ID: 1179252845

View in Genome Browser
Species Human (GRCh38)
Location 21:39687471-39687493
Sequence GTGAAGACACTGACATTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179252840_1179252845 14 Left 1179252840 21:39687434-39687456 CCATCGGCCTTAGGAATCAGAAA No data
Right 1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG No data
1179252841_1179252845 7 Left 1179252841 21:39687441-39687463 CCTTAGGAATCAGAAATTAGCCT No data
Right 1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG No data
1179252839_1179252845 17 Left 1179252839 21:39687431-39687453 CCTCCATCGGCCTTAGGAATCAG No data
Right 1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG No data
1179252837_1179252845 23 Left 1179252837 21:39687425-39687447 CCACGGCCTCCATCGGCCTTAGG No data
Right 1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG No data
1179252836_1179252845 24 Left 1179252836 21:39687424-39687446 CCCACGGCCTCCATCGGCCTTAG No data
Right 1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179252845 Original CRISPR GTGAAGACACTGACATTTCA GGG Intergenic
No off target data available for this crispr