ID: 1179256047

View in Genome Browser
Species Human (GRCh38)
Location 21:39716138-39716160
Sequence TAGTTGCACCACTGCGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179256042_1179256047 4 Left 1179256042 21:39716111-39716133 CCCGCAGTGAGTACCTGTCTCAG No data
Right 1179256047 21:39716138-39716160 TAGTTGCACCACTGCGGAGGAGG No data
1179256043_1179256047 3 Left 1179256043 21:39716112-39716134 CCGCAGTGAGTACCTGTCTCAGT No data
Right 1179256047 21:39716138-39716160 TAGTTGCACCACTGCGGAGGAGG No data
1179256044_1179256047 -9 Left 1179256044 21:39716124-39716146 CCTGTCTCAGTGCTTAGTTGCAC No data
Right 1179256047 21:39716138-39716160 TAGTTGCACCACTGCGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179256047 Original CRISPR TAGTTGCACCACTGCGGAGG AGG Intergenic
No off target data available for this crispr