ID: 1179256044

View in Genome Browser
Species Human (GRCh38)
Location 21:39716124-39716146
Sequence GTGCAACTAAGCACTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179256044_1179256047 -9 Left 1179256044 21:39716124-39716146 CCTGTCTCAGTGCTTAGTTGCAC No data
Right 1179256047 21:39716138-39716160 TAGTTGCACCACTGCGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179256044 Original CRISPR GTGCAACTAAGCACTGAGAC AGG (reversed) Intergenic
No off target data available for this crispr