTTGGGGAGAGG - Intergenic
1002131126 5:177082280-177082302 GGGGAGGGAGGTGTGGGGGCTGG - Intergenic
1002649462 5:180681046-180681068 GAGTACAGAGGACAGGGGGCTGG + Intergenic
1015862442 6:137695082-137695104 GAATAGGCAGGTTGGGGGGCTGG + Intergenic
1018652151 6:166001607-166001629 GAGTTTGCAGGGTTGGGGGCTGG + Intergenic
1019259053 7:70193-70215 GAGTTCTGATGTTTGGGGGCAGG - Intergenic
1019409129 7:899020-899042 GAGTACGCAGGTGAGGGGGGCGG - Exonic
1023821943 7:43985484-43985506 GGGTGGGGAGGTGTGGGGGCAGG - Intergenic
1028159811 7:87473343-87473365 GAGTAAGCAGGTTTGGGAGTAGG - Intronic
1029750207 7:102538897-102538919 GGGTGGGGAGGTGTGGGGGCAGG - Intronic
1029768158 7:102638005-102638027 GGGTGGGGAGGTGTGGGGGCAGG - Intronic
1035339678 7:158152245-158152267 GAGTATGAAGGATCGGGGGCTGG + Intronic
1036646019 8:10611759-10611781 GTGTGGGGAGGTATGGGGGCCGG + Exonic
1037262802 8:17027221-17027243 GAGAACGGAGGGGCGGGGGCGGG - Exonic
1039601486 8:38842084-38842106 GGGTAAGGAGGAATGGGGGCGGG - Intronic
1040037955 8:42888758-42888780 GGGTGGGGAGGTTGGGGGGCGGG - Intronic
1040424390 8:47270528-47270550 GACCAAGGAGGTTTGGGGGCGGG - Intronic
1040753517 8:50740989-50741011 GAGGACGGAGGTTTGGAGAAGGG + Intronic
1041561649 8:59225728-59225750 GAGAACACAGGTTGGGGGGCTGG - Intergenic
1042281998 8:67064816-67064838 GAGTTATGAGGGTTGGGGGCGGG + Intronic
1047375677 8:124293947-124293969 GATTACCAAGGTTTGGGGGAGGG - Intergenic
1049406126 8:142452569-142452591 AAGTGCGGAGGGTCGGGGGCTGG - Intronic
1049571668 8:143372755-143372777 CAGTACAGGGGTTTGGGGGATGG + Intronic
1049575046 8:143386041-143386063 GAGTGGGGAGGGGTGGGGGCGGG + Intergenic
1053603375 9:39632447-39632469 GAGTGGGGAGGCTGGGGGGCAGG - Intergenic
1053861007 9:42386167-42386189 GAGTGGGGAGGCTGGGGGGCAGG - Intergenic
1054250163 9:62709977-62709999 GAGTGGGGAGGCTGGGGGGCAGG + Intergenic
1054323939 9:63703886-63703908 GAGTAAGGGGGGGTGGGGGCGGG - Intergenic
1054564273 9:66744506-66744528 GAGTGGGGAGGCTGGGGGGCAGG + Intergenic
1055055055 9:72015743-72015765 GGGTACGGGGATTTGGGGGCTGG + Intergenic
1058625192 9:106927224-106927246 CAGTACTGAGGTCTGGTGGCGGG - Exonic
1059269044 9:113060863-113060885 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1059270180 9:113066312-113066334 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1059271316 9:113071762-113071784 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1059272447 9:113077206-113077228 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1059273582 9:113082648-113082670 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061950733 9:133934589-133934611 GAGTTCTGATGTCTGGGGGCAGG - Intronic
1062070814 9:134554092-134554114 GAGCAGGGGGGTGTGGGGGCTGG + Intergenic
1062448043 9:136603988-136604010 GAGGAGGGAGGTCTGGGTGCTGG + Intergenic
1062480217 9:136747643-136747665 GAGGCTGGAGGTTTGGAGGCTGG - Intronic
1062488525 9:136792847-136792869 GGGCACAGAGGATTGGGGGCAGG + Exonic
1062745665 9:138210292-138210314 GAGTTCTGATGTTTGGGGGCAGG + Intergenic
1186371247 X:8949601-8949623 GAGCAGGGATGTTTGGGGACAGG + Intergenic
1193199886 X:78676433-78676455 GAGGATGGAGGTTTGGAGGAGGG - Intergenic
1193200058 X:78678605-78678627 GAGGATGGAGGTTTGGAGGAGGG + Intergenic
1198810955 X:140535926-140535948 GAGTTTGGAGGTTTGAGGACAGG - Intergenic
1199595610 X:149504094-149504116 GTGCACTGAGGGTTGGGGGCGGG - Intronic
1199598268 X:149525117-149525139 GTGCACTGAGGGTTGGGGGCGGG + Intronic