ID: 1179257061

View in Genome Browser
Species Human (GRCh38)
Location 21:39726371-39726393
Sequence CTGGGATAGTGGCATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179257054_1179257061 17 Left 1179257054 21:39726331-39726353 CCTGGGAGAAGAAAGATTGGAAG No data
Right 1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG No data
1179257052_1179257061 30 Left 1179257052 21:39726318-39726340 CCTCTAGTGGAGGCCTGGGAGAA No data
Right 1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179257061 Original CRISPR CTGGGATAGTGGCATGTGGA TGG Intergenic
No off target data available for this crispr