ID: 1179255689

View in Genome Browser
Species Human (GRCh38)
Location 21:39713352-39713374
Sequence CAGCCAGCCCACCATGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179255689_1179255695 9 Left 1179255689 21:39713352-39713374 CCCAGGTCATGGTGGGCTGGCTG No data
Right 1179255695 21:39713384-39713406 TGTTGCCATGGTTAGGTAGCAGG No data
1179255689_1179255692 -3 Left 1179255689 21:39713352-39713374 CCCAGGTCATGGTGGGCTGGCTG No data
Right 1179255692 21:39713372-39713394 CTGCATGGTCCTTGTTGCCATGG No data
1179255689_1179255693 2 Left 1179255689 21:39713352-39713374 CCCAGGTCATGGTGGGCTGGCTG No data
Right 1179255693 21:39713377-39713399 TGGTCCTTGTTGCCATGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179255689 Original CRISPR CAGCCAGCCCACCATGACCT GGG (reversed) Intergenic
No off target data available for this crispr