ID: 1179258453

View in Genome Browser
Species Human (GRCh38)
Location 21:39737881-39737903
Sequence GGGCCTTATGACCCACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179258446_1179258453 13 Left 1179258446 21:39737845-39737867 CCTCCAAGGGATGCGGCAGGACC No data
Right 1179258453 21:39737881-39737903 GGGCCTTATGACCCACAAACAGG No data
1179258447_1179258453 10 Left 1179258447 21:39737848-39737870 CCAAGGGATGCGGCAGGACCCTT No data
Right 1179258453 21:39737881-39737903 GGGCCTTATGACCCACAAACAGG No data
1179258451_1179258453 -8 Left 1179258451 21:39737866-39737888 CCCTTTCTGGAATGAGGGCCTTA No data
Right 1179258453 21:39737881-39737903 GGGCCTTATGACCCACAAACAGG No data
1179258444_1179258453 17 Left 1179258444 21:39737841-39737863 CCTTCCTCCAAGGGATGCGGCAG No data
Right 1179258453 21:39737881-39737903 GGGCCTTATGACCCACAAACAGG No data
1179258452_1179258453 -9 Left 1179258452 21:39737867-39737889 CCTTTCTGGAATGAGGGCCTTAT No data
Right 1179258453 21:39737881-39737903 GGGCCTTATGACCCACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179258453 Original CRISPR GGGCCTTATGACCCACAAAC AGG Intergenic
No off target data available for this crispr