ID: 1179256043

View in Genome Browser
Species Human (GRCh38)
Location 21:39716112-39716134
Sequence ACTGAGACAGGTACTCACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179256043_1179256047 3 Left 1179256043 21:39716112-39716134 CCGCAGTGAGTACCTGTCTCAGT No data
Right 1179256047 21:39716138-39716160 TAGTTGCACCACTGCGGAGGAGG No data
1179256043_1179256045 -3 Left 1179256043 21:39716112-39716134 CCGCAGTGAGTACCTGTCTCAGT No data
Right 1179256045 21:39716132-39716154 AGTGCTTAGTTGCACCACTGCGG No data
1179256043_1179256046 0 Left 1179256043 21:39716112-39716134 CCGCAGTGAGTACCTGTCTCAGT No data
Right 1179256046 21:39716135-39716157 GCTTAGTTGCACCACTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179256043 Original CRISPR ACTGAGACAGGTACTCACTG CGG (reversed) Intergenic
No off target data available for this crispr